CN105803047B - Molecular labeling and its application - Google Patents
Molecular labeling and its application Download PDFInfo
- Publication number
- CN105803047B CN105803047B CN201410834556.0A CN201410834556A CN105803047B CN 105803047 B CN105803047 B CN 105803047B CN 201410834556 A CN201410834556 A CN 201410834556A CN 105803047 B CN105803047 B CN 105803047B
- Authority
- CN
- China
- Prior art keywords
- fruit
- muskmelon
- base
- molecular labeling
- long
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses molecular labeling and its applications.Wherein, which shows as the insertion/deletion length polymorphism of nucleotide sequence shown in SEQ ID NO:1.The long character of the fruit base of a fruit of molecular labeling and muskmelon of the invention is closely related, can be effective for the molecular mark of muskmelon.
Description
Technical field
The present invention relates to molecular labeling and its applications.In particular it relates to the long relevant molecule mark of the melon fruit base of a fruit
Note, for detecting the primer pair and kit of the molecular labeling, previous molecular label, primer pair, kit are in muskmelon breeding
Purposes, detect the long character of the melon fruit base of a fruit method and muskmelon auxiliary breeding means.
Background technique
Muskmelon (Cucumis melo L.) is Curcurbitaceae Cucumis, is a kind of important garden crop, quotient with higher
Industry value and economic value.Existing more than the 3000 years melon wilt history in China, is the country for cultivating muskmelon earliest in the world
One, and current melon wilt area in the world is maximum, the highest country of yield.The fruit of muskmelon is sweet and dilitious, is that China is wide
The tradition fresh food fruit that the big both urban and rural residents is generally fond of.With the development of economy with the raising of living standards of the people, the country is to sweet tea
The demand of melon is growing.It is counted according to FAO (Food and Agriculture Organization of the United Nation) (FAO), muskmelon has entered the column of the big important fruit in the world ten.
Since its color has both, while again containing various composition necessary to human nutrition: carbohydrate, protein, fat,
Calcium, phosphorus, iron, carrotene, VC, VB, VB2, Vpp etc., especially VC content are more than more than ten times of the animal foodstuffs such as milk.Muskmelon
Pulp it is sweet in flavor, cold, sliding, there is the effect of quenching the thirst, relieving restlessness heat, diuresis；Its muskmelon pedicel can be used as medicine, name calyx meto.Muskmelon is used
Way extensively, can also be processed into melon dry, melon dried meat, melon sauce etc. other than it can directly eat.In world wide, status is even wanted
Higher than watermelon.
With the improvement of living standards with the diversity of fruit variety, requirement of the domestic consumer to melon and fruit quality be also more next
It is higher.Melon and fruit breeding is more and more diversified, to meet the market requirement.As muskmelon quality have crisp, crisp, soft, soft and succulence, it is soft and
Few juice etc., muskmelon pulp has the colors such as snow-white, orange red, emerald green, can be selected according to the hobby of different regions consumer.
In existing muskmelon breeding practice, to muskmelon Main Agronomic Characters be mostly by phenotype indirectly to genotype into
Row selection, causes breeding cycle long, and low efficiency restricts the process of melon variety improvement.Marker assisted selection, especially with
The associated functional molecular marker of objective trait carries out assisted Selection, traditional Phenotypic Selection can be changed into direct gene
Type selection accelerates genetic improvement so as to which the efficiency of breeding is greatly improved.And it finds and important economical character close linkage
Molecular labeling, be carry out molecular marker assisted selection (also known as molecular breeding) and map based cloning basis.Thus, exploitation has
The molecular labeling of the important character gene of China's characteristic simultaneously carries out assisted selection research, significant.
Muskmelon muskmelon pedicel (including shape, length, thickness etc.) is of great significance to muskmelon quality grading system.Meanwhile sweet tea
Muskmelon pedicel can be used as medicine, and the carpopodium cut is collected when edible, dries in the shade or dry by the mature melon fruit of summer harvesting
It is medicinal.Clinic name has muskmelon pedicel, melon fourth, calyx meto, muskmelon handle.Bitter, cold in nature, toxic, returns spleen, stomach meridian have emetic therapy phlegm place
Food, the functions such as water pouring clearing damp removing jaundice.What is be isolated to from muskmelon muskmelon pedicel at present has a Cucurbitacin B, E, D, isocucurbitacin B,
Cucurbitacin B-glucoside.Wherein, pharmacological action shows that Cucurbitacin B (cucurbitacin B) is the master of anti-hepatitis and anticancer
Want effective monomer.In addition, also containing hitodesterol, -3 β -ol of beans steroid -7- alkene in muskmelon muskmelon pedicel.Thus, it finds and muskmelon fruit
The DNA marker of the real long character close linkage of the base of a fruit, so using DNA marker auxiliary to muskmelon carry out the long character improvement of the fruit base of a fruit,
High-quality muskmelon breeding is significant.
However, the molecular labeling with the long gene close linkage of the melon fruit base of a fruit at this stage, still has to be excavated.
Summary of the invention
The present invention is directed at least solve one of the technical problems existing in the prior art.For this purpose, one object of the present invention
It is to propose that one kind is related to the long character of the melon fruit base of a fruit, it can be effective for the molecular labeling of muskmelon breeding.
It should be noted that the present invention is the following work based on inventor and completes: inventor is with muskmelon " gold honey six
Number " it is research object, by constructing breeding population, the deep gene informations such as RAD sequencing, Genotyping are carried out to group's single plant
Analysis, in conjunction with phenotypic evaluation information, using biology information technology association important character and genome sequence (based on current muskmelon
Genome sequencing is completed, and inventor has selected to instruct opening for SNP marker using muskmelon whole genome sequence information
Hair), it quickly located gene/QTL site of the control long character of the base of a fruit, and successfully develop the molecular labeling with its close linkage,
So as to provide theoretical foundation for the molecular mark of muskmelon.
According to an aspect of the present invention, the present invention provides a kind of long relevant molecular labelings of melon fruit base of a fruit.According to
The embodiment of the present invention, the insertion/deletion length that the molecular labeling shows as nucleotide sequence shown in SEQ ID NO:1 are polymorphic
Property.According to an embodiment of the invention, nucleotide sequence shown in SEQ ID NO:1 is following (668bp):
AAAGGCTCACCAACTCCACAACCGCTGTCTCGTATGTGTTGAGCGATACCACCCCCCGTACTCTCACC
CTCTTCAGACTAGAACGAACTCCCCATGGGGGGATAATACATGATTGTCACCCGGCCTCTCCTCCATGCCTCCTTG
GTGTCGACCGCCCCCCGTTGATCATCCCATCGTCATGTAGGAGACTTTTTGGCCACTGCCCCTGTTGTTACTTCCG
CTTGGGTAATTCCCGGCCCTTAATTCTCTAATAACATTTCCGGGAACCCTTGTTTCTTAAAAATTTTATATATTCC
GTCCCCACATTTTGCTCCAAAAAAATTTTACCTCATTTGTTTCTGGGCGGCTTTTCCCTTAAACCCTTACGAATTT
CCCCCCCCCACGGGATTGGGGGATTTTTTTAAGAAATTTTTGCGAAGTTATTTTCTGTTTTTTTTACACCCCCAAC
AAATATAATTAATGGGGGTCCCCCCCCTCCCCCGCATTTTTCCCCCATTCCCTGGTGGGGGGAATTTTTCCCAAAG
TGTTTTAGGACCTCCTGCTCCCCCCGAAATGTGGTGAGTGTAGAATCCTCTTCTGGGGATAGCGGCCTCGGGGACA
AATAGGGTGAGATGACCATCCTTTTCCCAAAAAAGGAAGGCCCTCCGCCCGTGGGGTTTAGGAGAGAA(SEQ ID
NO:1).Wherein, the genetic linkage distance of molecular labeling of the invention and the long control gene of the melon fruit base of a fruit is 4.368cM.
According to an embodiment of the invention, having nucleotide sequence shown in SEQ ID NO:1 and in the molecular labeling site
Homozygous individual, shows as the short base of a fruit；Lack nucleotide sequence shown in SEQ ID NO:1 and in the molecular labeling site homozygosis
Individual shows as the long base of a fruit.Wherein, there is nucleotide sequence shown in SEQ ID NO:1 and in molecular labeling site heterozygosis
Individual, the fruit base of a fruit are long (i.e. the fruit base of a fruit is long has between the long base of a fruit and the short base of a fruit) placed in the middle.
Wherein, it should be noted that term " the long base of a fruit " used by herein refers to that the base of a fruit is grown at 2 centimetres or more, " the short base of a fruit "
Refer to that the base of a fruit is grown at 1 centimetre hereinafter, " base of a fruit is long placed in the middle " refers to that the base of a fruit is grown at 1~2 centimetre.
Inventors have found that by detection muskmelon genomic DNA (its source is unrestricted, such as can be from the kind of muskmelon
Son, plant or pulp etc. extract) in whether there is above-mentioned molecular labeling, its long character of fruit base of a fruit can be effectively determined.Specifically
Ground, as previously mentioned, the melon fruit for not having the molecular labeling is the long base of a fruit, the melon fruit with the molecular labeling is the short base of a fruit
Or the base of a fruit is long placed in the middle, thus, when detecting that muskmelon does not have the molecular labeling, then it can determine that melon fruit to be measured is the long base of a fruit,
And when muskmelon has the molecular labeling, then it can determine that melon fruit to be measured is that the short base of a fruit or the fruit base of a fruit are long placed in the middle.Further, when
PCR amplification is carried out to muskmelon genomic DNA sample to be measured using the specific primer for the molecular labeling and gel electrophoresis is examined
When survey, by the item number and length of purpose band, the long character of the fruit base of a fruit of muskmelon to be measured can be effectively determined, specifically, when
Purpose band is one, and when the purpose band is about 1239bp, can determine that melon fruit to be measured is the short base of a fruit；When purpose item
Band is one, and when the purpose band is about 571bp, can determine that melon fruit to be measured is the long base of a fruit；When purpose band is two
Item, and when the length of the purpose band respectively about 571bp and 1239bp, it can determine that the fruit base of a fruit of muskmelon to be measured is long and occupy
In.Inventor determines that the long character of the fruit base of a fruit of molecular labeling and muskmelon of the invention is closely related as a result, can be effective for
The molecular mark of muskmelon.And then it can be according to demand long to the fruit base of a fruit in practical breeding, to muskmelon breeding material
Seedling selection is carried out, the efficiency and accuracy of breeding are further effectively improved, improves the genetic level of muskmelon reproductive population, thus
Muskmelon excellent variety can accurately and efficiently be selected.For example, using the specific primer of the molecular labeling to muskmelon base to be measured
Because a group DNA is expanded, gel electrophoresis, selects amplified production purpose band for one and be about the sample to be tested of 571bp
Easily screening obtains the muskmelon of long base of a fruit fruit, so as to directly apply to molecular breeding practice.
In addition, according to some embodiments of the present invention, carrying out muskmelon molecular labeling auxiliary using molecular labeling of the invention
Breeding, have the advantages that early screening, save the time, be low in cost, accuracy it is high.
According to another aspect of the present invention, the present invention also provides a kind of for detecting mentioned-above molecule of the invention
The primer pair of label.According to an embodiment of the invention, the primer pair has nucleotide sequence shown in SEQ ID NO:2-3.
Specifically, the sequence of primer pair of the invention is as follows:
5 '-GCGCCGTCGGCATTCTTATT-3 ' (SEQ ID NO:2)；
5 '-CCGTCGGAAAGTTATCGAAT-3 ' (SEQ ID NO:3).
According to an embodiment of the invention, carrying out PCR amplification to muskmelon genomic DNA to be measured using the primer pair, and examine
The length for surveying amplified fragments, as the long 1239bp of the amplified fragments, the muskmelon to be measured has nucleosides shown in SEQ ID NO:1
The insertion of acid sequence shows as the short base of a fruit；As the long 571bp of the amplified fragments, the muskmelon to be measured lacks SEQ ID NO:1 institute
Show nucleotide sequence, shows as the long base of a fruit；When the amplified fragments are 571bp and two kinds of 1239bp, the institute of the muskmelon to be measured
State molecular labeling site heterozygosis.When the amplified fragments are 571bp and two kinds of 1239bp, the melon fruit base of a fruit to be measured is long to be occupied
In.
According to an embodiment of the invention, detecting the amplified fragments using the preferred agarose gel electrophoresis of gel electrophoresis
Length.
It is surprisingly found by the inventors that can be effectively to the above-mentioned and fruit base of a fruit of muskmelon to be measured using primer pair of the invention
Segment where the relevant molecular labeling of long character carries out PCR amplification, and then can effectively be realized to this by sequencing or electrophoresis
The detection of molecular labeling, determines whether muskmelon to be measured has the molecular labeling.For example, being produced when passing through electrophoresis detection according to amplification
The quantity and length of object purpose band can effectively determine the long character of the fruit base of a fruit of muskmelon to be measured.Specifically, drawn using above-mentioned
Muskmelon Plants to be measured are carried out PCR amplification and when detected through gel electrophoresis by object pair, when purpose band is one, and the purpose item
When band is about 1239bp, it can determine that melon fruit to be measured is the short base of a fruit；When purpose band is one, and the purpose band is about
When 571bp, it can determine that melon fruit to be measured is the long base of a fruit；When purpose band be two, and the purpose band length difference
When being about 571bp and 1239bp, it can determine that the fruit base of a fruit of muskmelon to be measured is long placed in the middle.And the amplified production and 1239bp of 571bp
Amplified production compared to the sequence of missing be molecular labeling of the invention, thus molecule labelled series of the invention are located at
In the amplified production of 1239bp.It, can be effective as a result, for detecting the primer pair of mentioned-above molecular labeling of the invention
In the molecular mark of muskmelon, and then early stage can be assisted to realize short time, low cost, high accuracy ground breeding muskmelon
Excellent variety.
It should be noted that those skilled in the art are known, the sequence shown in above-mentioned SEQ ID NO:2 and SEQ ID NO:3
In column, 1~10 base can be increased separately at its 5 ' end or 3 ' ends, the increased base type of institute can be according to muskmelon genomic DNA
The base type in the upper region that matches with SEQ ID NO:2 and SEQ ID NO:3 simultaneously determines according to basepairing rule, thus
The amplified production of obtained primer pair and SEQ ID NO:2 and SEQ ID NO:3 are essentially identical (between upstream and downstream primer
DNA sequence dna is identical).Therefore, 1~10 base is increased separately simultaneously at the 5 ' ends of SEQ ID NO:2 and SEQ ID NO:3 or 3 ' ends
It can expand and obtain the primer pair of essentially identical DNA fragmentation, be included in primer pair of the invention.
According to another aspect of the invention, the present invention also provides a kind of for detecting the examination of mentioned-above molecular labeling
Agent box.According to an embodiment of the invention, the kit includes: being described previously for detecting the primer of molecular labeling of the invention
It is right.Include the primer pair with nucleotide sequence shown in SEQ ID NO:2-3 in kit i.e. of the invention.According to the present invention
Embodiment can effectively realize the above-mentioned and fruit to muskmelon to be measured using primer pair included in kit of the invention
The detection of the relevant molecular labeling of the real long character of the base of a fruit, determines whether muskmelon to be measured has the molecular labeling, and then can effectively really
The long character of the fruit base of a fruit of fixed muskmelon to be measured.Specifically, such as using above-mentioned primer pair to muskmelon genomic DNA to be measured PCR is carried out
When amplification and detected through gel electrophoresis, when purpose band is one, and the purpose band is about 1239bp, it can determine to be measured
Melon fruit is the short base of a fruit；When purpose band is one, and the purpose band is about 571bp, muskmelon fruit to be measured can be determined
The actually long base of a fruit；It, can be true when purpose band is two, and the length of the purpose band is respectively about 571bp and 1239bp
The fruit base of a fruit of fixed muskmelon to be measured is long placed in the middle.The examination for being used to detect mentioned-above molecular labeling of the invention of the invention as a result,
Agent box, can be effective for the molecular mark of muskmelon, and then early stage can be assisted to realize short time, low cost, height
Accuracy ground breeding muskmelon excellent variety.
In accordance with a further aspect of the present invention, the present invention also provides mentioned-above molecular labelings of the invention, primer pair
Or kit, the purposes in muskmelon breeding.As previously mentioned, of the invention with the long property of the melon fruit base of a fruit by can be used in detecting
The reagent of the relevant molecular labeling of shape, such as primer pair above-mentioned or the kit comprising the primer pair etc., can effectively really
Whether fixed muskmelon genomic DNA to be measured has above-mentioned molecular labeling.Such as when using the specific primer for being directed to the molecular labeling
When carrying out PCR amplification and detected through gel electrophoresis to muskmelon genomic DNA to be measured, according to the quantity and length of amplified production purpose band
Degree, can determine the long character of the fruit base of a fruit of muskmelon to be measured, effectively so as to effectively assist muskmelon breeding.
In turn, according to another aspect of the present invention, the present invention also provides a kind of sides for detecting the long character of the melon fruit base of a fruit
Method.According to an embodiment of the invention, this method carries out the detection of mentioned-above molecular labeling to muskmelon to be measured, so as to determine to
Survey the long character of the fruit base of a fruit of muskmelon.It specifically, can be of the invention with the long character phase of the melon fruit base of a fruit by can be used in detecting
The reagent of the molecular labeling of pass, such as primer pair above-mentioned or the kit comprising the primer pair etc., to the gene of muskmelon to be measured
Group DNA carries out PCR amplification, gel electrophoresis, thus according to the quantity and length of amplified production purpose band, can effectively determine to
Survey the long character of the fruit base of a fruit of muskmelon.Wherein, as previously mentioned, using above-mentioned primer pair or kit, Muskmelon Plants to be measured are carried out
It, specifically, can when purpose band is one, and the purpose band is about 1239bp when PCR amplification and detected through gel electrophoresis
With determination melon fruit to be measured for the short base of a fruit；When purpose band is one, and the purpose band is about 571bp, can determine
Melon fruit to be measured is the long base of a fruit；When purpose band be two, and the length of the purpose band be respectively about 571bp and 1239bp
When, it can determine that the fruit base of a fruit of muskmelon to be measured is long placed in the middle.The side of the detection long character of the melon fruit base of a fruit of the invention is utilized as a result,
Method, can quickly, efficiently and accurately detect the long character of the melon fruit base of a fruit, so can effective for muskmelon molecular labeling it is auxiliary
Breeding is helped, so as to assist early stage to realize short time, low cost, high accuracy ground breeding muskmelon excellent variety.
In addition, the method for the detection long character of the melon fruit base of a fruit according to the above embodiment of the present invention can also have it is following attached
The technical characteristic added:
According to an embodiment of the invention, the method for the long character of the detection melon fruit base of a fruit of the invention further comprises: utilizing
Mentioned-above primer pair or kit carry out PCR amplification to the muskmelon genomic DNA to be measured；Detect amplified fragments
Length；And the length based on the amplified fragments, determine the long character of the fruit base of a fruit of the muskmelon to be measured, wherein when the expansion
When increasing piece segment length 1239bp, the muskmelon to be measured is the short base of a fruit；As the long 571bp of the amplified fragments, the muskmelon to be measured is length
The base of a fruit；When the amplified fragments are 571bp and two kinds of 1239bp, the molecular labeling site heterozygosis of the muskmelon to be measured.By
This, whether the detection muskmelon to be measured for capableing of efficiently and accurately has molecular labeling of the invention, and then can be effectively based on detection
As a result the long character of the fruit base of a fruit of muskmelon to be measured is determined.
It is not particularly limited, can adopt according to an embodiment of the invention, extracting the method for obtaining muskmelon genomic DNA to be measured
It is carried out with any of genome DNA extracting method or kit.Some specific examples according to the present invention, using hexadecane
Base trimethylammonium bromide method (CTAB method) extracts the genomic DNA of muskmelon to be measured.Thereby, it is possible to effectively obtain high-quality, purity
High genomic DNA carries out convenient for subsequent step.
According to an embodiment of the invention, detecting the amplified fragments using the preferred agarose gel electrophoresis of gel electrophoresis
Length.It is convenient and efficient as a result,.
Inventors have found that the long method of the detection melon fruit base of a fruit of the invention can effective for muskmelon molecular labeling it is auxiliary
Breeding is helped, so as to assist early stage to realize short time, low cost, high accuracy ground breeding muskmelon excellent variety.
According to another aspect of the invention, the present invention also provides a kind of muskmelon auxiliary breeding means.It is according to the present invention
Embodiment, this method include detecting the molecular labeling by the method for the mentioned-above detection long character of the melon fruit base of a fruit, with
Just the long character of the fruit base of a fruit of the muskmelon to be measured is determined.Muskmelon auxiliary breeding means of the invention are utilized as a result, it can effectively really
Determine the long character of the fruit base of a fruit of muskmelon, and then can be realized short time, low cost, high accuracy ground breeding muskmelon excellent variety.
It should be noted that of the invention to the long relevant molecular labeling of the melon fruit base of a fruit and its using with following excellent
Point:
(1) the relevant molecular labeling of the long character of the melon fruit base of a fruit provided by the invention is not by the limit of the growth phase of muskmelon
System, can be used for the early stage breeding of muskmelon, can significantly promote the breeding process of muskmelon；
(2) method for detecting muskmelon relevant molecular labeling of the long character of the melon fruit base of a fruit as shown in SEQ ID NO:1, it is quasi-
It is really reliable, it is easy to operate；
(3) detection of muskmelon relevant molecular labeling of the long character of the melon fruit base of a fruit as shown in SEQ ID NO:1 is muskmelon
The marker assisted selection of growth traits provides scientific basis.
Additional aspect and advantage of the invention will be set forth in part in the description, and will partially become from the following description
Obviously, or practice through the invention is recognized.
Detailed description of the invention
Above-mentioned and/or additional aspect of the invention and advantage will become from the description of the embodiment in conjunction with the following figures
Obviously and it is readily appreciated that, in which:
Fig. 1 is shown according to an embodiment of the present invention, utilizes drawing with nucleotide sequence shown in SEQ ID NO:2-3
Object carries out the electrophoresis detection result figure of the amplified production of PCR amplification to the DNA of parent and first familiar generation；
Fig. 2 is shown according to an embodiment of the present invention, utilizes drawing with nucleotide sequence shown in SEQ ID NO:2-3
Object carries out the electrophoresis detection result figure of the amplified production of PCR amplification to the DNA of part F2 generation individual.
Specific embodiment
The embodiment of the present invention is described below in detail.The embodiments described below is exemplary, and is only used for explaining this hair
It is bright, and be not considered as limiting the invention.Particular technique or condition are not specified in embodiment, according to text in the art
Offer described technology or conditions (such as with reference to J. Pehanorm Brooker etc. write, " Molecular Cloning:A Laboratory guide " that Huang Peitang etc. is translated,
The third edition, Science Press) or carry out according to product description.Reagents or instruments used without specified manufacturer is
Can be with conventional products that are commercially available, such as can purchase from Illumina company.
1 F2 of embodiment is constructed for segregating population and character is investigated
(1) material
The male parent " K3-92-1 " and female parent " K1-7 " of the muskmelon " gold honey six " provided with Xinjiang Baofeng Zhong Ye Co., Ltd
For material, F2 is constructed for segregating population.
Male parent " K3-92-1 " is self-mating system, the average long 21.6cm of leaf, mean blade width 29.3cm, and pachydermia netted melon is pale yellow
Skin, fine and closely woven reticulate pattern, without line is covered, pulp salmon pink, the long base of a fruit, averagely list melon quality 2.4kg, fruit shape index 1.55, edge are soluble
Solid content 7.4%, center soluble solid content 11.9%.
Maternal " K1-7 " is excellent single melon system, average leaf made of one farm variety of Kazakhstan " sheepshead " selfed breeding
Long 24.1cm, mean blade width 34.5cm, thick-skinned melon, melon is larger, and carpopodium end is yellow green skin, and areola end is golden yellow skin, carefully
Dilute reticulate pattern, without line, pulp white is covered, the short base of a fruit, averagely list melon quality 3.0kg, fruit shape index 1.52, edge soluble solid contain
Amount 5.1%, center soluble solid content 7.5%.
(2) informative population
It is female parent with K1-7 (P1), is that male parent is hybridized that (male parent fruit muskmelon pedicel is long with K3-92-1 (P2)；Maternal fruit
Muskmelon pedicel is short), it obtains first-filial generation (F1), F2 group is obtained after stringent self-pollination, totally 500 single plants.
(3) character is investigated
In fructescence, according to retouching for " Germplasm Resources of Cucumis Melo L Description standard and data standard " (Ma Shuanwu etc., 2006)
It states, investigates the carpopodium length (base of a fruit is long) of each single plant of P1, P2 and F2 group, according to phenotypic evaluation as a result, calculating segregation ratio, use
2003 software of Microsoft Excel carries out data statistic analysis, carries out Chi-square statistic to result using SPSS17.0.
Character investigation result: having 199 plants of fruit bases of a fruit long in F1 group, 154 plants of fruit bases of a fruit are short, and segregation ratio is inferred close to 1:1
The character may be to be controlled by a pair of of major gene resistance and multiple minor genes.
Embodiment 2:SNP labeled analysis and genetic map are drawn
1, SNP marker analysis and genetic map building
1.1SNP labeled analysis
The tender leaf of parent " K1-7 " (P1), each single plant of " K3-92-1 " (P2) and F2 group in Example 1, with improvement
CTAB (cetyl trimethylammonium bromide) method extract genomic DNA, it is specific as follows:
Extract the genomic DNA of Parent, F1 generation and F2 generation individual respectively with CTAB method, the specific method is as follows:
(1) the fresh blade of 1.0g is weighed, shreds and is put into mortar, with 1.5 × CTAB of 3mL is added after liquid nitrogen grinding, is ground into
Homogenate is transferred in the centrifuge tube of 15mL, and 1.5 × CTAB of 1mL flushing is then added into mortar and is transferred in centrifuge tube again.After mixing
In 65 DEG C of water-bath 30min, during which slowly shake up frequently.
Wherein 1.5 × CTAB is formulated following (1L):
| CTAB | 15g |
| The Tris.Cl (pH 8.0) of 1mol/L | 75mL |
| The EDTA of 0.5mol/L | 30mL |
| NaCl | 61.4g |
Add deionized water to be settled to 1L, uses the preceding mercaptoethanol that final concentration of 0.2% (2ml) is added.
(2) it is cooled to room temperature, isometric chloroform/isoamyl alcohol (24:1) is added, mixes gently, until subnatant becomes dark green
Color.
(3) 4200rpm is centrifuged 10min, and upper strata aqueous phase is moved on to new 15mL centrifuge tube, adds the anhydrous of 2 times of volume pre-coolings
Ethyl alcohol mixes static 5min.DNA is precipitated in -20 DEG C of placement 30min.
(4) 4200rpm is centrifuged 10min, discards supernatant, and 75% ethanol washing of 1mL is added and precipitates 1 time, it is dry to be inverted centrifuge tube
200 μ L TE dissolving DNAs are added in dry DNA.
(5) genomic DNA is detected with 0.8% Ago-Gel.
(6) by the genomic DNA of obtained Parent and F1 generation, F2 generation individual be stored in -20 DEG C it is spare.
Then, 1 μ g genomic DNA is taken, is interrupted it at random with restriction enzyme, electrophoresis recycles the DNA of 400-600bp
Segment, be then based on Hiseq2000 high-flux sequence platform builds library strategy, constructs the genomic library of each sample, then
After various kinds Ben Wenku is mixed (each sample carries the label that do not allow mutually) by 2100 biological analyser of Agilent and
Hiseq2000 high-flux sequence platform carries out sequencing analysis.
According to identification sequence label obtain the sequencing reads of each individual, with SOAP2.20 software (reference can be made to: Li
R.et al., 2009a, SOAP2:an improved ultrafast tool for short read
Alignment.Bioinformatics, by referring to be incorporated by herein), with muskmelon DHL92 be (can with reference to genome
Referring to Garcia-Mas et al., 2012, The genome of melon (Cucumis melo L.), by referring to by its
Be incorporated by herein), carry out alignment, as a result with SAMtools 0.1.8,0.983 realSFS software conversion, analysis (can
Referring to: Li et al., 2009b, SNP detection for massively parallel whole-genome
Resequencing., by referring to be incorporated by herein), identify each site, then result be filtered, filter
Standard is 50≤depth≤2500, and site mutation probability >=95% obtains the SNP collection of high confidence level.It is reference, mistake with SNP collection
Filter obtains the genotype of parent and group.
The building of 1.2 genetic maps
A large amount of SNP causes to be difficult to construct Genetic linkage map, the Bin being composed according to continuous SNP to each label
Gene constructed Bin map can be simpler effective.
It according to the genotype of parent and group, selects with every 15 SNP as a window, slides a SNP every time, determine
The exchange site of the genotype of each window and each individual obtains the Bin genotype of each individual.Ready Bin base
Because of type data, using MSTMap software, graphing method selects Regression mapping algorithm, and mapping function selects Kosambi '
S function building genetic map ((reference can be made to: Wu et al., 2008, Efficient and accurate construction
Of genetic linkage maps from the minimum spanning tree of a graph., by referring to general
It is incorporated by herein).Chromosome serial number is added to name chromosome with abbreviation chr, as chr01 indicates No. 1 chromosome.
Wherein, analysing and comparing to sequencing result, the results are shown in Table 2, removes non-anchor sequence, in parents' sheet and
44722 SNP markers are detected in F2 group altogether, averagely each a length of 8.21Kb of SNP, the SNP quantity on every chromosome is not
Together, minimum with the SNP on o.11 chromosome, it is 1894, the SNP on No. 6 chromosomes is most, up to 5865；SNP is in each dye
Distribution on colour solid is from 1SNP/4.7Kb (No. 3 chromosome) to 1SNP/4.714.5Kb (No. 11 chromosome).After combined,
Common property gives birth to 2277 Bin segments in F2 group, and fragment length is differed from 20Kb to 4.83Mb, average length 138.95kb, structure
The Bin genetic map that total genetic distance is 1296.174cM is built, No. 10 chromosome maps are away from most short (77.997cM), No. 1 dyeing
Body map distance longest (143.278cM).In the genotype of entire F2 group whole, have 25.36% from male parent, 24.67%
From female parent, 49.96% is heterozygous, illustrate ratio of 3 kinds of genotype in total genotype close to 1:2:1 segregation ratio.
The distribution of SNP, Bin on 2 genetic map of table
| Chromosome | SNP | Bin | Genetic distance (cM) |
| chr01 | 3319 | 244 | 143.278 |
| chr02 | 3743 | 169 | 109.473 |
| chr03 | 5675 | 275 | 114.580 |
| chr04 | 3056 | 191 | 134.128 |
| chr05 | 4150 | 204 | 111.275 |
| chr06 | 5865 | 253 | 125.153 |
| chr07 | 4623 | 179 | 100.867 |
| chr08 | 2984 | 160 | 101.795 |
| chr09 | 3554 | 186 | 101.119 |
| chr10 | 2764 | 108 | 77.997 |
| chr11 | 1894 | 127 | 86.461 |
| chr12 | 3095 | 181 | 90.048 |
| Total | 44722 | 2277 | 1296.174 |
3, the assignment of genes gene mapping
Using winQTLCart2.5 software, the assignment of genes gene mapping is carried out using CIM (composite interval mapping method).Specifically: according to
The individual phenotype of F2 group, similar with male parent type character to be denoted as a, similar with maternal type character to be denoted as b, character occupy male parent
H is denoted as between female parent.The phenotypic datas of all individuals are obtained, by the phenotypic data of individual and the genotype number that before obtains
According to being compared, the assignment of genes gene mapping is carried out to carpopodium length (base of a fruit is long) character.The results show that the long gene of the fruit base of a fruit is by a main effect
Gene and the control of multiple minor genes, major gene resistance are located in No. 6 sections chromosome 7262900bp-7309599bp, length
About 46700kb, additive effect 0.6758, phenotypic variation explain rate as 0.1830.
4, molecular markers development
Parent is carried out to full-length genome and resurveys sequence (10X), according to genome sequencing as a result, utilizing SOAP software
(reference can be made to application link: http://soap.genomics.org.cn/, by referring to be incorporated by herein) compare survey
Then sequence reads finds the biggish molecular labeling of Fragment Differential with SOAPsv, identify convenient for being distinguished with gel electrophoresis.
As a result, selecting the label M060781 (nucleic acid shown in SEQ ID NO:1 close to section where the long gene of the fruit base of a fruit
Sequence) as candidate.
The nucleotide sequence of molecular labeling M060781 is as follows:
AAAGGCTCACCAACTCCACAACCGCTGTCTCGTATGTGTTGAGCGATACCACCCCCCGTACTCTCACC
CTCTTCAGACTAGAACGAACTCCCCATGGGGGGATAATACATGATTGTCACCCGGCCTCTCCTCCATGCCTCCTTG
GTGTCGACCGCCCCCCGTTGATCATCCCATCGTCATGTAGGAGACTTTTTGGCCACTGCCCCTGTTGTTACTTCCG
CTTGGGTAATTCCCGGCCCTTAATTCTCTAATAACATTTCCGGGAACCCTTGTTTCTTAAAAATTTTATATATTCC
GTCCCCACATTTTGCTCCAAAAAAATTTTACCTCATTTGTTTCTGGGCGGCTTTTCCCTTAAACCCTTACGAATTT
CCCCCCCCCACGGGATTGGGGGATTTTTTTAAGAAATTTTTGCGAAGTTATTTTCTGTTTTTTTTACACCCCCAAC
AAATATAATTAATGGGGGTCCCCCCCCTCCCCCGCATTTTTCCCCCATTCCCTGGTGGGGGGAATTTTTCCCAAAG
TGTTTTAGGACCTCCTGCTCCCCCCGAAATGTGGTGAGTGTAGAATCCTCTTCTGGGGATAGCGGCCTCGGGGACA
AATAGGGTGAGATGACCATCCTTTTCCCAAAAAAGGAAGGCCCTCCGCCCGTGGGGTTTAGGAGAGAA(SEQ ID
NO:1).
Embodiment 3: the fruit base of a fruit long range dependent verifying of molecular labeling
To the melon fruit base of a fruit long related molecular marker M060781 (core shown in SEQ ID NO:1 determined in embodiment 2
Acid sequence) it is verified, specific as follows:
For above-mentioned molecular labeling design primer, primer sequence is as follows:
Forward primer: 5 '-GCGCCGTCGGCATTCTTATT-3 ' (SEQ ID NO:2)；
Reverse primer: 5 '-CCGTCGGAAAGTTATCGAAT-3 ' (SEQ ID NO:3).
Using above-mentioned primer, the polymorphism and expansion of the label are verified by PCR amplification and agarose gel electrophoresis detection
Increase stability.
Specifically, using male parent, female parent, F1 generation or the genomic DNA in F2 generation extracted in embodiment 2 as template, in utilization
It states amplimer and carries out PCR amplification, wherein
PCR reaction system is as follows:
| Sterile water | 20.2μl |
| 10*Buffer (contains Mg2+) | 2.5μl |
| dNTPs(25mM) | 0.15μl |
| Taq enzyme (5U/ μ l) | 0.15μl |
| Forward primer | 0.5μl |
| Reverse primer | 0.5μl |
| Template | 1.0μl |
| Total volume | 25μl |
PCR response procedures are as follows:
94 DEG C initial denaturation 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, run 35 circulations；
Last 72 DEG C extend 3 minutes.Pcr amplification product can be saved at 4 DEG C.
Then, part is taken to carry out agarose gel electrophoresis detection, the result is shown in Figure 1 and Fig. 2 each pcr amplification product.Such as Fig. 1
Shown, male parent amplified production is the amplified fragments of 571bp size, and maternal amplified production is the amplified fragments of 1239bp size, miscellaneous
F1 generation is handed over then to contain the two amplified fragments simultaneously.The electrophoresis detection knot of the amplified production of part F2 generation individual is shown in Fig. 2
Fruit, the single plant of the long base of a fruit amplify the band of 571bp, and the single plant of the short base of a fruit amplifies the band of 1239bp, and the long person placed in the middle of the base of a fruit is then
Containing there are two amplified fragments.Thus, it was demonstrated that molecular labeling M060781 (nucleic acid sequence shown in SEQ ID NO:1) is in parent
There is polymorphism, which is closely related with the long character of the melon fruit base of a fruit between this.
Then, each amplified production is sequenced using 3730 sequenators, as a result, the expansion of male parent and F2 Dai Zhongchang base of a fruit single plant
Increase band, lacks a Duan Xulie compared with maternal and F2 is for the amplified band of short base of a fruit single plant, which is molecule above-mentioned
It marks M060781 (nucleic acid sequence shown in SEQ ID NO:1).
Wherein, male parent amplified fragments sequence (571bp) is as follows::
ACTAAGAAAATTAACGTTGCCGTTCTCTGTAAAAGCTTTCCAACGAATGATCCTGCTACTGTGGGTAA
CTGAGGAGGGGGACACTCTCTATTGAGACGATTATGCCGCTAATTCTCTGAGGATGTACGACGGGGACCTTCGGGC
CTTGGCCCAGATGAGCGGCCCTGCTGTGATAACGTAATTGGTGGGGTAAAGGCCCACCAACGCGACGATGGTGTTG
CACATGTATTGACCGCCCCACCCCGCTTATGCCACGGCATCAGACTCCTACGGGTGGCACGGGGGGGGAATTTGTA
TGATTGGCGGACCCTGAACCATCCATACCTCATGTCTGTGGCCGGCCTCCCGGCTGAAACGGCCAATAGTCATTGA
GGGGGACTTTTCGCTAACTGGCTGAAAGATCCTCCATTTCTTTGGGAGGTTCAGGGGCCAACTACGGGACATAAAT
ATTTTGTCTTACATTGGATGCGAGCGTTAAACACAAATTATTGGTGCATAATATAGGAAGATAAAAATTTTTTCTG
GCGGGGAAGTTGATTAAACAAGACTGACCCCGCAACACGCGCGCCAT (SEQID NO:4),
Maternal amplified fragments sequence (1239bp) is as follows:
ACCCAAAACTGTTCCGGTGCCCCCTCCATTAAAGCTTTCCAACCAATGAGCGTGGGAGGGAAGGGAAG
AGATAATAAGGACACTAATGTACGAGAAGGAATACCGCGACTATTTGAGGATGAGACCGGGGACCTTCGGGCCATG
CTCCTGACGAACACCCGCCTGGGATTATGTAGTTCGAGACGTAAAGGCTCACCAACTCCACAACCGCTGTCTCGTA
TGTGTTGAGCGATACCACCCCCCGTACTCTCACCCTCTTCAGACTAGAACGAACTCCCCATGGGGGGATAATACAT
GATTGTCACCCGGCCTCTCCTCCATGCCTCCTTGGTGTCGACCGCCCCCCGTTGATCATCCCATCGTCATGTAGGA
GACTTTTTGGCCACTGCCCCTGTTGTTACTTCCGCTTGGGTAATTCCCGGCCCTTAATTCTCTAATAACATTTCCG
GGAACCCTTGTTTCTTAAAAATTTTATATATTCCGTCCCCACATTTTGCTCCAAAAAAATTTTACCTCATTTGTTT
CTGGGCGGCTTTTCCCTTAAACCCTTACGAATTTCCCCCCCCCACGGGATTGGGGGATTTTTTTAAGAAATTTTTG
CGAAGTTATTTTCTGTTTTTTTTACACCCCCAACAAATATAATTAATGGGGGTCCCCCCCCTCCCCCGCATTTTTC
CCCCATTCCCTGGTGGGGGGAATTTTTCCCAAAGTGTTTTAGGACCTCCTGCTCCCCCCGAAATGTGGTGAGTGTA
GAATCCTCTTCTGGGGATAGCGGCCTCGGGGACAAATAGGGTGAGATGACCATCCTTTTCCCAAAAAAGGAAGGCC
CTCCGCCCGTGGGGTTTAGGAGAGAAAAAATCCGGTTCTCTATAAAAAAAAAAACCACAATTAATCACACCTTCCT
TACAGGAAAGTCGGGGATGGGTATTGGGGTTAAAAAAGGGGGGAATACCATCAACAATCCGCAAACCCCCAGGCCG
AGTGCTTGTCCTTTCGTTGTTCTGCCTAGTTGAACCAAAAATAATGTATAATAAGGAAGAGGAAAATAAAAACGCT
CCGCTGTGTGTGGCTACCTATGGAAACTGTGACCATTCTGTCGGGGGGGGAATGACAAAACACACCAAAAAAAACT
GGGGGGGGTTGGCATGCGGGAAACAGTAGGGGATTTATACCCAACAGGAAAAGAAGAAGATGGGTGTAGAGGAGGA
ATATATTGCCATAACATGCCGCGCGCGCCCC (SEQ ID NO:5).
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means specific features, structure, material or spy described in conjunction with this embodiment or example
Point is included at least one embodiment or example of the invention.In the present specification, schematic expression of the above terms are not
Centainly refer to identical embodiment or example.Moreover, particular features, structures, materials, or characteristics described can be any
One or more embodiment or examples in can be combined in any suitable manner.
Although an embodiment of the present invention has been shown and described, it will be understood by those skilled in the art that: not
A variety of change, modification, replacement and modification can be carried out to these embodiments in the case where being detached from the principle of the present invention and objective, this
The range of invention is defined by the claims and their equivalents.
Claims (3)
1. a kind of relevant molecular labeling of the long character of the melon fruit base of a fruit, which is characterized in that the nucleotide sequence of the molecular labeling
As shown in SEQ ID NO:1, with nucleotide sequence shown in SEQ ID NO:1 and in of the molecular labeling site homozygosis
Body shows as the short base of a fruit；Lack nucleotide sequence shown in SEQ ID NO:1 and in the individual of the molecular labeling site homozygosis, table
It is now the long base of a fruit.
2. a kind of method for detecting the long character of the melon fruit base of a fruit, which is characterized in that
The detection of molecular labeling described in claim 1 is carried out, to muskmelon to be measured to determine that the melon fruit base of a fruit to be measured is long
Character.
3. a kind of muskmelon auxiliary breeding means, which is characterized in that the described method includes:
By method as claimed in claim 2, molecular labeling described in claim 1 is detected, to determine melon fruit to be measured
The long character of the base of a fruit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410834556.0A CN105803047B (en) | 2014-12-29 | 2014-12-29 | Molecular labeling and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410834556.0A CN105803047B (en) | 2014-12-29 | 2014-12-29 | Molecular labeling and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105803047A CN105803047A (en) | 2016-07-27 |
| CN105803047B true CN105803047B (en) | 2019-03-01 |
Family
ID=56980702
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410834556.0A Active CN105803047B (en) | 2014-12-29 | 2014-12-29 | Molecular labeling and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105803047B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555717A (en) * | 2013-11-18 | 2014-02-05 | 新疆农业科学院哈密瓜研究中心 | Functional molecular markers of related genes of sweetness and sourness characters of muskmelon and application of markers |
| CN103740711A (en) * | 2014-01-29 | 2014-04-23 | 中国农业科学院蔬菜花卉研究所 | Indel marker linked with yellow flesh gene yf of cucmis sativus L. and application of Indel marker |
-
2014
- 2014-12-29 CN CN201410834556.0A patent/CN105803047B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555717A (en) * | 2013-11-18 | 2014-02-05 | 新疆农业科学院哈密瓜研究中心 | Functional molecular markers of related genes of sweetness and sourness characters of muskmelon and application of markers |
| CN103740711A (en) * | 2014-01-29 | 2014-04-23 | 中国农业科学院蔬菜花卉研究所 | Indel marker linked with yellow flesh gene yf of cucmis sativus L. and application of Indel marker |
Non-Patent Citations (4)
| Title |
|---|
| A set of EST-SNPs for map saturation and cultivar identification in melon;Wim Deleu et al.;《BMC Plant Biology》;20090715;1-9 |
| The genome of melon (Cucumis melo L.);Jordi Garcia-Mas et al.;《PNAS》;20120717;第109卷(第29期);11872-11877 |
| 甜瓜果实颜色3个质量性状基因的定位;杨光华 等;《园艺学报》;20140516;第41卷(第5期);898-906 |
| 甜瓜遗传图谱的构建及果实与种子QTL分析;王贤磊 等;《遗传》;20111231;第33卷(第12期);1369-1408 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105803047A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105802960B (en) | Molecular labeling and its application | |
| CN105385697B (en) | Sesame inflorescence finite basis is because of Sidt1 and its SNP marker | |
| CN105802962B (en) | Molecular labeling and its application | |
| CN105802961B (en) | Molecular labeling and its application | |
| CN107400721A (en) | With two InDel marks of cucumber yellow-white pericarp close linkage and application | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN106498048B (en) | One kind QTL relevant to soybean nodulation number, SNP marker and application | |
| CN106148526B (en) | One kind molecular labeling Hf1-Indel relevant to watermelon flesh hardness and its application | |
| CN107937397A (en) | SNP marker and its preparation method and application with tomato male sterility gene close linkage | |
| Kumar et al. | Microsatellite based DNA fingerprinting and assessment of genetic diversity in bougainvillea cultivars | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| CN105177129B (en) | Sesame anti-blight gene compact linkage molecule marks SiFWR2145 | |
| CN105803047B (en) | Molecular labeling and its application | |
| CN110527741A (en) | A kind of molecular labeling, primer and application with american pumpkin mildew-resistance biological strain 2F gene close linkage | |
| CN105483281B (en) | It is a kind of to be used to identify glutinous No. 1 SNP marker of five firework of waxy corn Shanghai and its identification method | |
| CN105821135B (en) | Molecular labeling and application with muskmelon downy mildew resistance gene close linkage | |
| CN114875168A (en) | InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof | |
| CN105713983B (en) | A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN106244683B (en) | Primer for detecting " Qiong Li " small watermelon purity of hybrid combines and its methods and applications | |
| CN110453007A (en) | It is a kind of for the SSR primer sets of red clover analysis of genetic diversity and its application | |
| CN112575101A (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN114634991B (en) | InDel marker for identifying high-variety coconuts and application thereof | |
| CN110423838A (en) | The molecular labeling of main effect QTL section close linkage related to corn seed keeping quality is located at and its application | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 518124 Peng Peng Road, Dapeng office, Dapeng New District, Shenzhen, Guangdong 7 Applicant after: Shenzhen Huada Sansheng Garden Technology Co., Ltd. Applicant after: Shenzhen Huada Academy of life science Applicant after: Sanya Nanfan Science Technology Institute Address before: 518083 science and Technology Pioneer Park, Beishan Industrial Zone, 146 Beishan Road, Yantian District, Shenzhen, Guangdong 604 Applicant before: SHENZHEN BGI AGRICULTURE AND CYCLE ECONOMIC TECHNOLOGY CO., LTD. Applicant before: BGI-Shenzhen Applicant before: Sanya Nanfan Science Technology Institute |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |