CN105779616B - Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 - Google Patents
Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 Download PDFInfo
- Publication number
- CN105779616B CN105779616B CN201610241439.2A CN201610241439A CN105779616B CN 105779616 B CN105779616 B CN 105779616B CN 201610241439 A CN201610241439 A CN 201610241439A CN 105779616 B CN105779616 B CN 105779616B
- Authority
- CN
- China
- Prior art keywords
- xinjiang
- alaska grayling
- grayling
- thymall
- xinjiang alaska
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01.The genomic DNA in Xinjiang Alaska grayling muscle is extracted first and is diluted spare；The microsatellite core sequence contained in Xinjiang Alaska grayling DNA sequence dna is recycled, in its sequence design specific primers at both ends；Then PCR amplification is carried out using genomic DNA individual in the primer pair Xinjiang Alaska grayling difference proles or Xinjiang Alaska grayling group, PCR product is detected；It is analyzed using the band that product occurs, determines the genotype of each individual, and obtain the genetic polymorphism map of Xinjiang Alaska grayling.It is characteristic of the invention that the mapping genetic variations of Xinjiang Alaska grayling genetic marker Thymall-01 can be obtained efficiently, method is easy.
Description
Technical field
The invention belongs to Xinjiang Alaska grayling (Thymallus arcticus grubei) DNA molecular Genetic Markers,
It is related to a kind of technical method for detecting Xinjiang Alaska grayling microsatellite marker Thymall-01, specifically Xinjiang Alaska grayling is micro- defends
The genotype detection method of asterisk note Thymall-01.
Background technique
Xinjiang Alaska grayling (Thymallus arcticus grubei) belong to salmon shape mesh (Salmoniformes), salmonidae
(Salmonidae), grayling subfamily (Thymallinae), grayling category (Thymallus), it is commonly called as careless spot, oil mark also known as stick flower
Fish, flower shark's fin.Body is elongated, flat-sided, and dorsal fin is long and tall and big, upper limb boss is in flag shape the line of several russet spot formations
Band, body colour are bright-coloured.It is each that wild resource is mainly distributed on Altay, Xinjiang city Fuyun County and the upstream in Burqin County Eerqisihe River
In tributary.Alaska grayling belongs to the high oxygen consumption fish of typical cold water, lives in mountain stream streams throughout the year, and water quality is limpid pollution-free, and The turbulent river crashes its way through,
The pebbly place in river bed.Alaska grayling appearance is magnificent, and meat is especially fine and smooth, is not only rare Xinjiang Endemic fish, and
The important Fish Germplasm Resources in China, there is high economic development value.Due to environmental pollution, forest deterioration and mistake in recent years
It crosses human factors, the resources of the fish such as fishing and faces exhaustion, II class of Xinjiang is classified as by the People's Government, Xinjiang Uygur Autonomous Regions
Important aquatic wild protection animal.In recent years, Production and Construction Corps of Xinjiang's Fishery technical Center for Popularization to big equal researchers
Had begun Alaska grayling artificial breeding, resource increment and artificial domesticating and cultivating research, and achieve certain research at
Fruit is expected to realize the industrialization of cultivation.For Xinjiang Alaska grayling as a kind of emerging breed variety, genetics research is relatively thin
Weak, there are no the reports of microsatellite marker exploitation.Although isoenzyme mark, RAPD label and AFLP labelling technique can be used for
The genetic structure and its genetic diversity of Xinjiang Alaska grayling are studied, however since these labels belong to dominant inheritance label,
Detection efficiency is high not as good as codominant markers such as microsatellite markers.In addition, the shortcomings that isoenzyme mark is that polymorphism is low, RAPD mark
The stability of note is bad, and AFLP marking operation is cumbersome, these all greatly limit their application.And microsatellite sequence divides extensively
It is distributed in eukaryotic gene group, its main feature is that type is more, allele number is more, and polymorphism is high, codominance, Mendelian inheritance
Mode, and be randomly distributed in genome, and microsatellite marker detection efficiency is high, it is as a result stable.But due to lacking Xin Jiangbei
Pole grayling microsatellite marker, limits the development of its molecule genetics research, thus there is an urgent need to obtain microsatellite marker with into
The research and application of row Xinjiang Alaska grayling genetic diversity, individual identification and genealogical identification etc..
Summary of the invention
The object of the present invention is to provide a kind of Xinjiang Alaska grayling DNA molecular Genetic Markers of high polymorphism, i.e., newly
The rapid detection method of boundary Alaska grayling microsatellite marker Thymall-01, to make up the deficiency of prior art.
Basic conception of the invention mainly utilizes the microsatellite core sequence contained in the Alaska grayling DNA sequence dna of Xinjiang,
In its design specific primers at both ends and PCR detection is carried out, so that rapidly the detection each individual of Xinjiang Alaska grayling is micro- herein
The hereditary variation in satellite area, obtains the primer (microsatellite marker Thymall-01) to the polymorphism map of Xinjiang Alaska grayling,
The genotype of each individual is intuitively detected by map.Status and actual requirement based on the above background, the present invention is from Xinjiang
A microsatellite marker is obtained in Alaska grayling DNA sequence dna, is named as Thymall-01, microsatellite marker Thymall-01
It can be used for Xinjiang Alaska grayling analysis of genetic diversity and genealogical identification.
The present invention is completed according to following operational aspect: the genome first in extraction Xinjiang Alaska grayling muscle
DNA simultaneously dilutes spare；The microsatellite core sequence contained in Xinjiang Alaska grayling genomic dna sequence is recycled, in its sequence
Design specific primers at both ends；Then using in the primer pair Xinjiang Alaska grayling difference proles or Xinjiang Alaska grayling group
The genomic DNA of body carries out PCR amplification, denaturing polyacrylamide gel electrophoresis detection is carried out to PCR product, so that it is determined that each
The genotype of individual obtains the genetic polymorphism map of Xinjiang Alaska grayling.
Xinjiang Alaska grayling genomic DNA is extracted, 100ng/ μ l is diluted to, 1 μ l is added in each PCR reaction, instead
Answering total volume is 25 μ l.
DNA sequence dna containing microsatellite sequence are as follows:
1 ccaatgcaac agcttttgaa cgtggacttt ggataagtag gtatacccag aggataagta
61 ggtataccca gaggtataaa tgtgtgttcg acacccatgc tatctataca gcaacctctg
121 gtcctggtgg aattgtcaac ttgtgaattc agactttgct ttcatttaca cttttatgtg
181 tcgtcgtcgt cgtcgtcgtc gttctcagta ggtagacatt tttttgaata ataacagggt
241 aacatgtaac aacttactcc tcgttagtat agtggtgagt atccccgcct gtcacgcggg
301 agaccggggt tcaattcccc gacggggagg aatgactaca ccttttacga agacgctatg
361 tggcagtcgt gcaaggcgtc tgtgtttcag tggt
Wherein microsatellite core sequence are as follows:
GTCGTCGTCGTCGTCGTCGTC
Thymall-01 micro-satellite primers sequence are as follows:
Normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ',
Minus strand 5 '-TGTAGTCATTCCTCCCCGTC-3 ', annealing temperature when using the primer are 58 DEG C.
Microsatellite core sequence and primer sequence are core of the invention, in the Alaska grayling Diversity Detection of Xinjiang
Polymorphism is presented.
The sample-adding parameter of PCR amplification are as follows: each PCR reaction total volume is 25 μ l, including the Xinjiang 100ng Alaska grayling gene
Group DNA；10 × PCR Buffer, 2.5 μ l；Mg2+1.5mmol/L；Tag enzyme 1u；Each 0.1mmol/L of dNTP；Above-mentioned primer is each
10pmol；Add ddH2O to 25 μ l.Use the program parameter that PCR instrument is set when the primer are as follows: 94 DEG C of denaturation 2min；94℃
30sec, 58 DEG C of 45sec, 72 DEG C of 40sec, the reaction carry out 35 circulations；72 DEG C of 5 min of extension, 4 DEG C of preservations.
The detecting step of PCR product: by PCR product with 15W invariable power electrophoresis in 8% denaturing polyacrylamide gel
It is separated within 1.5 hours.After electrophoresis, 30min is impregnated with 10% glacial acetic acid solution first, then distilled water flushing
5min, then with 0.1% silver nitrate solution impregnate 30min, with 3% sodium carbonate liquor develop the color 5min, finally with 10% ice
Acetum impregnates 5min, and the polymorphism map of Xinjiang Alaska grayling microsatellite marker Thymall-01 can be obtained.
Therefore, it is characteristic of the invention that the Thymall-01 microsatellite marker of Xinjiang Alaska grayling can be obtained efficiently
Mapping genetic variations, method are easy.Moreover, microsatellite marker meets Meng De for other molecular genetic marker techniques
That hereditary pattern, is in codominant inheritance, and acquired results can intuitively detect the genotype of each individual of Xinjiang Alaska grayling；And
Applied to genetic marker, genealogical identification and building of genetic map etc. between individual in different proles or Xinjiang Alaska grayling group.
Detailed description of the invention
Fig. 1 is microsatellite marker Thymall-01 of the present invention to Xinjiang Alaska grayling 20 individual test map (numbers
1-20 be 20 individuals of Xinjiang Alaska grayling).
Specific embodiment
The present invention is described in detail below by embodiment in Xinjiang Alaska grayling Thymall-01 microsatellite core sequence DNA
Molecular genetic marker technique method.The genomic DNA in Xinjiang Alaska grayling muscle is extracted first and is diluted spare；It recycles new
The microsatellite core sequence contained in boundary Alaska grayling DNA sequence dna, in its sequence design specific primers at both ends；Then using should
Individual genomic DNA carries out PCR amplification in primer pair Xinjiang Alaska grayling difference proles or Xinjiang Alaska grayling group, right
PCR product carries out denaturing polyacrylamide gel electrophoresis detection, determines the genotype of each individual, i.e. acquisition Xinjiang Alaska grayling
Genetic polymorphism map.
1, Eppendorf pipe the extraction of Xinjiang Alaska grayling genomic DNA: is added in 100 Xinjiang μ g Alaska grayling muscle
In, the 5 μ l of Proteinase K of cell pyrolysis liquid 500 μ l and 20mg/ml are added, is gently shaken up, 37 DEG C are overnight.Then it is cracking
600 μ l Fen Lv ︰ Fang ︰ isoamyl alcohol (25 ︰, 24 ︰ 1) mixed liquors are added in good sample, 12000rpm is centrifuged after shaking 20min
10min takes supernatant.Fen ︰ Lv Fang ︰ isoamyl alcohol mixed liquor is added, is repeated aforesaid operations 3 times.Supernatant is taken again, is added 2 times
The sodium acetate of the cooling dehydrated alcohol of volume and the 3mol/L of 1/10 volume, 12000rpm are centrifuged 10min, discard supernatant liquid, protect
DNA is stayed to precipitate, then with 70% ethanol washing the precipitating 2 times, after ethyl alcohol volatilization completely, with TE buffer solution DNA, and it is dilute
It is interpreted as 100ng/ μ l, 4 DEG C of preservations.
2, the design of micro-satellite primers: in Xinjiang on the basis of Alaska grayling DNA sequence dna, the sequence of microsatellite DNA two sides is utilized
Same species are listed in relative to the well-conserved of core sequence, accordingly in its design specific primers at both ends, are amplified with it
The microsatellite segment in the site.Since microsatellite core sequence mutation rate is relatively high, microsatellite DNA core sequence is caused to repeat
Number increases or decreases, i.e. the variation of microsatellite DNA sequence length, this is the root for detecting microsatellite polymorphism.The present invention
Microsatellite area core sequence both ends specific primer sequence are as follows: normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ', minus strand
5 '-TGTAGTCATTCCTCCCCGTC-3 ', annealing temperature when using the primer are 58 DEG C.
3, PCR amplification: being loaded first, and sample-adding amount is as follows: Xinjiang Alaska grayling genomic DNA (100ng/L), 1 μ l；10×
PCR Buffer, 2.5 μ l；Mg2+(25mmo1/L), 1.5 μ l；Taq enzyme (5u/ μ l), 0.2 μ l；DNTP (each 2.5mmo/L), 1 μ
l；Primer (each 10pmol/ μ l), 1 μ l；Add aqua sterilisa to 25 μ l.Secondly, carrying out PCR reaction, PCR amplification instrument program parameter
Are as follows: 94 DEG C of denaturation 2min；94 DEG C of 30sec, 58 DEG C of 45sec, 72 DEG C of 40sec, 35 circulations；72 DEG C of extension 5min, 4 DEG C of preservations.
4, the detection of PCR product: PCR product is separated by electrophoresis on 8% denaturing polyacrylamide gel, electrophoresis apparatus function
Rate is 15W, and electrophoresis time is 1.5 hours or so.After electrophoresis, 30min is impregnated with 10% glacial acetic acid solution first, then
Distilled water flushing 5min, 0.1% silver nitrate solution impregnate 30min, 3% sodium carbonate liquor colour developing 5min, finally with 10%
Glacial acetic acid solution impregnate 5min Xinjiang Alaska grayling can be obtained in the polymorphism figure of Thymall-01 microsatellite core sequence
Spectrum, as shown in Figure 1.Fig. 1 the result shows that, 20 of Xinjiang Alaska grayling individual coamplifications go out 10 allele, illustrate micro- defend
Asterisk remembers Thymall-01 polymorphism with higher, is appropriate for Xinjiang Alaska grayling genetic diversity and genetic structure point
The research and application of analysis, individual identification and genealogical identification etc..
<110>Xinjiang University
<120>Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01
<160> 1
<210> 1
<211> 394
<212> DNA
<213>Xinjiang Alaska grayling (Thymallus arcticus grubei)
<220>
<221> repeat_region
<222> (180)...(200)
<400> 1
1 ccaatgcaac agcttttgaa cgtggacttt ggataagtag gtatacccag aggataagta
61 ggtataccca gaggtataaa tgtgtgttcg acacccatgc tatctataca gcaacctctg
121 gtcctggtgg aattgtcaac ttgtgaattc agactttgct ttcatttaca cttttatgtg
181 tcgtcgtcgt cgtcgtcgtc gttctcagta ggtagacatt tttttgaata ataacagggt
241 aacatgtaac aacttactcc tcgttagtat agtggtgagt atccccgcct gtcacgcggg
301 agaccggggt tcaattcccc gacggggagg aatgactaca ccttttacga agacgctatg
361 tggcagtcgt gcaaggcgtc tgtgtttcag tggt
Claims (5)
1. one group of primer detected using microsatellite marker Thymall-01 to Xinjiang Alaska grayling genotype, feature are existed
In,
Wherein the primer is sequence:
Normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ',
Minus strand 5 '-TGTAGTCATTCCTCCCCGTC-3 ', annealing temperature when using the primer are 58 DEG C.
2. the method detected using microsatellite marker Thymall-01 to Xinjiang Alaska grayling genotype, which is characterized in that
The genomic DNA in Xinjiang Alaska grayling muscle is extracted first and is diluted spare；It recycles and contains in Xinjiang Alaska grayling DNA sequence dna
Some microsatellite core sequences carry out PCR expansion using genomic DNA of the specific primer to Xinjiang Alaska grayling Different Individual
Increase, denaturing polyacrylamide gel electrophoresis detection is carried out to PCR product, so that it is determined that Xinjiang Alaska grayling Different Individual exists
The genotype in Thymall-01 core sequence area, wherein the Xinjiang Alaska grayling microsatellite marker Thymall-01's is special
Property primer are as follows:
Normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ',
Minus strand 5 '-TGTAGTCATTCCTCCCCGTC-3 ', annealing temperature when using the primer are 58 DEG C.
3. being detected as claimed in claim 2 using microsatellite marker Thymall-01 to Xinjiang Alaska grayling genotype
Method, which is characterized in that the PCR amplification that the genomic DNA of different Xinjiang Alaska grayling individuals carries out, be loaded parameter are as follows:
Each PCR reaction total volume is 25 μ L, including the Xinjiang 100ng Alaska grayling genomic DNA；10 × PCR Buffer, 2.5 μ L；
Mg2+1.5 mmol/L；Taq enzyme 1u；dNTP 0.1mmol/L；Each 10 pmol of specific primer in claim 2；Finally plus
ddH2O to 25 μ L；The program parameter of PCR instrument is set are as follows: 94 DEG C of denaturation 5min；94 DEG C of 45sec, 58 DEG C of 1min, 72 DEG C
40sec, the reaction carry out 35 circulations；72 DEG C of 5 min of extension, 4 DEG C of preservations.
4. being detected as claimed in claim 2 using microsatellite marker Thymall-01 to Xinjiang Alaska grayling genotype
Method, which is characterized in that the step of denaturing polyacrylamide gel electrophoresis detection is carried out to PCR product: by PCR product 8%
Denaturing polyacrylamide gel in separated within 1.5 hours with 15W invariable power electrophoresis, with 10% glacial acetic acid solution impregnate
30min, then distilled water flushing 5min, then 30min is impregnated with 0.1% silver nitrate solution, it is developed the color with 3% sodium carbonate liquor
5min finally impregnates 5min with 10% glacial acetic acid solution.
5. method described in any one of claim 2-4 is between the Alaska grayling group of Xinjiang on genetic polymorphism map construction
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610241439.2A CN105779616B (en) | 2016-04-19 | 2016-04-19 | Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610241439.2A CN105779616B (en) | 2016-04-19 | 2016-04-19 | Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105779616A CN105779616A (en) | 2016-07-20 |
| CN105779616B true CN105779616B (en) | 2019-07-02 |
Family
ID=56396717
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610241439.2A Active CN105779616B (en) | 2016-04-19 | 2016-04-19 | Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105779616B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007084499A2 (en) * | 2006-01-13 | 2007-07-26 | San Diego State University | Disease control in shrimp |
-
2016
- 2016-04-19 CN CN201610241439.2A patent/CN105779616B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| 下游黑龙江茴鱼种群遗传变异及地理分化的微卫星分析;马波等;《中国水产科学》;20090930;第16卷(第5期);678-688 |
| 茴鱼微卫星标记开发及保护遗传学研究进展;刘云国等;《水产科学》;20160131;第35卷(第1期);全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105779616A (en) | 2016-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103387980B (en) | A kind of Portunus trituberculatus Miers microsatellite locus and primer | |
| CN110004235A (en) | A kind of relevant SNP site of fugu obscurus fast-growth and application | |
| CN107190092B (en) | Molecular marker, primer pair, molecular marker method and application for identifying flowering morning and evening of common head cabbage | |
| CN109266782B (en) | Molecular marker of muskmelon female flower regulatory gene g and application thereof | |
| CN108998547A (en) | A kind of microsatellite marking method for C. guichenoti paternity test | |
| CN108546774A (en) | A kind of SSR primers and identification method for purple chili Hybrid Purity | |
| CN102146460A (en) | Detecting method for Litopenaeus vannamei Boone LvE165 microsatellite DNA marker | |
| CN105779614B (en) | Utilize the Xinjiang Alaska grayling hereditary variation detection method of microsatellite marker Thymalag | |
| CN106520939A (en) | Snapper germplasm identification method and application thereof | |
| CN104531717B (en) | Rice-blast resistant genes Pike and application thereof | |
| CN102912017B (en) | Method for quickly and accurately identifying northern snakehead, Taiwan snakehead and hybrid snakehead | |
| CN105779613B (en) | Xinjiang Alaska grayling genotype detection method based on microsatellite marker Tarcticusg | |
| Li et al. | Genetic diversity of Sonneratia alba in China detected by inter-simple sequence repeats (ISSR) analysis | |
| CN105779616B (en) | Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 | |
| CN105779617B (en) | The primer and method that Xinjiang Alaska grayling is detected using microsatellite marker Thymall-02 | |
| CN105385769B (en) | SSR molecular marker method for identifying millet varieties and application | |
| CN105779615B (en) | A kind of genotype detection method of Xinjiang Alaska grayling microsatellite marker Thymallus | |
| Bi et al. | Genetic diversity of wild population of Pyropia haitanensis based on SSR analysis | |
| CN102321750A (en) | Method for rapidly screening bian chicken weight gain degree by molecular marking | |
| CN105950727B (en) | Lefteye flounder genotype detection primer and method based on microsatellite marker Paraoliva-1 | |
| CN110042169B (en) | Molecular marker primer, kit and identification method for group specificity of Fennel fish in Heilongjiang | |
| CN104846110B (en) | Saladifish detection primer and method based on microsatellite marker Epinmoyzh | |
| CN104818341A (en) | Detection primer and method of saladfish microsatellite marker Epinmoss | |
| CN104894257B (en) | Utilize the microsatellite marker Epinmoyn primers detected to saladifish genotype and method | |
| CN102758021B (en) | Recombination activating gene (RAG) 2 molecular marker restriction fragment length polymorphism (RFLP) identifying method for aquaculture of catfish hybrids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |