CN105803046A - Method for rapid screening of single copy transgenic offspring homozygous family and use thereof - Google Patents
Method for rapid screening of single copy transgenic offspring homozygous family and use thereof Download PDFInfo
- Publication number
- CN105803046A CN105803046A CN201410833434.XA CN201410833434A CN105803046A CN 105803046 A CN105803046 A CN 105803046A CN 201410833434 A CN201410833434 A CN 201410833434A CN 105803046 A CN105803046 A CN 105803046A
- Authority
- CN
- China
- Prior art keywords
- gene
- breeding
- oryza sativa
- primer
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of plant transgenosis and relates to a method for rapid screening of a single copy transgenic offspring homozygous family and a use thereof. A carrier is conversed through an agrobacterium-mediated genetic transformation method, a positive single copy transgenic plant is screened through southern, seeds of the T0 generation of the transgenic plant are collected and then are sowed in a seed bed, leaves in a trefoil stage are collected, total DNAs of a hand sample are extracted through a CTAB method, real-time PCR primers are designed according to an exogenous target gene hygromycin and an endogenous G3PDH gene, the hand sample DNA is subjected to real-time PCR through the primers of the exogenous target gene and the endogenous gene, amplification Ct values of the exogenous target gene and the endogenous gene are calculated and compared, a transgenic plant genotype is determined through the amplification Ct values, after the T1 generation of the plants produce fruits, a transgenic plant genotype is detected through germination, the above two transgenic plant genotypes are compared, and the two materials with the identical genotypes are used as transgenic breeding, hybridization transformation breeding or polygene pyramiding breeding materials.
Description
Technical field
The invention belongs to technical field of plant transgene, be specifically related to a kind of rapid screening list copy transgenic progeny and isozygoty the method for family and application, described application includes the application of Transgenic Rice breeding, hybridization transformation breeding or multiple gene polymerization breeding.
Background technology
Oryza sativa L. is the most important cereal crops of China, about supports the population of China about 60%.(Zambryskietal. since first case transgenic time nineteen eighty-three, TiplasmidvectorfortheintroductionofDNAintoplantcellswith outalterationoftheirnormalregenerationcapacity.EMBOJ, 1983,2:2143-2150), the research of plant genetic engineering achieves the progress advanced by leaps and bounds, and has become as an important method and technology in modern crop breeding process.Crop Improvement is gone to have a good application prospect in agricultural production by engineered means；Therefore, transgenic technology also will play the part of increasingly heavier role's (Zhang Qifa chief editor, the conception of green super hybridization rice and practice, Science Press, version in 2009) in the breed improvement and genetic breeding process of following Oryza sativa L..
Plant transgene breeding process (includes particle gun and the genetic transforming method of T-DNA mediation) or the later stage of transgenic line hybridizes the positive Seedling obtained in transformation and multiple gene polymerization breeding process and F1 hybrid is generally heterozygous state, therefore to obtain the positive material of stable heredity, we generally require and filter out family of isozygotying during the plantation of offspring, then carry out the work such as character observation again.nullThe method of screening homozygous plants has at present and mainly has three kinds，One is when there is no insertion point，Need individually to breed a generation，Seed is carried out Seed germination by results later，Statistics offspring's germination ratio on resistant gene，And then judge that this material is whether for the family (Chenetal. that isozygotys,Transgenicindicariceplantsharboringasyntheticcry2A*geneofBacillusthuringiensisexhibitenhancedresistanceagainstlepidopteranricepests.TheorApplGenet,2005,111:1330-1337；Tangetal.,Developmentofinsectresistanttransgenicindicaricewithasyntheticcry1C*gene.MolBreed,2006,18:1-10；Yeetal.,Developmentofinsect-resistanttransgenicricewithCry1C*-freeendosperm.PestManagSci,2009,65:1015-1020).；Two are, separate the flanking sequence of transgenic line insertion point, and then in segregating population the genotype (Yuanetal., MutationofthericegenePAIR3resultsinlackofbivalentformati oninmeiosis.PlantJ2009,59:303-315) of test material；Three is utilize the PCR method detection genotypic segregation ratio of offspring after a breeding generation, and then judge genotype (Yangetal., the Developmentandcharacterizationoftransgenicriceexpressing twoBacillusthuringiensisgenes.PestManagSci2011 of parent；67:414–422).But, above three kinds of methods have bigger defect, one be Seed germination and PCR method consuming time longer, it is necessary to individually spent 1 generation to breed, screening；Two is that in Seed germination process, seed quality and germinating power difference are bigger on germination percentage impact, it is easy to impact judges；Three is just do not have suitable resistance gene to use when the transgenic line of cultivation screening marker-free gene (Markerfree) is with multiple gene polymerization (resistant gene is identical), and then cannot be carried out Seed germination, at this time it is necessary for offspring is carried out large-scale PCR positive detection, genotype (Yangetal., the Developmentandcharacterizationoftransgenicriceexpressing twoBacillusthuringiensisgenes.PestManagSci2011 of previous generation parent is judged by adding up positive ratio；67:414–422)；Four are, the process separating flanking sequence is complicated, the quality and quantity of DNA is had high requirements, the extensive flanking sequence separating insertion point has very big difficulty, be not suitable for Large-scale Screening (Zhangetal., Non-randomdistributionofT-DNAinsertionsatvariouslevelsof thegenomehierarchyasrevealedbyanalyzing13804T-DNAflankin gsequencesfromanenhancer-trapmutantlibrary.PlantJ2007 in early days；.47,947–959).Therefore how quick and precisely to detect the genotype of transfer-gen plant, accelerate Transgenic Rice breeding significant.
The present invention utilizes the method having Real-timePCR, and at T1 for detecting the amplification curve of each individual plant genes of interest and Oryza sativa L. endogenous gene in family seedling stage, and then rapid screening goes out homozygous plants.By the invention it is possible to utilize a small amount of DNA just energy fast and easy to identify the genotype of plant in T1 generation, accelerate transgenic and pyramiding breeding process.
Summary of the invention
It is an object of the invention to overcome the deficiency of existing screening homozygous plants technology, a kind of rapid screening list copy transgenic progeny is provided to isozygoty the method for family and application, the present invention is by quickly, simply by minim DNA (concentration is about 40ng) seedling stage from T1 for segregating population screening homozygous plants, be expected to apply to transgenic breeding and the breed improvement of Oryza sativa L..For the ease of research and utilization, applicant obtains 20 strain transfer-gen plants by Agrobacterium-mediated genetic transformation, utilizes the copy number of the southern method validation transformed plant hybridized, it is thus achieved that 1,9 and 16 three list copies plant.Utilizing the method detection T1 of realtimePCR for the amplification curve of offspring's plant in seedling stage external source genes of interest and Oryza sativa L. source gene, screening homozygous plants, thus realizing the task of the present invention.Utilize the present invention, it is possible to utilize a small amount of DNA to carry out the genotype of quick testing goal gene at rice seedling, screen homozygous plants.Invention can solve the major defect of existing screening homozygous plants method, as big in length consuming time and workload, accelerates breeding process.
The concrete technical scheme of the present invention is as follows:
A kind of rapid screening list copy transgenic progeny is isozygotied the method for family, it is characterized in that, utilize agrobcterium-mediated transformation conversion carrier pCAMBIA1300, adopt southern method to filter out the positive and singly copy transformed plant, from T0 for transfer-gen plant is gathered in the crops seed, by presoaking and germinating and be seeded on seedbed, the sample blade on plant is taken seedling stage in SANYE, by CTAB method extracting sample genomic DNA, design real-timePCR primer with the nucleotide sequence of the endogenous G3PDH gene of external source genes of interest hygromycin gene and Oryza sativa L.；The primer pair sample DNA utilizing described external source genes of interest and described Oryza sativa L. source gene carries out real-timePCR detection, judges the genotype of transfer-gen plant by comparing the amplification Ct value calculating described external source genes of interest and described Oryza sativa L. source gene；At T1 for the solid genotype again being detected transfer-gen plant by Seed germination later, relatively whether the genotype results of above-mentioned two transfer-gen plant coincide, and selects the genotype results of two transfer-gen plants can coincide material as the breeding material of follow-up Transgenic Rice or paddy rice cross breeding transformation breeding material or Oryza sativa L. multiple gene polymerization breeding material；
Wherein,
The nucleotide sequence of described hygromycin gene is such as shown in sequence table SEQ IDNO:1；
Shown in the nucleotide sequence sequence table SEQ IDNO:2 of described G3PDH gene；
The nucleotide sequence of described primer is as follows:
The primers F (forward primer) of amplification hygromycin gene: CTGATAGAGTTGGTCAAGAC
Primer R (reverse primer): TACATGGCGTGATTTCATAT of amplification hygromycin gene
The primers F (forward primer) of amplification G3PGH gene: TTACATCTCTAGTCTCTTATG
Primer R (reverse primer): CTGGAACATTTATCTACCTA of amplification G3PGH gene
PCR program is as follows: 94 DEG C of 10sec；94 DEG C of 5sec, 60 DEG C of 34sec, 45 circulations
The present invention comprises the concrete steps that:
Agrobcterium-mediated transformation is utilized (to be provided by Australia's CAMBIA laboratory by carrier pCAMBIA1300, CenterfortheApplicationofMolecularBiologytoInternational Agriculture, CAMBIA) import and wild rice kind is spent 11 (from Institute of Crop Science, Chinese Academy of Agricultural Science).After obtaining transfer-gen plant, go out singly to copy plant by southern technology screening.T0 plants T1 for segregating population for after plant sowing in experiment field.At SANYE one heart stage water intaking rice blade, CTAB method after milling with Automatic Grinding Prototype, is adopted to carry out sample DNA extracting.Sample is dissolved in 100 μ lddH2O is standby.Utilizing BeaconDesigner software (http://www.premierbiosoft.com/molecular_beacons/index.html) to upper GAPDH (LOC_Os03g03720) the sequential design real-timePCR primer of hygromycin sequence and TIGR (http://rice.plantbiology.msu.edu/), primer sequence is in Table 1.First the specificity of detection primer amplification, what the meltability curve display hygromycin of real-timePCR product and G3PHD primer can be special amplifies target fragment.Carry out real-timePCR detection with above-mentioned two primer pair sample DNA, compare amplification curve and the Ct value of hygromycin and G3PDH, and then judge the genotype of plant.According to mendelian inheritance, the Ct value difference value of hygromycin gene and G3PDH gene has 3 classes, and corresponding is 3 kinds of genotype respectively, namely isozygotys, heterozygosis and negative (table 2).T1 is carried out Seed germination for seed simultaneously, judge the genotype of plant according to the germination percentage of seed, verify real-timePCR result with this result.Display real-timePCR is consistent with the result of Seed germination for experimental result, illustrates that the practicality of the present invention and reliability are fine.
It is an advantage of the current invention that:
(1) present invention is utilized, it is possible to utilize a small amount of DNA to carry out the genotype of quick testing goal gene at rice seedling, screen homozygous plants.Invention can solve the major defect of existing screening homozygous plants method, as big in length consuming time and workload, accelerates breeding process.
(2) present invention can be directly applicable to Transgenic Rice breeding, hybridization transformation breeding and multiple gene polymerization breeding.
Accompanying drawing explanation
Sequence SEQIDNO:1: be the nucleotide sequence of the riddled basins hygromycin gene (deriving from streptomyces hygroscopicus, Streptomyceshygroscopicus) contained in the external source genes of interest pCAMBIA1300 carrier in one of them embodiment of the present invention.
Sequence SEQIDNO:2: be derived from the nucleotide sequence of the G3PDH gene (Oryza sativa L., Oryzasativa) of Oryza sativa L., is to balance each sample DNA content height as reference gene.
Fig. 1: be the techniqueflow chart of the present invention.
The collection of illustrative plates of Fig. 2: pCAMBIA1300 carrier.
Fig. 3: be the meltability curve of hygromycin gene primer extension product.
Fig. 4: be the meltability curve of Oryza sativa L. G3PDH gene primer amplified production.
Fig. 5: each genotypic amplification curve of family 1 of the present invention.
Fig. 6: each genotypic amplification curve of family 9 of the present invention.
Fig. 7: each genotypic amplification curve of family 16 of the present invention.
Fig. 8: different genotype Seed germination result.
Fig. 9: be the nucleotide sequence of the riddled basins hygromycin gene contained in pCAMBIA1300 carrier, the italics part with underscore is real-timePCR design of primers site.
Figure 10: be the nucleotide sequence of Oryza sativa L. endogenous gene G3PDH, the italics part with underscore, for being real-timePCR design of primers site, is to balance each sample DNA content height as reference gene.
Detailed description of the invention
Embodiment 1: Agrobacterium-mediated genetic transformation
The method shown in " Agrobacterium-mediated genetic transformation workbook " that agrobcterium-mediated transformation is delivered referring especially to State Key Laboratory of Crop Genetic Improvent (support the army by woods, the foundation of the agriculture bacillus mediated No. 8 high-efficient transgenic systems in Mudanjiang, Acta Agronomica Sinica, 2002,28 (3): 294-300).Transformation receptor is the embryo callus spending 11 (Institute of Crop Science, Chinese Academy of Agricultural Science) the induced generation of mature seed in rice varieties.Through preculture, infect, co-culture, wash and screen after obtain the wound healing with hygromycin resistance, then through breaking up, take root, practicing Seedling and transplanting, obtain transfer-gen plant.The method of the key step of the genetic transformation of the present invention, culture medium and preparation thereof is as described below:
(1) reagent and solution abbreviation
Title and the abbreviation of main agents involved in culture medium process for preparation in the present invention are expressed as follows: 6-BA
(6-BenzylaminoPurine, 6-benzyladenine)；CN (Carbenicillin, Carbenicillin)；KT (Kinetin, kinetins)；NAA (Napthaleneaceticacid, naphthalene acetic acid)；IAA (Indole-3-aceticacid, heteroauxing)；2,4-D
(2,4-Dichlorophenoxyaceticacid, 2,4-dichlorphenoxyacetic acid)；AS (Acetosringone, acetosyringone)；CH (CaseinEnzymaticHydrolysate, caseinhydrolysate)；HN (HygromycinB, hygromycin)；DMSO (DimethylSulfoxide, dimethyl sulfoxide)；N6max(N6A great number of elements ingredient solution)；N6mix(N6Trace Elements solution)；MSmax (MS a great number of elements ingredient solution)；MSmix (MS Trace Elements solution)
(2) main solution formula
1)N6Culture medium a great number of elements mother solution (10 times of concentrated solutions (10X)):
Mentioned reagent is dissolved one by one, is then settled to 1000ml with distilled water under room temperature.
2) N6 culture medium trace element mother solution (100X):
Mentioned reagent is at room temperature dissolved and is settled to 1000ml with distilled water.
3) iron salt (Fe2-EDTA) stock solution (100X):
By 3.73 grams of disodiumedetate (Na2EDTA·2H2O) and 2.78 grams of FeSO4·7H2O dissolves respectively, and mixing is also settled to 1000ml with distilled water, and to 70 DEG C of temperature baths 2 hours, 4 DEG C saved backup.
4) vitamins stock liquid (100X):
Adding distilled water and be settled to 1000ml, 4 DEG C save backup.
5) MS culture medium a great number of elements mother solution (10X):
Mentioned reagent is at room temperature dissolved, and is settled to 1000ml with distilled water.
6) MS culture medium trace element mother solution (100X):
Mentioned reagent is at room temperature dissolved, and is settled to 1000ml with distilled water.
7) 2,4-D stock solution (1mg/ml):
Weigh 2,4-D100mg, dissolve 5 minutes with 1ml1N potassium hydroxide, be settled to 100ml after then adding the dissolving completely of 10ml distilled water, preserve under room temperature.
8) 6-BA stock solution (1mg/ml):
Weigh 6-BA100mg, dissolve 5 minutes with 1ml1N potassium hydroxide, after then adding the dissolving completely of 10ml distilled water, be settled to 100ml, room temperature preservation.
9) naphthalene acetic acid (NAA) stock solution (1mg/ml):
Weighing NAA100mg, dissolve 5 minutes with 1ml1N potassium hydroxide, be settled to 100ml after then adding the dissolving completely of 10ml distilled water, 4 DEG C save backup.
10) heteroauxing (IAA) stock solution (1mg/ml:
Weighing IAA100mg, dissolve 5 minutes with 1ml1N potassium hydroxide, be settled to 100ml after then adding the dissolving completely of 10ml distilled water, 4 DEG C save backup.
11) glucose storage liquid (0.5g/ml):
Weighing glucose 125g, then dissolve with distilled water and be settled to 250ml, after sterilizing, 4 DEG C save backup.
12) AS stock solution (200mM):
Weighing AS0.392g, add DMSO10ml and dissolve, subpackage is to 1.5ml centrifuge tube, and 4 DEG C save backup.
13) 1N potassium hydroxide:
Weighing potassium hydroxide 5.6g, dissolve with distilled water and be settled to 100ml, room temperature preservation is standby.
(3) for the culture medium prescription of rice transformation
1) inducing culture
Add distilled water to 900ml, 1N potassium hydroxide regulates pH value to 5.9, boils and is settled to 1000ml, being dispensed into 50ml triangular flask (25ml/ bottle), sealing sterilizing 25 minutes at latter 121 DEG C, following medium sterilization method is identical with the sterilizing methods of basal culture medium.
2) subculture medium
Add distilled water to 900ml, 1N potassium hydroxide and regulate pH value to 5.9, boil and be settled to 1000ml, being dispensed into 50ml triangular flask (25ml/ bottle), sealing, sterilizing as stated above.
3) pre-culture
Add distilled water to 250ml, 1N potassium hydroxide and regulate pH value to 5.6, sealing, sterilizing as stated above.
Using front heating for dissolving culture medium and add 5ml glucose storage liquid and 250 microlitre AS stock solutions, subpackage is poured into (25ml/ ware) in sterilizing culture dish.
4) base is co-cultured
Add distilled water to 250ml, 1N potassium hydroxide and regulate pH value to 5.6, sealing, sterilizing as stated above.
Using front heating for dissolving culture medium and add 5ml glucose storage liquid and 250 microlitre AS stock solutions, subpackage is poured into (the every ware of 25ml/) in sterilizing culture dish.
5) suspension medium
Add distilled water to 100ml, regulate pH value to 5.4, be dispensed in the triangular flask of two 100ml, sealing, sterilizing as stated above.
1ml sterile dextrose stock solution and 100 microlitre AS stock solutions are added before using.
6) Selective agar medium
Add distilled water to 250ml, regulate pH value to 6.0, sealing, sterilizing as stated above.
Dissolve culture medium before using, add 250 microlitre hygromycin (HN) (50mg/ml) and 400 microlitre Carbenicillin (CN) (250mg/ml) subpackages pour (25ml/ ware) in culture dish into.(note: first time Selective agar medium CN concentration is 400mg/ liter, second time and later Selective agar medium CN concentration are 250mg/l).
7) pre-division culture medium
Add distilled water to 250ml, 1N potassium hydroxide and regulate pH value to 5.9, sealing, sterilizing as stated above.
Dissolving culture medium before using, 250 microlitre HN (50mg/ml) 250 microlitre CN (250mg/ml), subpackage pours (25ml/ ware) in culture dish into.8) division culture medium
Add distilled water to 900ml, 1N potassium hydroxide and regulate pH value to 6.0.
Boil and be settled to 1000ml with distilled water, being dispensed into 50ml triangular flask (50ml/ bottle), sealing, sterilizing as stated above.
9) take root and Seed germination culture medium
Add distilled water to 900ml, regulate pH value to 5.8 with 1N potassium hydroxide.
Boil and be settled to 1000ml with distilled water, being dispensed into and take root (25ml/ pipe) in pipe, sealing, sterilizing as stated above.
(4) Agrobacterium-mediated genetic transformation step
1) wound healing induction
A. will ripe in spend 11 rice paddy seeds to shell, then successively with the Ethanol Treatment 1 minute of 75%, 0.15% mercuric chloride (HgCl2) the surface of the seed sterilize 15 minutes；
B. seed is washed 4-5 time with sterilizing；
C. seed is placed on inducing culture；
D., postvaccinal culture medium is placed in dark place cultivate 4 weeks, temperature 25 ± 1 DEG C.
2) wound healing subculture
Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put on subculture medium and cultivate 2 weeks under dark, temperature 25 ± 1 DEG C.
3) preculture
Select the embryo callus subculture of consolidation and relatively dry, be put on pre-culture and cultivate 2 weeks under dark, temperature 25 ± 1 DEG C.
4) Agrobacterium is cultivated
A. in the LA culture medium selected with kalamycin resistance, (formula of LA culture medium is shown in J. Pehanorm Brooker etc., Molecular Cloning: A Laboratory guide, the third edition, Jin Dongyan etc. (translate), Science Press, 2002, Beijing) go up preculture Agrobacterium EHA105 (agrobacterium strains that this bacterial strain openly uses) from CAMBIA company two days, temperature 28 DEG C；
B. Agrobacterium is transferred in suspension medium, 28 DEG C of shaking tables are cultivated 2-3 hour.
5) Agrobacterium is infected
A. pre-incubated wound healing is transferred in sterilized bottle；
B. the suspension concentration of Agrobacterium is regulated to OD6000.8-1.0；
C. wound healing is soaked 30 minutes in agrobacterium suspension；
D. transfer wound healing blots to the good filter paper of sterilizing；Then it is placed on to co-culture and base is cultivated 3 days, temperature 19-20 DEG C.
6) wound healing washing and selection are cultivated
A. wound healing is washed to cannot see Agrobacterium with aquesterilisa；
B. it is immersed in the aquesterilisa containing 400mg/lCN 30 minutes；
C. transfer wound healing blots to the good filter paper of sterilizing；
D. transfer wound healing selects to cultivate 2-3 time to Selective agar medium, each 2 weeks.
7) differentiation
A. kanamycin-resistant callus tissue is transferred on pre-division culture medium and cultivates 5-7 days in dark place；
B. shift the wound healing of pre-differentiation culture to division culture medium, cultivate under illumination (1500-2000Lux), cultivation temperature 26 DEG C.
8) take root
Cut the root that differentiation phase produces；It is then transferred in root media under illumination (1500-2000Lux) and cultivates 2-3 week, cultivation temperature 26 DEG C.
9) seedling exercising
Open point membrana oralis taking root on pipe, add tap water, be put in light culturing room or shady and cool place cultivates 1 week
10) transplant
Wash the remaining medium on root off, the seedling with good root system is proceeded to experimental plot, keep moisture to moisten at initial several days simultaneously.
Embodiment 2: the extraction of Oryza sativa L. sample genomic DNA
Take appropriate transgenic paddy rice (to kind not requirement, the present embodiment adopts in transgenic and spends 11, middle spending the original kind of 11 from Chinese agriculture institute crop science institute) T1 is for the young leaflet tablet of plant, through full-automatic sample grinder (Tissuelyser-48, the clean reliable industry Development Co., Ltd in Shanghai) mill after abandon steel ball, add 800 μ l1.5 × extract with CTAB liquid (15gCTAB；75ml1MTris-HCl,pH8.0；30ml0.5MEDTA,pH8.0；61.4gNaCl constant volume 1l, stirrer stirring and dissolving 2 hours)；65 DEG C of water-bath 30min；Add 600 μ l chloroforms/isoamyl alcohol (volume ratio 24:1) to turn upside down for several times (about 15min), till lower floor's liquid phase is dark green；The centrifugal 10min of 12000r/min under room temperature；Take 500 μ l supernatants in a new 1.5ml centrifuge tube, add 95% ethanol 1ml of pre-cooling, mix rearmounted-20 DEG C, 30min；Under room temperature, the centrifugal 10min of 12000r/min, removes supernatant, embathes precipitation, natural drying with 75% ethanol；Add 200 μ lddH2O dissolves, standby.Measure DNA concentration with NanoDrop2000 (ThermoScientific), be about 20-30ng/ μ l.
Embodiment 3:real-timePCR analyzes
Adopt Real-timePCR reaction kit carry out real-timePCR analysis (reaction kit purchased from precious biological engineering Dalian company limited,PremixExTaqTMTest kit).Primer synthesis is completed (Hn-F:CTGATAGAGTTGGTCAAGAC, Hn-R:TACATGGCGTGATTTCATAT by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd；G3PDH-F:TTACATCTCTAGTCTCTTATG, G3PDH-R:CTGGAACATTTATCTACCTA (table 1), be dissolved into 100 μMs of concentration, dilution 50 times to 2 μMs before using.Reaction system is: DNA, 2.4 μ l, and amount is about 50ng；2XSYBRbuffer (added with 50XROXReference0.2 μ l), 5.2 μ l；The each 1.2 μ l of left and right primer, reaction system is 10 μ l.Response procedures is 94 DEG C of 10sec；94 DEG C of 5sec, 60 DEG C of 34sec, 45 circulations.Dissolubility curve detection specific amplification is done after having reacted.Dissolubility curve display amplified production is unimodal, illustrates that primer amplification is special.
Embodiment 4: Seed germination
By ripe transgenic T1 generation (spending 11 in transgenic) seed after shelling successively with the Ethanol Treatment 1 minute of 75%, 0.15% mercuric chloride (HgCl2) the surface of the seed sterilizes 15 minutes, washes seed 4-5 time with sterilizing；Seed is placed on taking root and in Seed germination culture medium (formula see take root in embodiment 1 and Seed germination culture medium) added with 5mg/ml hygromycin；By postvaccinal take root and Seed germination culture medium be placed in illumination cultivation room cultivate 2 weeks (intensity of illumination is about 1600lx-2000lx, Light To Dark Ratio 16:8), temperature 25 ± 1 DEG C, statistics germination percentage.According to mendelian inheritance, isozygotying, heterozygosis and negative three kinds of genotype are germinateed in hygromycin culture medium and dead ratio is respectively as follows: 1:0,3:1 and 0:1, i.e. germination percentage is 100%, 75% and 0%.Statistical result showed, heterozygous plant Seed germination meets 3:1 segregation ratio (table 2).
Table 1real-timePCR primer sequence
Embodiment 4: Seed germination
By ripe transgenic T1 generation (spending 11 in transgenic) seed after shelling successively with the Ethanol Treatment 1 minute of 75%, 0.15% mercuric chloride (HgCl2) the surface of the seed sterilizes 15 minutes, washes seed 4-5 time with sterilizing；Seed is placed on taking root and in Seed germination culture medium (formula see take root in embodiment 1 and Seed germination culture medium) added with 5mg/ml hygromycin；By postvaccinal take root and Seed germination culture medium be placed in illumination cultivation room cultivate 2 weeks (intensity of illumination is about 1600lx-2000lx, Light To Dark Ratio 16:8), temperature 25 ± 1 DEG C, statistics germination percentage.According to mendelian inheritance, isozygotying, heterozygosis and negative three kinds of genotype are germinateed in hygromycin culture medium and dead ratio is respectively as follows: 1:0,3:1 and 0:1, i.e. germination percentage is 100%, 75% and 0%.Statistical result showed, heterozygous plant Seed germination meets 3:1 segregation ratio (table 2).
Embodiment 5:real-timePCR result is analyzed with germination test result comparison
Carry out identifying the genotype of all transfer-gen plants to be analyzed according to Seed germination result.Simultaneously according to real-timePCR result, calculate the difference (△ Ct) of plant hygromycin and G3PDH two primer amplification Ct value, added up the correlation coefficient between germination percentage and △ Ct by regression analysis.Result shows that the germination percentage of all test transfer-gen plants and △ Ct are height correlation (correlation coefficient are 0.9927,0.9807 and 0.9943 respectively, in Table 2) in family.
Table 2real-timePCR and Seed germination statistical result contrast
Experimental result illustrates, the present embodiment adopts the genotype that the method for real-timePCR detects transfer-gen plant to be accurately, believable.Show that the present invention is equally reliable with traditional Seed germination, by comparison simultaneously, the present invention more saves time, and (T1 is for can be carried out detection seedling stage, and traditional method will in T2 generation detection, save a generation, accelerate breeding process), workload lower (amount of DNA, for individual plant sample DNA, is required low by T1).
Claims (3)
1. a rapid screening Oryza sativa L. single copy transgenic progeny is isozygotied the method for family, it is characterized in that, utilize agrobcterium-mediated transformation conversion carrier pCAMBIA1300, adopt southern method to filter out the positive and singly copy transformed plant, from T0 for transfer-gen plant is gathered in the crops seed, by presoaking and germinating and be seeded on seedbed, the sample blade on plant is taken seedling stage in SANYE, by CTAB method extracting sample genomic DNA, design real-timePCR primer with the nucleotide sequence of the endogenous G3PDH gene of external source genes of interest hygromycin gene and Oryza sativa L.；The primer pair sample DNA utilizing described external source genes of interest and described Oryza sativa L. source gene carries out real-timePCR detection, judges the genotype of transfer-gen plant by comparing the amplification Ct value calculating described external source genes of interest and described Oryza sativa L. source gene；At T1 for the solid genotype again being detected transfer-gen plant by Seed germination later, relatively whether the genotype results of above-mentioned two transfer-gen plant coincide, and selects the genotype results of two transfer-gen plants can coincide material as the breeding material of follow-up Transgenic Rice or paddy rice cross breeding transformation breeding material or Oryza sativa L. multiple gene polymerization breeding material；
Wherein,
The nucleotide sequence of described hygromycin gene is such as shown in sequence table SEQ IDNO:1；
Shown in the nucleotide sequence sequence table SEQ IDNO:2 of described G3PDH gene；
The nucleotide sequence of described primer is as follows:
Hygromycin gene primers F: CTGATAGAGTTGGTCAAGAC
Hygromycin gene primer R:TACATGGCGTGATTTCATAT
G3PGH gene primer F:TTACATCTCTAGTCTCTTATG
G3PGH gene primer R:CTGGAACATTTATCTACCTA
PCR program is as follows: 94 DEG C of 10sec；94 DEG C of 5sec, 60 DEG C of 34sec, 45 circulations.
2. the method described in claim 1 is isozygotied the application in family in rapid screening Oryza sativa L. single copy transgenic progeny.
3. as claimed in claim 2 isozygotying the application in family in rapid screening Oryza sativa L. single copy transgenic progeny, its feature includes the application in Transgenic Rice breeding or paddy rice cross breeding transformation breeding or Oryza sativa L. multiple gene polymerization breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410833434.XA CN105803046A (en) | 2014-12-29 | 2014-12-29 | Method for rapid screening of single copy transgenic offspring homozygous family and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410833434.XA CN105803046A (en) | 2014-12-29 | 2014-12-29 | Method for rapid screening of single copy transgenic offspring homozygous family and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105803046A true CN105803046A (en) | 2016-07-27 |
Family
ID=56980399
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410833434.XA Pending CN105803046A (en) | 2014-12-29 | 2014-12-29 | Method for rapid screening of single copy transgenic offspring homozygous family and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105803046A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113736900A (en) * | 2021-08-30 | 2021-12-03 | 华南农业大学 | Method for screening single-copy T-DNA transgenic plant |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676536A (en) * | 2011-03-11 | 2012-09-19 | 华中农业大学 | Application for OsLIS-L1 gene controlling rice plant height and pollen fertility |
| CN104195225A (en) * | 2014-07-03 | 2014-12-10 | 武汉大学 | Quantitative PCR method for rapidly identifying transgenic paddy rice homozygote |
-
2014
- 2014-12-29 CN CN201410833434.XA patent/CN105803046A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676536A (en) * | 2011-03-11 | 2012-09-19 | 华中农业大学 | Application for OsLIS-L1 gene controlling rice plant height and pollen fertility |
| CN104195225A (en) * | 2014-07-03 | 2014-12-10 | 武汉大学 | Quantitative PCR method for rapidly identifying transgenic paddy rice homozygote |
Non-Patent Citations (2)
| Title |
|---|
| 杨晓杰等: "不同转化方法获得的转基因棉花外源基因拷贝数分析", 《农业生物技术学报》 * |
| 王育花等: "利用实时荧光定量PCR 法检测转基因水稻外源基因拷贝数的研究", 《生命科学研究》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113736900A (en) * | 2021-08-30 | 2021-12-03 | 华南农业大学 | Method for screening single-copy T-DNA transgenic plant |
| CN113736900B (en) * | 2021-08-30 | 2023-07-25 | 华南农业大学 | Method for screening single copy T-DNA transgenic plants |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Overexpression of microRNA OsmiR397 improves rice yield by increasing grain size and promoting panicle branching | |
| Placido et al. | The LATERAL ROOT DENSITY gene regulates root growth during water stress in wheat | |
| CN110241248B (en) | KASP marker related to wheat grain weight under salt stress condition and application thereof | |
| Baltazar et al. | QTL mapping for tolerance to anaerobic germination in rice from IR64 and the aus landrace Kharsu 80A | |
| US9310354B2 (en) | Methods of predicting crop yield using metabolic profiling | |
| Himuro et al. | Arabidopsis galactinol synthase AtGolS2 improves drought tolerance in the monocot model Brachypodium distachyon | |
| CN110804676A (en) | Rice OsNramp5-18Mutant gene and identification method thereof, KASP typing primer for identification and application | |
| CN102776201B (en) | Application of OsELF 3 gene in controlling heading stage of paddy rice | |
| CN101974521A (en) | Molecular marker SIsv0372 in close linkage with foxtail millet herbicide resistant gene | |
| CN108164588A (en) | Application of the cotton transport protein GhBASS5 genes in plant salt tolerance | |
| CN103374578A (en) | Gene G13 for regulating length and weight of rice grains and application | |
| Xu et al. | Intron-targeted gene insertion in rice using CRISPR/Cas9: A case study of the Pi-ta gene | |
| Guo et al. | Biological mechanisms of cadmium accumulation in edible Amaranth (Amaranthus mangostanus L.) cultivars promoted by salinity: A transcriptome analysis | |
| CN110578015A (en) | SNP marker closely linked with cabbage type rape high and short characters and application thereof | |
| CN110904130B (en) | Construction and application of antibacterial nuclear disease gene GmGST1 and transgenic GmGST1 plant | |
| CN102766697B (en) | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape | |
| Abid et al. | Changes in DNA-methylation during zygotic embryogenesis in interspecific hybrids of beans (Phaseolus ssp.) | |
| CN101985620B (en) | Molecular marker SIsv1223 closely linked with millet herbicide-resistant gene | |
| CN106701778A (en) | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes | |
| JP2023505138A (en) | Physical and chemical mutagenesis Methods for identifying M1 generation mutations in plants and methods for obtaining mutants and typing primers, mutant genes and uses for mutation identification in rice | |
| CN103421820B (en) | Control clone and the application thereof of rice panicle type gene PM1 for one | |
| CN101985621B (en) | Molecular mark SIsvo188 closely linked with herbicide-resistant gene in foxtail millet | |
| CN110885838B (en) | Rice OsRR22-7Mutant gene and identification method thereof, KASP typing primer for identification and application | |
| CN103525856A (en) | Ethylene responsive factor gene OsERF3 and application of promoter thereof in regulating and controlling development of rice roots | |
| Perera et al. | Potential and advanced strategies for sugarcane improvement |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160727 |
|
| RJ01 | Rejection of invention patent application after publication |