CN105802983B - It is a kind of produce aliphatic group because high-throughput screening method and acquisition mutant and application - Google Patents
It is a kind of produce aliphatic group because high-throughput screening method and acquisition mutant and application Download PDFInfo
- Publication number
- CN105802983B CN105802983B CN201610183720.5A CN201610183720A CN105802983B CN 105802983 B CN105802983 B CN 105802983B CN 201610183720 A CN201610183720 A CN 201610183720A CN 105802983 B CN105802983 B CN 105802983B
- Authority
- CN
- China
- Prior art keywords
- mutant
- hydrocarbon
- detecting element
- seq
- aliphatic group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/02—Preparation of hydrocarbons or halogenated hydrocarbons acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/0108—Long-chain acyl-[acyl-carrier-protein] reductase (1.2.1.80)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses it is a kind of production aliphatic group because high-throughput screening method and acquisition mutant and application, belong to technical field of bioengineering.Method provided by the present invention be by carry it is potential production aliphatic group because vector introduction into the host cell for carrying detecting element, cultivate host cell, identify the expression of target gene by responding to detecting element signal, and separates the mutant of high yield aliphatic hydrocarbon.Meanwhile the present invention also provides the fatty aldehyde piptonychia acyl oxygenation enzyme mutants obtained using the screening technique.Fatty aldehyde piptonychia acyl oxygenation enzyme mutant provided by the invention with compared with the enzyme wild type have higher aliphatic hydrocarbon combined coefficient.High yield aliphatic group provided by the invention because high-throughput screening method help quickly to filter out specific gene or mutant with more high yield hydrocarbon efficiency from the potential alternative gene and its mutant library for producing hydrocarbon ability.
Description
Technical field
The present invention relates to it is a kind of production aliphatic group because high-throughput screening method and acquisition mutant and application, belong to life
Object field of engineering technology.
Background technique
Develop bio-fuel be solve the problems, such as resource, energy and environment that the mankind are faced etc. effective way it
One.Since aliphatic hydrocarbon is the main component of the engine fuels such as gasoline, diesel oil, aviation kerosine, there is high-energy density, low moisture absorption
Property and low volatility, and match with existing transportation facility and engine system, biological aliphatic hydrocarbon has been considered to be a kind of
Most potential high-quality bio-fuel.
In recent years, it is found successively in some organisms, certain specific enzymes can be by intracellular aliphatic compound
(such as fatty acid, fatty aldehyde) is converted into aliphatic hydrocarbon.For example, being primarily present the way of a two-step method synthesizing aliphatic hydrocarbons in cyanobacteria
Diameter, i.e. acyl ACP generate fatty aldehyde under acyl ACP reductase (AAR) effect, and fatty aldehyde is again through fatty aldehyde piptonychia acyl oxygenase
(ADO) catalysis deformylase generates aliphatic hydrocarbon and formic acid.In addition, there are a kind of cytochromes in Jeotgalicoccus bacterium
P450 OleT, decarboxylation of fatty acids base can directly be generated the alkene with terminal unsaturation double bond by it.Current above-mentioned approach is equal
It has realized and has been recombinantly expressed in Escherichia coli or cyanobacteria, and successfully be detected the synthesis of the aliphatic hydrocarbons such as C15, C17, C19, showed
Preferable development prospect out.
The efficiency of current some Microbe synthesis aliphatic hydrocarbons with natural fat hydrocarbon biosynthesis pathway is all very low, not
Has commercial application potentiality, a key reason is the extremely low catalytic efficiency of catalyst.Therefore, pass through biotechnology hand
The catalytic activity of key enzyme in the above-mentioned aliphatic hydrocarbon route of synthesis of Duan Tigao, be promote aliphatic hydrocarbon biosynthesis effective way it
One.Such as by random in the primary structure to enzyme or semi-randomly introduce the insertion of single or several amino acid, delete or replace
It changes, by corresponding high-throughput screening method, is the catalysis characteristics for changing enzyme, realizes a kind of effective means of the improvement of enzyme.By
It is numerous in potential optional modification scheme, how the strong enzyme of hydrocarbon ability or mutation produced by high flux screening means quick separating
Strain, is current urgent problem to be solved.However, limited by the physicochemical properties of aliphatic hydrocarbon itself, how the micro- life of Fast Evaluation
The ability of object synthesizing aliphatic hydrocarbons is the difficult point in research work.Traditional techniqueflow is first will be in cell by organic solvent
Aliphatic hydrocarbon extracting and concentration analyzed then by the content of Gas chromatographyMass spectrometry analysis wherein fatty the hydrocarbon component
Process throughput is low, and required time is long, analysis cost higher (Schirmer A, et al, Science, 2010.329:559-
562).Limited by analysis method, there is no at present for produce aliphatic group because high-throughput screening method implementation precedent.
Summary of the invention
To solve the above problems, the present invention provides a kind of production aliphatic group because high-throughput screening method and acquisition it is prominent
Variant and application, the technical solution taken are as follows:
The purpose of the present invention is to provide it is a kind of production aliphatic group because high-throughput screening method, this method be will carry dive
Produce aliphatic group because vector introduction into the host cell for carrying detecting element, cultivate host cell, by detection
Element signal response identifies the expression of target gene, and separates the mutant of high yield aliphatic hydrocarbon.
The step of screening technique, is as follows:
1) amplification produce aliphatic group because, and by fallibility PCR reaction introduce random mutation, obtain amplified production；
2) amplified production that step 1) obtains is connected in the plasmid vector containing resistant gene after digestion, is weighed
Group plasmid；
3) building carries the host cell of detecting element, and by the resulting recombinant plasmid transformed of step 2) to host cell,
Obtain transformant；
4) incubation step 3) gained transformant, detects and carries out destination gene expression according to the signal response to detecting element
Identification and separate the mutant of high yield aliphatic hydrocarbon.
Preferably, step 1) the production aliphatic group is because being fatty aldehyde piptonychia acyl monooxygenase gene ADO.
Preferably, the step 3) detecting element, including aliphatic hydrocarbon detecting element and Reports component.
It is highly preferred that the aliphatic hydrocarbon detecting element, contains at least one constitutive promoter, a transcription regulatory factor
With a hydrocarbon response characteristic promoter；The Reports component is green fluorescent protein, LacZ gene, luciferase or resistance base
One of because.
Preferably, the constitutive promoter is promoter PalkS, and nucleotide sequence is as shown in SEQ ID NO.6；Institute
Transcription regulatory factor is stated, is transcription regulatory factor AlkR, amino acid sequence is as shown in SEQ ID NO.7；The hydrocarbon response characteristic
Promoter is promoter PalkM, and nucleotide sequence is as shown in SEQ ID NO.8.
Preferably, the step 3) host cell is Escherichia coli, yeast or cyanobacteria.
Preferably, the signal of the step 4) detecting element, refer to fluorescence intensity, absorbance value, chemiluminescence intensity and
One or more of bacterium colony size.
Any screening technique is in high yield aliphatic group because of the application in engineering bacteria.
Another object of the present invention is to provide a kind of mutant obtained using the screening technique, and the mutant is such as
A kind of following variation at least occurs for the amino acid sequence of fatty aldehyde piptonychia acyl oxygenase shown in SEQ ID NO.1:
1) the 194th glutamic acid mutation is leucine (E194K), and amino acid sequence is as shown in SEQ ID NO.2；
2) the 9th glutamic acid mutation is glycine, and the 27th isoleucine mutation is asparagine (I9G&I27N),
Amino acid sequence is as shown in SEQ ID NO.3；
3) the 204th glutamic acid mutation is phenylalanine (I204F), and amino acid sequence is as shown in SEQ ID NO.4.
Application of the mutant in aliphatic hydrocarbon biosynthesis is also within protection scope of the present invention.
The beneficial effect that the present invention obtains is:
Have using the fatty aldehyde piptonychia acyl oxygenation enzyme mutant that screening technique provided by the invention obtains wild compared with the enzyme
Type has higher aliphatic hydrocarbon combined coefficient；High yield aliphatic group provided by the invention because high-throughput screening method facilitate fastly
Filtering out from the potential alternative gene and its mutant library for producing hydrocarbon ability for speed is specific with more high yield hydrocarbon efficiency
Gene or mutant；Specifically:
1) mutational site of fatty aldehyde piptonychia acyl oxygenation enzyme mutant gene of the present invention is reported without open before making the present invention
Road.
2) high-throughput screening method of the present invention directly detects aliphatic hydrocarbon using aliphatic hydrocarbon detecting element in cell
Situation is synthesized, can be realized for the first time according to the signal strength (such as fluorescence, chemiluminescence, enzyme activity) of reporter protein from biggish base
Hydrocarbon ability and the stronger specific gene of production hydrocarbon ability and its mutant are produced because quickly filtering out to have in library, there is no it before this
He it is similar for produce aliphatic group because high-throughput screening method report.
Detailed description of the invention
1 schematic diagram of plasmid of Fig. 1 carrying AAR-ADO hydrocarbon-producing genes.
The GC-MS testing result of aliphatic hydrocarbon in Fig. 2 Escherichia coli.
Wherein, figure A is control sample, and figure B is the E. coli SampLes for producing aliphatic hydrocarbon, and internal standard compound is n-eicosane, mainly
Fatty hydrocarbon products are positive pentadecane and 17 alkene.
2 schematic diagram of plasmid of Fig. 3 carrying aliphatic hydrocarbon detecting element.
Fig. 4 bacterium solution fluorescence intensity is with the variation of inducer concentrations and incubation time and the pass of fatty hydrocarbon content and fluorescence intensity
System；
Wherein, figure A is variation of the bacterium solution fluorescence intensity with inducer concentrations and incubation time；B be fatty hydrocarbon content with it is glimmering
The relationship of luminous intensity.
Fig. 5 high yield aliphatic group provided by the invention because high-throughput screening method schematic illustration.
Airflow classification result schematic diagram provided by Fig. 6 embodiment of the present invention；
(in figure, a is the cell flow cytometer showed result not induced；B is the cell airflow classification knot of 0.05mM IPTG induction
Fruit).
The aliphatic hydrocarbon synthetic quantity for the ADO predominant mutation body that Fig. 7 is screened by directed evolution and relative to wild type
It improves the standard；(wherein, wt: the wild type fatty aldehyde piptonychia acyl oxygenase as mutagenesis template；3-3:ADO mutant I
(E194K)；5-3:ADO mutant II (E9G&I27N)；5-7:ADO mutant III (I204F)；3-3/5-3:ADO mutant IV
(E194K&E9G&I27N)。
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with drawings and examples, but those skilled in the art
Member it will be understood that, following drawings and embodiment are merely to illustrate the present invention, rather than the restriction of the range to invention.With reference to the accompanying drawings and
The following detailed description of preferred method, various purposes of the invention and advantageous aspect will become to those skilled in the art
Obviously.
Embodiment of the present invention is described in detail below in conjunction with embodiment.Those skilled in the art will manage
Solution, the following examples are merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.
Unless otherwise indicated, otherwise the present invention used in molecular biology test method, substantially with reference to
J.Sambroo et al., molecular cloning: laboratory manual, second edition, CSH Press, 1989, and
F.M.Ausubel et al., fine works molecular biology experiment guide, the 3rd edition, described in John Wiley&Sons, Inc., 1995
Method carry out or carried out according to product description.Production firm person is not specified in agents useful for same, is that can be obtained by commercially available
The conventional products obtained.As known to those skilled in the art, embodiment describes the present invention by way of example, and is not intended to limit the present invention
Range claimed.
Sequence table information:
SEQ ID NO.1: the amino acid sequence of fatty aldehyde piptonychia acyl oxygenase ADO.
The amino acid sequence of SEQ ID NO.2:ADO mutant II:E194K.
The amino acid sequence of SEQ ID NO.3:ADO mutant I:E9G&I27N.
The amino acid sequence of SEQ ID NO.4:ADO mutant III:I204F.
The amino acid sequence of SEQ ID NO.5:ADO mutant IV:E9G&I27N&E194K
SEQ ID NO.6: the DNA sequence of constitutive promoter PalkS.
SEQ ID NO.7: the amino acid sequence of encoding transcription regulatory factor AlkR.
SEQ ID NO.8: the DNA sequence of hydrocarbon response promoter PalkM.
SEQ ID NO.9: the nucleotide sequence of primer ADO-For.
SEQ ID NO.10: the nucleotide sequence of primer ADO-Rev.
The building of 1 Escherichia coli aliphatic hydrocarbon route of synthesis of embodiment and aliphatic hydrocarbon assay
Bacterial strain:
E. coli bl21 (DE3) Δ fadE
Carrier:
Carry the plasmid 1:pACYCduet-ADO-AAR of fatty aldehyde piptonychia acyl oxygenase ADO and acyl ACP reductase AAR
(Fig. 1)
Culture medium:
LB culture medium (10g/L containing tryptone, yeast extract powder 5g/L, NaCl 10g/L, if solid medium, then
Every liter of culture medium adds agar 15g/L)
Improve M9 culture medium (Na containing 6g/L2HPO4,3g/L KH2PO4,0.5g/L NaCl,2g/L NH4Cl,0.25g/L
MgSO4·7H2O,11mg/L CaCl2,27mg/L FeCl3·6H2O,2mg/L ZnCl2·4H2O,2mg/L Na2MoO4·
2H2O,1.9mg/L CuSO4·5H2O,0.5mg/L H3BO3, 1mg/L vitamin B1,200mM Bis-Tris (pH 7.25) and
0.1% (v/v) Triton-X100)
Implementation steps: converting e. coli bl21 (DE3) Δ fadE for plasmid 1, and the transformant of acquisition is trained in resistance LB
It supports after being incubated overnight in base (containing 34 μ g/mL chloramphenicol), is forwarded to the improvement M9 culture medium of corresponding resistant, culture to logarithmic phase
After (OD600 ≈ 0.6-0.8), 1mM IPTG induction hydrocarbon-producing genes expression is added, after continuing culture about 20-40 hours, take 3~
N-eicosane reference substance is added to a certain concentration (1~50mg/L) in 100mL bacterium solution thereto, and is added isometric with bacterium solution
Chloroform: methyl alcohol mixed liquor (2:1 is mixed chloroform by volume with methanol) fullys shake, and centrifugation (refers to 4 DEG C of centrifugal condition, centrifugation
Power 8000 × g, 15min) drying of Hou Qu lower layer organic phase, 200~500 μ L chromatographically pure n-hexane dissolution residual oil phases are added, from
Supernatant is transferred in chromatography column feed materials bottle after the heart and with the fatty hydrocarbon content in GC-MS test sample.With reference to chromatography testing conditions:
Gas chromatograph-mass spectrometer (GC-MS) (GC-MS) detection uses (30m × 250 μm HP-INNOWax of Agilent 7890A-5975C
× 0.25 μm) chromatographic column, using helium as current-carrying gas, stablizing flow velocity is 1mL/min.Injector temperature is 250 DEG C, distinguished and admirable ratio
For 20:1, temperature program are as follows: 100 DEG C of holding temperature 1min, then 5 DEG C/min is warming up to 150 DEG C, and then 10 DEG C/min is warming up to
250 DEG C, keep temperature 15min.
As a result as shown in Fig. 2, the n-eicosane appearance time as internal standard compound is about 28min, by with negative control (no
Carry the Escherichia coli of aliphatic hydrocarbon approach) compare, it can be found that producing the n-pentadecane and 17 of hydrocarbon approach synthesis by AAR-ADO
Alkene is respectively in about 17min and 22min appearance, and according to two kinds of aliphatic hydrocarbons, respectively peak area and molecular weight can be calculated with internal standard compound
The content of synthesizing aliphatic hydrocarbons out.But since detection process takes a long time, and the extractive process step of aliphatic hydrocarbon is more complex,
It only cannot achieve the quick analysis and high flux screening to fatty hydrocarbon samples are produced by organic solvent extracting and GC-MS method.
Embodiment 2 is synthesized using aliphatic hydrocarbon in aliphatic hydrocarbon element testing cell
Bacterial strain:
E. coli bl21 (DE3) Δ fadE；Bacillus coli DH 5 alpha
Carrier:
Carry the plasmid 1:pACYCduet-ADO-AAR of fatty aldehyde piptonychia acyl oxygenase ADO and acyl ACP reductase AAR；
Carry the plasmid 2 (Fig. 3) of aliphatic hydrocarbon detecting element AlkR-PalkM::GFP: pCom8-AlkR-PalkM::GFP
Culture medium:
LB culture medium (10g/L containing tryptone, yeast extract powder 5g/L, NaCl 10g/L, if solid medium, then
Every liter of culture medium adds agar 15g/L)
Improve M9 culture medium (Na containing 6g/L2HPO4,3g/L KH2PO4,0.5g/L NaCl,2g/L NH4Cl,0.25g/L
MgSO4·7H2O,11mg/L CaCl2,27mg/L FeCl3·6H2O,2mg/L ZnCl2·4H2O,2mg/L Na2MoO4·
2H2O,1.9mg/L CuSO4·5H2O,0.5mg/L H3BO3, 1mg/L vitamin B1,200mM Bis-Tris (pH 7.25) and
0.1% (v/v) Triton-X100)
Implementation steps: plasmid 1 and plasmid 2 are individually or collectively converted to e. coli bl21 (DE3) Δ fadE, by acquisition
Transformant mistake in resistance LB culture medium (containing 34 μ g/mL chloramphenicol and/or 50 μ g/mL gentamicins, depending on carrying plasmid)
After night culture, it is forwarded to the improvement M9 culture medium of corresponding resistant, after culture to logarithmic phase (OD600 ≈ 0.6-0.8), is added 0.05
~1mM IPTG induces hydrocarbon-producing genes expression, after continuing culture about 10 hours to 20 hours, with microplate reader (band fluorescent moieties) (or
Fluorescence microscope, flow cytometer) detection bacterium solution fluorescence.And referring to the method in embodiment 1, with GC-MS method test sample
In fatty hydrocarbon content
As a result as shown in figure 4, carrying the transformant of plasmid 1 and plasmid 2 simultaneously after IPTG is added and cultivates about 10-20h,
Fluorescence significantly increases, and fluorescence intensity and inducer and fatty being positively correlated property of hydrocarbon content, and showing can be by comparing cell
Fluorescence intensity detects the relative amount of aliphatic hydrocarbon indirectly.
Embodiment 3 has the high flux screening of high yield aliphatic hydrocarbon ability ADO mutated gene
ADO gene is expanded using primer ADO-For and ADO-Rev, and uses fallibility PCR reaction system to introduce random alkali
Base mutation.The primer sequence is following (dashed part is restriction enzyme site):
ADO-For:TATACCATGGCGCAGCTTGAAGCCAGCCT
ADO-Rev:CCTGGAATTCAAACGGCCGCAA
Specifically, PCR reaction using carry the plasmid of ADO gene as template, ADO-For is respectively adopted and on ADO-Rev is
Downstream primer uses the rTaq archaeal dna polymerase of Takara company.Reaction system is as shown in the table:
1 PCR reaction system of table
PCR reaction condition are as follows: first 95 DEG C of 2min；Then 94 DEG C of 1min, 55 DEG C of 1min, 72 DEG C of 1min, totally 30 are followed
Ring；Last 72 DEG C of 10min.
After reaction, agarose gel electrophoresis (agarose concentration 0.8%) detection is carried out to pcr amplification product, obtained
The band of about 700bp.It cuts ADO genetic fragment restriction enzyme NcoI and EcoRI that fallibility PCR is obtained are bis-, is connected into same
Connection product is converted the place for carrying plasmid 2 to replace wild type ADO segment by the plasmid 2 (compared with long segment) of sample double digestion processing
Main strain Escherichia coli BL21 (DE3) Δ fadE competent cell；About 1mL LB culture medium is added into 200 μ L converted products,
After incubating about 1 hour, gentamicin and chloramphenicol is added (concentration is 50 μ g/mL, similarly hereinafter)；Continue after being incubated overnight, by 1:
20 are forwarded to resistant improvement M9 culture medium, and 0.05mM IPTG is added in 37 DEG C of cultures to logarithmic phase (OD600 ≈ 0.6),
After 30 DEG C are cultivated about 16 hours, bacterium solution is diluted to about 10-6Cell/mL utilizes flow sorter (such as BD for having sorting unit
FACS AriaIII) (exciting light 485nm emits light 535nm) is sorted, collect wherein strongest 1% cell of fluorescence intensity
(Fig. 6).The cell of collection is coated on the LB plate with corresponding resistant, incubates culture, after bacterium colony is grown, picking monoclonal is connect
In kind to the centrifuge tube with resistant LB culture medium, after being incubated overnight, it is forwarded to the improvement M9 culture medium of resistance, culture to logarithm
After phase, IPTG is added, continues culture 10-20 hours, examines cell glimmering with fluorescence microscope and microplate reader (band fluorescent moieties)
Light obtains 3 mutant strains, is denoted as mutant I, II, III respectively by comparing fluorescence intensity, determines wherein ADO by sequencing
The amino acid sequence of mutant is respectively as shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.
Embodiment 4 utilizes ADO mutant biosynthesis aliphatic hydrocarbon
(the open country in ADO mutant gene replacement plasmid 1 of plasmid 1 of 3 kinds of ADO mutant genes described in embodiment 3 will be carried
Raw type ADO genetic fragment) it is cloned into production hydrocarbon host e. coli BL21 (DE3) Δ fadE respectively；In addition, to further increase
The potential production hydrocarbon ability of mutant replaces with 194 glutamic acid in 5-7 variant amino acid sequence with reference to mutant 3-3
Leucine (E194K), is denoted as mutant IV:E9G&I27N&E194K.Above-mentioned plasmid is converted and produces hydrocarbon host e. coli BL21
(DE3) condition of culture and aliphatic hydrocarbon detection method described in Δ fadE transformant reference implementation example 1 obtained measure described in carrying
The bacterial strain of four kinds of mutant produces hydrocarbon amount and is compared with wild type ADO.
As shown in fig. 7, carrying out parallel laboratory test under used same culture conditions, four kinds of fatty aldehyde piptonychias are carried
Acyl oxygenation enzyme mutant I (3-3, E194K, SEQ ID NO.2), II (5-3, E9G&I27N, SEQ ID NO.3), III (5-7,
I204F, SEQ ID NO.4), the Escherichia coli of IV (3-3/5-3, E9G&I27N&E194K, SEQ ID NO.5), hydrocarbon yield
It is 2.0 to 2.9 times of wild type ADO respectively, shows that four mutant have higher production hydrocarbon efficiency compared with wild type ADO.
It is not reported before this in the mutational site.
Although the present invention has been disclosed in the preferred embodiment as above, it is not intended to limit the invention, any to be familiar with this
The people of technology is not departing from spirit and scope of the invention, can do various change and modification, therefore, guarantor of the invention
Shield range should subject to the definition of the claims.
Claims (7)
1. it is a kind of produce aliphatic group because high-throughput screening method, which is characterized in that by carry it is potential production aliphatic group because load
Body is imported into the host cell for carrying detecting element, cultivates host cell, identifies sieve by responding to detecting element signal
The expression of target gene is selected, and separates the mutant of high yield aliphatic hydrocarbon；The detecting element, including aliphatic hydrocarbon detecting element
And Reports component, the aliphatic hydrocarbon detecting element, contain at least one constitutive promoter, a transcription regulatory factor and one
The promoter of hydrocarbon response characteristic；The Reports component is in green fluorescent protein, LacZ gene, luciferase or resistant gene
One kind；The constitutive promoter is promoter PalkS, and nucleotide sequence is as shown in SEQ ID NO.6；The transcription is adjusted
The factor is controlled, is transcription regulatory factor AlkR, amino acid sequence is as shown in SEQ ID NO.7；The hydrocarbon response characteristic promoter is
Promoter PalkM, nucleotide sequence is as shown in SEQ ID NO.8；The host cell is Escherichia coli.
2. screening technique described in claim 1, which is characterized in that steps are as follows:
1) amplification produce aliphatic group because, and by fallibility PCR reaction introduce random mutation, obtain amplified production；
2) amplified production that step 1) obtains is connected in the plasmid vector containing resistant gene after digestion, obtains recombination matter
Grain；
3) building carries the host cell of detecting element, and by the resulting recombinant plasmid transformed of step 2) to host cell, obtains
Transformant；
4) incubation step 3) gained transformant, detects and carries out according to the signal response to detecting element the mirror of destination gene expression
Determine and separate the mutant of high yield aliphatic hydrocarbon.
3. screening technique described in claim 2, which is characterized in that step 1) the production aliphatic group because, including but not limited under
One or more of column gene: fatty aldehyde piptonychia acyl monooxygenase gene ADO, decarboxylation of fatty acids enzyme OleT, terminal olefin synthesis
Enzyme Ols.
4. screening technique described in claim 2, which is characterized in that the signal of the step 4) detecting element, refer to fluorescence intensity,
One or more of absorbance value, chemiluminescence intensity and bacterium colony size.
5. any screening technique of claim 1-4 is obtaining high yield aliphatic group because of the application in engineering bacteria.
6. a kind of mutant obtained using any the method for claim 1-4, which is characterized in that such as SEQ ID NO.1 institute
A kind of following variation at least occurs for the amino acid sequence of the fatty aldehyde piptonychia acyl oxygenase shown:
1) the 9th glutamic acid mutation is glycine, and the 27th isoleucine mutation is asparagine, such as SEQ ID NO.3；
2) the 194th glutamic acid mutation is lysine, such as SEQ ID NO.2；
3) the 204th glutamic acid mutation is phenylalanine, such as SEQ ID NO.4.
7. application of the mutant described in claim 6 in aliphatic hydrocarbon biosynthesis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610183720.5A CN105802983B (en) | 2016-03-28 | 2016-03-28 | It is a kind of produce aliphatic group because high-throughput screening method and acquisition mutant and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610183720.5A CN105802983B (en) | 2016-03-28 | 2016-03-28 | It is a kind of produce aliphatic group because high-throughput screening method and acquisition mutant and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802983A CN105802983A (en) | 2016-07-27 |
| CN105802983B true CN105802983B (en) | 2019-12-03 |
Family
ID=56454886
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610183720.5A Active CN105802983B (en) | 2016-03-28 | 2016-03-28 | It is a kind of produce aliphatic group because high-throughput screening method and acquisition mutant and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802983B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110295159A (en) * | 2018-03-07 | 2019-10-01 | 江南大学 | A kind of enzyme mutant |
| CN108753912B (en) * | 2018-06-25 | 2021-08-24 | 江南大学 | High-throughput screening method for trans-anethole oxygenase mutant, mutant strain and mutant |
| CN109486835B (en) * | 2018-12-05 | 2022-02-11 | 中国科学院合肥物质科学研究院 | Alkane-producing key gene mutant from blue-green algae and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1065092A (en) * | 1990-09-24 | 1992-10-07 | 综合医院公司 | The screening assay method |
| CN1778919A (en) * | 2005-09-30 | 2006-05-31 | 东北师范大学遗传与细胞研究所 | Human MDR1 gene expression regulator screening system and method for screening gene expression regulator |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080293060A1 (en) * | 2007-04-23 | 2008-11-27 | Ls9, Inc. | Methods and Compositions for Identification of Hydrocarbon Response, Transport and Biosynthesis Genes |
-
2016
- 2016-03-28 CN CN201610183720.5A patent/CN105802983B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1065092A (en) * | 1990-09-24 | 1992-10-07 | 综合医院公司 | The screening assay method |
| CN1778919A (en) * | 2005-09-30 | 2006-05-31 | 东北师范大学遗传与细胞研究所 | Human MDR1 gene expression regulator screening system and method for screening gene expression regulator |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802983A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Larroude et al. | A synthetic biology approach to transform Yarrowia lipolytica into a competitive biotechnological producer of β‐carotene | |
| Zhou et al. | Optimization of amorphadiene synthesis in Bacillus subtilis via transcriptional, translational, and media modulation | |
| Kato et al. | The expression of sterigmatocystin and penicillin genes in Aspergillus nidulans is controlled by veA, a gene required for sexual development | |
| CN105802983B (en) | It is a kind of produce aliphatic group because high-throughput screening method and acquisition mutant and application | |
| CN103243065B (en) | Bacterial strain for producing farnesene and application of bacterial strain | |
| Zhu et al. | Coproduction of acetaldehyde and hydrogen during glucose fermentation by Escherichia coli | |
| JP2018507698A (en) | De novo microbial synthesis of terpenes | |
| KR102126985B1 (en) | Protein synthesis system for kit synthesis in vitro, kit and method for manufacturing the same | |
| CN107881151A (en) | CHO expression systems | |
| CN114717209B (en) | T4DNA ligase variants with increased salt tolerance | |
| CN105209615A (en) | Alkenol dehydratase variants | |
| CN112961791B (en) | Recombinant strain of non-specific peroxygenase and construction method and application thereof | |
| Davis et al. | Genetic reprogramming of the ergot alkaloid pathway of Metarhizium brunneum | |
| Marques et al. | Combined engineering of disaccharide transport and phosphorolysis for enhanced ATP yield from sucrose fermentation in Saccharomyces cerevisiae | |
| Kozák et al. | Inactivation of the indole-diterpene biosynthetic gene cluster of Claviceps paspali by Agrobacterium-mediated gene replacement | |
| Wyre et al. | Use of a stress-minimisation paradigm in high cell density fed-batch Escherichia coli fermentations to optimise recombinant protein production | |
| Roccuzzo et al. | Metabolic insights into infochemicals induced colony formation and flocculation in Scenedesmus subspicatus unraveled by quantitative proteomics | |
| CN112375771B (en) | Homoserine biosensor and construction method and application thereof | |
| Tong et al. | Evasion of Cas9 toxicity to develop an efficient genome editing system and its application to increase ethanol yield in Fusarium venenatum TB01 | |
| CN109810999A (en) | A method of nerol is produced using microbial fermentation | |
| Cheng et al. | Development of a Pichia pastoris cell factory for efficient production of germacrene A: a precursor of β-elemene | |
| WO2020161354A1 (en) | Recombinant host cells to produce anthraquinone derivatives | |
| Nitta et al. | Application of inorganic phosphate limitation to efficient isoprene production in Pantoea ananatis | |
| US20230220369A1 (en) | Taxadiene synthase tcts2, encoding nucleotide sequence and use thereof | |
| CN114854699B (en) | T4DNA ligase variants with improved thermostability |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |