CN105907754B - The anti-anthracnose molecular labeling of capsicum and application - Google Patents
The anti-anthracnose molecular labeling of capsicum and application Download PDFInfo
- Publication number
- CN105907754B CN105907754B CN201610405982.1A CN201610405982A CN105907754B CN 105907754 B CN105907754 B CN 105907754B CN 201610405982 A CN201610405982 A CN 201610405982A CN 105907754 B CN105907754 B CN 105907754B
- Authority
- CN
- China
- Prior art keywords
- capsicum
- anthracnose
- primer
- molecular labeling
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to field of molecular marker, and in particular to the anti-anthracnose molecular labeling of capsicum and application.The genetic distance of itself and flank SNP marker UN02856_633 are 3.468cM.Molecular labeling provided by the invention, which realizes, in seedling stage identifies the anti-anthracnose of the green fruiting period of pepper plant, substantially reduces breeding time, has saved manpower and material resources.
Description
Technical field
The present invention relates to field of molecular marker, and in particular to the anti-anthracnose molecular labeling of capsicum and application.
Background technique
Capsicum (Capsicum spp) also known as hot pepper, chilly, spicy, peppery eggplant etc. belong to Solanaceae (solanaceae) Capsicum
(Capsicum), China is the maximum country of pepper planting area, the world, and pepper anthracnose occurs more universal on capsicum, is
A kind of Major Diseases of pepper fruit are endangered, pepper anthracnose harm time is long, economic loss is big, in the weather item of high temperature and rainy
It is particularly acute under part.In China, the pathogen of pepper anthracnose is caused mainly there are 4 kinds: sharp spore anthrax-bacilus
Colletotrichum acutatum (Simmonds), red anthrax-bacilus C.gloeosporioides (Penz.) Penz.and
Sacc., stain anthrax-bacilus C.capsici (Syd.) Butler and Bisby and black anthrax-bacilus C.coccodes (Wallr.)
S.Hughes。
The easy pollution environment of chemical prevention, physical control highly energy-consuming and effect are unobvious in pepper anthracnose prevention and treatment, therefore
Cultivating disease-resistant variety is a kind of effective ways for preventing and treating anthracnose, it is general easily affected by environment using traditional breeding method and when
Between long, low efficiency, exploitation with the chain molecular labeling of disease-resistant gene, using molecular marker assisted selection breeding be developed recently rise
The high-efficient breeding means come.Some researches show that capsicum is different in green fruiting period and red fruit phase to the resistance of anthracnose, may be by more
The influence of a gene.Lin etc. (2007) has studied capsicum " 0038-9155 " (being derived by PBC932) to the resistance of sharp spore anthrax-bacilus
Heredity, the results showed that, green ripe fruiting period resistance by two complementary dominant gene co- controllings, red ripe fruiting period resistance by
The recessive gene control of two overlappings, and the resistant gene in the two periods is independent from each other.PBC80 (C.baccatum) exists
Green ripe fruiting period is controlled sharp spore anthrax-bacilus resistance by single recessive gene co4, and the resistance of red ripe fruiting period is then by a pair of dominant base
Because Co5 controls (Mahasuk et al., 2009b).Using Chinese Capsicum ' PBC932 ' to sharp spore anthrax-bacilus (bacterial strain Coll-
153) resistance has carried out Preliminary Genetic positioning, has further clarified its genetic development.Studies have shown that PBC932 is to anthracnose
Dominant inheritance is presented in resistance, and the main effect QTL all Primary Locations for controlling green ripe fruiting period and red ripe fruiting period resistance connect to No. 5 chromosomes
Between two molecular labelings of InDel and HpmsE116 of proximal end, at a distance of 9.4cM, and the resistance main effect of green fruiting period and red fruit phase
Gene linkage but not be located at same gene seat.It can be further fine fixed by the main effect QTL of Primary Location and disease-resistant sex-kink
Important foundation is established for the close linkage label of molecular marker assisted selection to develop in position.
Summary of the invention
The purpose of the present invention is to provide a kind of and anti-anthracnose Gene A nR of the green fruiting period of capsicumGOThe molecule mark of 5 close linkages
Note.
It is a further object of the present invention to provide a kind of methods using the anti-sense of molecular markers for identification pepper anthracnose.
It is according to the present invention to can be used for assisting anti-anthracnose AnRGOThe molecular labeling of 5 gene selects is obtained by following steps
?.
The present invention is test material with the BC4S1 group of pepper disease resistance kind PBC932 and susceptible variety 77013 and its building
Material studies the anti-anthracnose major gene resistance AnR of the green fruiting period of assisted Selection capsicumGO5 molecular labeling.Using SNP marker screening with
AnRGOThe molecular labeling of 5 gene linkages is marked using No. 5 ends of chromosome the two sides SSR and InDel chain with it is just navigated to
Note, by the comparison of its flag sequence on No. 5 chromosomes of capsicum CM334 and ZunLa genome database (http: //
Passport.pepper.snu.ac.kr/? t=PGENOME/；http://peppersequence.Genomics.cn/
Page/species/index.jsp), the physical locations for obtaining two labels, filter out have in parent between two labels it is polymorphic
Property KasPar label, filter out 64 KasPar primers altogether, by primary dcreening operation, wherein 8 showed in parents and group it is polymorphic
Property.By corresponding with the phenotype of BC4S1 group anti-anthracnose fruit surface Lesion size, the site and flank SNP marker are found
The distance of UN02856_633 is nearest, and genetic distance 3.468cM, physical location is about 221.3Mb.Existed using the molecular labeling
Anti- anthracnose identification is carried out in new group, can be effectively used to assistant breeding and be worked.
It is Y type that KasPar, which marks UN02856_633 parting in disease-resistant material PBC932, HEX fluorescence is issued, in susceptible material
Parting is X-type in material 77013, issues FAM fluorescence, two kinds of fluorescence are simultaneously emitted by F1.
KasPar primer for the anti-anthracnose of the green fruiting period of specificity screening capsicum of the invention, information are as follows.
It is an advantage of the invention that only being detected in seedling stage to the DNA of pepper plant, so that it may sentence not by Disease Resistance Identification
Capsicum break for the resistance of anthracnose, molecular mark can be widely applied to.
The present invention provides application of the molecular labeling UN02856_633 in pepper anthracnose Resistance Identification.
The present invention provides application of the molecular labeling UN02856_633 in capsicum annuum marker-assisted breeding.
Molecular labeling provided by the invention, which realizes, in seedling stage identifies the anti-anthracnose of the green fruiting period of pepper plant, greatly shortens
Breeding time, has saved manpower and material resources.By being waited for using specific primer provided by the invention using KasPar system detection
Survey capsicum genomic DNA: KasPar marks UN02856_633, and genotyping result is X-type in capsicum Susceptible parent, issues blue
Fluorescence, parting is Y type in disease-resistant parent, issues green fluorescence；Genotyping result is heterozygous in F1, issues two kinds of fluorescence.It is logical
The green fruiting period resistance toanthracnose of capsicum can be identified by crossing this KasPar molecular labeling, improve breeding efficiency.Compare state
The inside and outside other molecular labelings having found, SNP marker UN02856_633 of the invention and the anti-anthracnose base of the green fruiting period of capsicum
Because of AnRGO5 is even closer chain, and genetic distance is respectively 3.468cM, significant in the anti-anthracnose breeding of capsicum.
Detailed description of the invention
Fig. 1 shows that the SSR marker just positioned and InDel are marked in BC4S1 population segment single plant amplification.(a)InDel
Label, (b) SSR marker.Note: M:50bp marker；A: identical as disease-resistant parent's band；B: identical as Susceptible parent band；H:
Contain susceptible and disease-resistant parent's band.
Fig. 2 shows SSR marker, InDel label and KasPar label and major gene resistance AnRGO5 linkage relationship.
Specific embodiment
Following embodiment further illustrates the contents of the present invention, but should not be construed as limiting the invention.Without departing substantially from
In the case where spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, the present invention is belonged to
Range.
Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art.
The present invention using pepper disease resistance kind PBC932 as male parent, susceptible variety 77013 be it is maternal and its using 77013 as time
Handing over parent to be selfed the BC4S1 group of generation building again in four generations of backcrossing is test material.
The anti-anthracnose cultivar identification of the green fruiting period of 1 capsicum of embodiment and and AnRGOThe molecular labeling of 5 gene close linkages
The acquisition of UN02856_633
1, capsicum Resistance Identification genetic group constructs
To contain sharp spore resistance toanthracnose major gene resistance AnRGO5 capsicum strain PBC932 (C.chinense) and it is susceptible from
Hand over based material 77013 (Capsicum annuum L.) be parents, hybridization obtain F1 after with four generation of 77013 continuous backcross of male parent,
It is selfed the BC4S1 of generation acquisition again as mapping population, totally 528 single plants.
2, the extraction of genomic DNA
Tender leaf is taken, the genomic DNA of all single plants of BC4S1, parent and F1 is extracted with CTAB method, it is micro- with Biospec-nano
Spectrophotometric determination concentration and quality are measured, by concentration dilution to 5ng/ μ l.
3, BC4S1 population resistance is identified
Anti- sharp spore anthrax-bacilus (bacterial strain Coll-153) inoculated identification, inoculation method are carried out to fruit when fruits/plant green ripe stage
It using needle point method, will be dried after the green ripe stage fruit washing and sterilizing of harvesting, puncture pericarp with micro syringe and inject 1 μ L concentration
For the spore suspension of 5 × 105/ml, each fruit is inoculated with 2-3 point according to fruit size, the fruit after inoculation is placed in paving
Have on the wet filter paper of sterilizing and by vaccination upward, be sealed in dark culture 2d in 26 DEG C of incubators with insulation film, after open guarantor
Warm membrane cover upper cover moisturizing 5d, humidity will be continuously maintained in 90% or more, then measure lesion diameter, Investigate incidence.Resistance
Identification of indicator is overall lesion diameter (O), overall lesion diameter (O)=all lesion diameters summation/inoculation points.Lesion diameter
Measurement standard be that the vaccination lesion diameter that do not fall ill is denoted as 0mm, the vaccination lesion diameter of morbidity is that scab is horizontal, vertical diameter
Average value.Compared with the scab data of group are carried out variance analysis etc. with the scab data of two parents, disease resistance is drawn
Minute mark is quasi-: immune (I): GO (green ripe fruit totality lesion diameter)=0；Highly resistance (HR): 0 < GO≤5；Disease-resistant (R): 5 < GO≤10；In
Anti- (MR): 10 < GO≤15；Susceptible (S): 15 < GO≤20；Height sense (HS): GO > 20.PBC932,77013,F1And BC4S1 is final
Identification strain number is respectively as follows: 14,14,8,528 plants.According to anti-sense standard, disease-resistant parent PBC932 and F1 show as it is disease-resistant, 77013
It all shows as susceptible.
4, KasPar marker development
Genotyping is carried out to BC4S1 group using SSR and the InDel label just positioned.
2 SSR and InDel primer information of table
With this 2 pairs of primer amplification BC4S1 groups totally 528 samples (result such as Fig. 1), exchange single plant is filtered out.Two marks
Note be it is codominant, susceptible individual is and the disease-resistant individual band that show as length different.
Utilize SNP marker screening and AnRGOThe molecular labeling of 5 gene linkages, using just navigate to No. 5 ends of chromosome with
Its chain two sides SSR and InDel label compares its flag sequence to capsicum CM334 and ZunLa genome database 5
(http://passport.pepper.snu.ac.kr/ on chromosome? t=PGENOME/；http://
Peppersequence.Genomics.cn/page/species/index.jsp), the physical location of two labels is obtained.Screening
There is the KasPar of polymorphism to mark in parent between two labels, filters out 64 KasPar primers altogether, by primary dcreening operation, wherein
8 show polymorphism in parents and group.Pass through the phenotype pair with BC4S1 group anti-anthracnose fruit surface Lesion size
It answers, it is found that the site is nearest at a distance from flank SNP marker UN02856_633, genetic distance 3.468cM, physical location is about
For 221.3Mb.Anti- anthracnose identification is carried out in new group using the molecular labeling, can effectively be used to assistant breeding work
Make.
Each pair of KasPar label contains 3 primer sequences: A1, A2, C.Wherein A1, A2 are only that the SNP site of end is deposited
In difference, at the 5 ' ends of A1, A2 respectively added with common joint sequence: 5 ' GAAGGTGACCAAGTTCATGCT3 ', 5 '
GAAGGTCGGAGTCAACGGATT3'.This two sections of joint sequences are complementary with the sequence of fluorescence is had in Master Mix, after pairing
Fluorescence can be excited, C is reverse complementary sequence, and the primer is in raw work synthesis.
5, polymorphism KasPar linked marker screens
Using parent DNA as template, polymorphism screening is carried out to KasPar primer, screens 8 marks with polymorphism altogether
Note, then analyzes BC4S1 group with the polymorphism mark screened, this 8 primers with green fruiting period major gene resistance AnRGO5
It is chain.Wherein label UN02856_633 is and the anti-anthracnose AnR of capsicumGO5 gene linkages are most closely positioned at point of gene flank
Son label.
KasPar primer premixes system (100 μ L): 12 μ L of site-specific primer A1, site specially 12 μ L of primer A2, altogether
With 30 46 μ L of μ L, ddH2O of primer C.
PCR amplification system (4 μ L): DNA (5ng/ μ L) 2 μ L, 2 × KASPar Mix 2 μ L, 0.055 μ L of primer mixed liquor.
Response procedures carry out under 384 module of 384 hole ABI PCR instruments and 480 II fluorescent quantitation instrument of Roche.
The application of 2 molecular labeling UN02856_633 of embodiment
It is being parent with capsicum PBC932 and 77013 using developed molecular labeling UN02856_633, is being with 77013
Resistance Identification is carried out in the BC4S1 group of backcrossing male parent building, identifies that 317 single plants, anti-sense phenotype ratio meet 3:1 separation altogether
Than being identified using molecular labeling UN02856_633, molecular data and phenotypic evaluation data are coincide.
The method of molecular labeling UN02856_633 identification capsicum point spore anthrax-bacilus resistance are as follows:
(1) DNA of BC4S1 group to be detected single plant is extracted；
(2) sharp spore anthrax-bacilus is inoculated with to BC4S1 group；
(3) using the DNA of extraction as template, gene is carried out to group using label UN02856_633 and KasPar system
Type parting；
(4) KasPar system detection genotyping result；Genotype is judged according to the different fluorescence of sending.(the reading of fluorescent value
In 480 II fluorescent quantitation instrument of Roche, carried out according to 37 DEG C of 1min, Read fluorescence 1s, according still further to Endpt
Fluorescent value is read in Geno analysis)
Claims (2)
1. flank SNP marker UN02856_633 is as the molecule with the anti-anthracnose Gene A nRGO5 close linkage of the green fruiting period of capsicum
The application of label, which is characterized in that the specific primer of the flank SNP marker UN02856_633 includes:
Preceding primer A1:5 ' AGAGAAGCCCAAAGAGCCCGAAAAA3 '；
Preceding primer A2:5 ' AGAGAAGCCCAAAGAGCCCGAAAAG3 '；
Primer C:5 ' TTTRGGCTTTGGAGGCTCCTTGGGC3 ' afterwards.
2. a kind of method for identifying the anti-anthracnose characteristic of capsicum, which is characterized in that the method includes using flank SNP marker
The step of specific detection primer of UN02856_633 is detected, the specific primer include:
Preceding primer A1:5 ' AGAGAAGCCCAAAGAGCCCGAAAAA3 '；
Preceding primer A2:5 ' AGAGAAGCCCAAAGAGCCCGAAAAG3 '；
Primer C:5 ' TTTRGGCTTTGGAGGCTCCTTGGGC3 ' afterwards.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610405982.1A CN105907754B (en) | 2016-06-10 | 2016-06-10 | The anti-anthracnose molecular labeling of capsicum and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610405982.1A CN105907754B (en) | 2016-06-10 | 2016-06-10 | The anti-anthracnose molecular labeling of capsicum and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105907754A CN105907754A (en) | 2016-08-31 |
| CN105907754B true CN105907754B (en) | 2019-03-26 |
Family
ID=56750933
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610405982.1A Active CN105907754B (en) | 2016-06-10 | 2016-06-10 | The anti-anthracnose molecular labeling of capsicum and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105907754B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111808984A (en) * | 2020-08-24 | 2020-10-23 | 中国农业科学院蔬菜花卉研究所 | SNP (Single nucleotide polymorphism) marker related to hot pepper cytoplasmic male sterility restoring gene, specific primer and application of specific primer |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100051981A (en) * | 2008-11-10 | 2010-05-19 | (주)고추와 육종 | Molecular marker linked to the major resistant gene to pepper anthracnose (colletotrichum acutatum) and its use |
| KR20110054921A (en) * | 2009-11-19 | 2011-05-25 | (주)고추와 육종 | 'p&b-ar6' line resistant to pepper anthracnose developed by interspecific backcross between capsicum annuum and c. baccatum |
| WO2014077464A1 (en) * | 2012-11-19 | 2014-05-22 | (주)고추와 육종 | Anthracnose-resistant varieties of capsicum annuum developed by interspecific hybridization, and primer set for screening same |
-
2016
- 2016-06-10 CN CN201610405982.1A patent/CN105907754B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100051981A (en) * | 2008-11-10 | 2010-05-19 | (주)고추와 육종 | Molecular marker linked to the major resistant gene to pepper anthracnose (colletotrichum acutatum) and its use |
| KR20110054921A (en) * | 2009-11-19 | 2011-05-25 | (주)고추와 육종 | 'p&b-ar6' line resistant to pepper anthracnose developed by interspecific backcross between capsicum annuum and c. baccatum |
| WO2014077464A1 (en) * | 2012-11-19 | 2014-05-22 | (주)고추와 육종 | Anthracnose-resistant varieties of capsicum annuum developed by interspecific hybridization, and primer set for screening same |
Non-Patent Citations (3)
| Title |
|---|
| 《A SNP-based genetic linkage map of Capsicum baccatum, and its comparison to the Capsicum annuum, reference physical map》;Ye R L等;《 Molecular Breeding》;20160531(第5期);全文 * |
| 《辣椒抗炭疽病QTL定位及分析》;孙春英等;《中国优秀硕士学位论文全文数据库农业科技辑》;20140215(第2期);全文 * |
| 《辣椒根结线虫抗性基因Mel的精细定位》;王学瑛等;《中国优秀硕士学位论文全文数据库农业科技辑》;20160115(第1期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105907754A (en) | 2016-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Stenglein et al. | Genetic diversity of Phaeoisariopsis griseola in Argentina as revealed by pathogenic and molecular markers | |
| Onfroy et al. | Cultural, molecular and pathogenic variability of Mycosphaerella pinodes and Phoma medicaginis var. pinodella isolates from dried pea (Pisum sativum) in France | |
| CN106011287B (en) | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN108913795B (en) | Southern rice black-streaked dwarf resistant locus qSRBSDV9 and molecular marking method thereof | |
| US11692201B2 (en) | Pepper plants with improved pest resistance | |
| US10316328B2 (en) | Melon plants with improved traits | |
| Bhattarai et al. | A novel grape downy mildew resistance locus from Vitis rupestris | |
| JP5587789B2 (en) | Markers genetically associated with tobamovirus resistance and their use in cucumber | |
| US20160165824A1 (en) | Root knot nematode resistance marker for tomato plant, root-knot nematode resistant tomato plant, production method for root-knot nematode resistant tomato plant, and screening method for root know nematode resistant tomato plant | |
| CN102770018A (en) | Cucumber vein yellowing virus (CVYV) resistant cucumber plants (Cucumis sativus L.) | |
| CN106244678B (en) | The molecular labeling of rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN106148510B (en) | Resistance gene of rice blast Pi5 specific Function molecular labeling and its application | |
| CN108697058A (en) | Peronospora resistance in spinach | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| Bisognin et al. | Mapping late blight resistance in Solanum microdontum Bitter | |
| Řepková et al. | Identification of Resistance Genes Against Powdery Mildew in Four Accessions of Hordeum Vulgare SSP. S pontaneum | |
| CN105907754B (en) | The anti-anthracnose molecular labeling of capsicum and application | |
| Miranda et al. | Genetic mapping of a Triticum monococcum‐derived powdery mildew resistance gene in common wheat | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN105907755B (en) | Molecular labeling and its application with capsicum anti cucumber mosaic virus close linkage | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| KR20220007592A (en) | Powdery Mildew Resistant Capsicum Plants | |
| Von Korff et al. | Genetic variation among Rhynchosporium secalis populations of West Asia and North Africa as revealed by RAPD and AFLP analysis | |
| Mulkey et al. | Development and characterization of simple sequence repeat markers for St. Augustinegrass | |
| CN108950049A (en) | The SNP marker and its application of bacterial spot of tomato close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |