CN105779616A - Sinkiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 - Google Patents
Sinkiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 Download PDFInfo
- Publication number
- CN105779616A CN105779616A CN201610241439.2A CN201610241439A CN105779616A CN 105779616 A CN105779616 A CN 105779616A CN 201610241439 A CN201610241439 A CN 201610241439A CN 105779616 A CN105779616 A CN 105779616A
- Authority
- CN
- China
- Prior art keywords
- alaska grayling
- xinjiang
- primer
- grayling
- thymall
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a Sinkiang Alaska grayling detection primer and method based on a microsatellite marker Thymall-01. Firstly, genomic DNA in muscle of Sinkiang Alaska grayling is extracted and diluted to be used; secondly, specific primers are designed at the two ends of a Sinkiang Alaska grayling DNA sequence through a microsatellite core sequence contained in the Sinkiang Alaska grayling DNA sequence; then, PCR amplification is conducted on genomic DNA of different geographic stocks of Sinkiang Alaska grayling or genomic DNA of individuals in the Sinkiang Alaska grayling stocks through the primers, and detection is conducted on PCR products; analysis is conducted through bands appearing on the products, the genetype of each individual is determined, and a genetic polymorphism spectrum of Sinkiang Alaska grayling is acquired. The primer and the method have the advantages that the genetic polymorphism spectrum of the Sinkiang Alaska grayling genetic marker Thymall-01 can be quickly acquired, and the method is simple and convenient to implement.
Description
Technical field
The invention belongs to Xinjiang Alaska grayling (Thymallus arcticus grubei) DNA molecular Genetic Markers,
Relating to a kind of technical method detecting Xinjiang Alaska grayling microsatellite marker Thymall-01, specifically Xinjiang Alaska grayling is micro-defends
The genotype detection method of asterisk note Thymall-01.
Background technology
Xinjiang Alaska grayling (Thymallus arcticus grubei) belongs to salmon shape mesh (Salmoniformes), salmon section
(Salmonidae), grayling subfamily (Thymallinae), grayling belong to (Thymallus), be commonly called as grass speckle, oil mark, have another name called rod flower
Fish, flower shark's fin.Body is elongated, flat-sided, dorsal fin length and tall and big, and upper limb boss, in flag shape, has the stricture of vagina of several russet spot formations
Band, body colour is bright-coloured.The upstream that wild resource is mainly distributed on Fuyun County, Altay, Xinjiang city and Eerqisihe River, Burqin County is each
In tributary.Alaska grayling belongs to typical case cold water height oxygen consumption fish, lives in mountain stream streams throughout the year, and water quality is limpid pollution-free, and The turbulent river crashes its way through,
Pebbly place, river bed.Alaska grayling outward appearance is magnificent, and meat is the finest and the smoothest, is not only famous and precious Xinjiang Endemic fish, is also
The Fish Germplasm Resources that China is important, has high economic development value.Due to environmental pollution in recent years, forest deterioration and mistake
Crossing anthropic factors such as fishing for, the resource of this fish faces exhaustion, is classified as Xinjiang II class by the People's Government of Xinjiang Uygur Autonomous Regions
Important aquatic wild protection animal.In recent years, the research worker such as Xiang Wei of Production and Construction Corps of Xinjiang's Fishery technical Center for Popularization
Have begun to the artificial breeding of Alaska grayling, resource increment and artificial domesticating and cultivating research, and achieved certain research and become
Really, it is expected to realize the industrialization of cultivation.Xinjiang Alaska grayling is as a kind of emerging breed variety, genetics research relative thin
Weak, also there is no the report that microsatellite marker is developed.Although isoenzyme mark, RAPD labelling and AFLP labelling technique can be used for
The hereditary constitution of research Xinjiang Alaska grayling and genetic diversity thereof, broadly fall into dominant inheritance's labelling yet with these labellings,
Detection efficiency is high not as codominant markers such as microsatellite markers.It addition, the shortcoming of isoenzyme mark to be polymorphism low, RAPD marks
The stability of note is bad, and AFLP marking operation is loaded down with trivial details, and these all greatly limit their application.And microsatellite sequence extensively divides
Being distributed in eukaryotic gene group, be characterized in that kind is many, allele number is many, and polymorphism is high, codominance, mendelian inheritance
Mode, and be randomly distributed in genome, and microsatellite marker detection efficiency is high, and result is stable.But owing to lacking Xin Jiangbei
Pole grayling microsatellite marker, limits the development of its molecule genetics research, so in the urgent need to obtaining microsatellite marker to enter
The research of the aspects such as row Xinjiang Alaska grayling genetic diversity, individual identification and genealogical identification and application.
Summary of the invention
It is an object of the invention to provide the Xinjiang Alaska grayling DNA molecular Genetic Markers of a kind of high polymorphism, newly
The method for quick of boundary Alaska grayling microsatellite marker Thymall-01, to make up the deficiency of prior art.
The basic conception of the present invention mainly by the microsatellite core sequence contained in the Alaska grayling DNA sequence of Xinjiang,
Go forward side by side performing PCR detection in its design specific primers at both ends, thus the detection Xinjiang each individuality of Alaska grayling is micro-at this rapidly
The hereditary variation in satellite district, it is thus achieved that this primer (microsatellite marker Thymall-01) the polymorphism collection of illustrative plates to Xinjiang Alaska grayling,
The genotype of each individuality is detected intuitively by collection of illustrative plates.Based on above-mentioned background present situation and actual requirement, the present invention is from Xinjiang
Alaska grayling DNA sequence obtains a microsatellite marker, named Thymall-01, this microsatellite marker Thymall-01
Can be used for Xinjiang Alaska grayling analysis of genetic diversity and genealogical identification.
The present invention completes according to following operational aspect: first extract the genome in the Alaska grayling muscle of Xinjiang
DNA diluted for use；The microsatellite core sequence contained in the Alaska grayling genomic dna sequence of recycling Xinjiang, in its sequence
Design specific primers at both ends；Then use this primer in Xinjiang Alaska grayling difference proles or Xinjiang Alaska grayling group
The genomic DNA of body carries out PCR amplification, and PCR primer is carried out denaturing polyacrylamide gel electrophoresis detection, so that it is determined that each
Individual genotype, it is thus achieved that the genetic polymorphism collection of illustrative plates of Xinjiang Alaska grayling.
Extract Xinjiang Alaska grayling genomic DNA, be diluted in 100ng/ μ l, each PCR reaction add 1 μ l, instead
Answering cumulative volume is 25 μ l.
DNA sequence containing microsatellite sequence is:
1 ccaatgcaac agcttttgaa cgtggacttt ggataagtag gtatacccag aggataagta
61 ggtataccca gaggtataaa tgtgtgttcg acacccatgc tatctataca gcaacctctg
121 gtcctggtgg aattgtcaac ttgtgaattc agactttgct ttcatttaca cttttatgtg
181 tcgtcgtcgt cgtcgtcgtc gttctcagta ggtagacatt tttttgaata ataacagggt
241 aacatgtaac aacttactcc tcgttagtat agtggtgagt atccccgcct gtcacgcggg
301 agaccggggt tcaattcccc gacggggagg aatgactaca ccttttacga agacgctatg
361 tggcagtcgt gcaaggcgtc tgtgtttcag tggt
Wherein microsatellite core sequence is:
GTCGTCGTCGTCGTCGTCGTC
Thymall-01 micro-satellite primers sequence is:
Normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ',
Minus strand 5 '-TGTAGTCATTCCTCCCCGTC-3 ', uses annealing temperature during this primer to be 58 DEG C.
Microsatellite core sequence and primer sequence are the cores of the present invention, in the Alaska grayling Diversity Detection of Xinjiang
Present polymorphism.
The sample-adding parameter of PCR amplification is: each PCR reaction cumulative volume is 25 μ l, including 100ng Xinjiang Alaska grayling gene
Group DNA；10 × PCR Buffer, 2.5 μ l；Mg2+1.5mmol/L；Tag enzyme 1u；The each 0.1mmol/L of dNTP；Above-mentioned primer is each
10pmol；Add ddH2O to 25 μ l.The program parameter arranging PCR instrument when using this primer is: 94 DEG C of degeneration 2min；94℃
30sec, 58 DEG C of 45sec, 72 DEG C of 40sec, this reaction carries out 35 circulations；72 DEG C extend 5 min, 4 DEG C of preservations.
The detecting step of PCR primer: by PCR primer in the denaturing polyacrylamide gel of 8% with 15W invariable power electrophoresis
Within 1.5 hours, separate.After electrophoresis terminates, first soak 30min, then distilled water flushing with the glacial acetic acid solution of 10%
5min, then with 0.1% silver nitrate solution soak 30min, with 3% sodium carbonate liquor colour developing 5min, finally with 10% ice
Acetum soaks 5min, i.e. can get the polymorphism collection of illustrative plates of Xinjiang Alaska grayling microsatellite marker Thymall-01.
Therefore, it is characteristic of the invention that and can obtain the Thymall-01 microsatellite marker of Xinjiang Alaska grayling efficiently
Mapping genetic variations, method is easy.And, for other molecular genetic marker technique, microsatellite marker meets Meng De
That hereditary pattern, in codominant inheritance, acquired results can detect the genotype of each individuality of Xinjiang Alaska grayling intuitively；And
It is applied in different proles or Xinjiang Alaska grayling group genetic marker, genealogical identification and the structure etc. of genetic map between individuality.
Accompanying drawing explanation
Fig. 1 is the detection collection of illustrative plates (numbering that microsatellite marker Thymall-01 of the present invention is individual to Xinjiang Alaska grayling 20
1 20 is 20 individualities of Xinjiang Alaska grayling).
Detailed description of the invention
The present invention is described in detail at Xinjiang Alaska grayling Thymall-01 microsatellite core sequence DNA below by embodiment
Molecular genetic marker technique method.First the genomic DNA in the Alaska grayling muscle of Xinjiang diluted for use are extracted；Recycling is new
The microsatellite core sequence contained in boundary Alaska grayling DNA sequence, in its sequence design specific primers at both ends；Then using should
Primer carries out PCR amplification to genomic DNA individual in Xinjiang Alaska grayling difference proles or Xinjiang Alaska grayling group, right
PCR primer carries out denaturing polyacrylamide gel electrophoresis detection, determines the genotype of each individuality, i.e. obtains Xinjiang Alaska grayling
Genetic polymorphism collection of illustrative plates.
1, the extraction of Xinjiang Alaska grayling genomic DNA: 100 g Xinjiang Alaska grayling muscle are added Eppendorf pipe
In, add E.C. 3.4.21.64 5 l of cell pyrolysis liquid 500 l and 20mg/ml, shake up gently, 37 DEG C are overnight.Then in cracking
Adding 600 l phenol chloroform isoamyl alcohol (25 24 1) mixed liquors in good sample, after rocking 20min, 12000rpm is centrifuged
10min, takes supernatant.Add phenol chloroform isoamyl alcohol mixed liquor, repeat aforesaid operations 3 times.Take supernatant again, add 2 times
The dehydrated alcohol of volume cooling and the sodium acetate of the 3mol/L of 1/10 volume, 12000rpm is centrifuged 10min, abandoning supernatant, protects
DNA is stayed to precipitate, then by this precipitation of 70% washing with alcohol 2 times, after ethanol volatilization completely, with TE buffer solution DNA and dilute
It is interpreted as 100ng/ μ l, 4 DEG C of preservations.
2, the design of micro-satellite primers: on the basis of the Alaska grayling DNA sequence of Xinjiang, utilize the sequence of microsatellite DNA both sides
It is listed in well-conserved relative to core sequence of same species, accordingly in its design specific primers at both ends, amplifies with it
The microsatellite fragment in this site.Owing to microsatellite core sequence mutation rate is of a relatively high, microsatellite DNA core sequence is caused to repeat
Being increased or decreased of number of times, the i.e. change of microsatellite DNA sequence length, this is the root of detection microsatellite polymorphism.The present invention
The specific primer sequence at core sequence two ends, microsatellite district be: normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ', minus strand
5 '-TGTAGTCATTCCTCCCCGTC-3 ', use annealing temperature during this primer to be 58 DEG C.
3, PCR amplification: being first loaded, sample-adding amount is as follows: Xinjiang Alaska grayling genomic DNA (100ng/L), 1 μ l；10×
PCR Buffer, 2.5 μ l；Mg2+(25mmo1/L), 1.5 μ l；Taq enzyme (5u/ μ l), 0.2 μ l；DNTP (each 2.5mmo/L), 1 μ
l；Primer (each 10pmol/ μ l), 1 μ l；Add aquesterilisa to 25 μ l.Secondly, PCR reaction is carried out, its PCR amplification instrument program parameter
For: 94 DEG C of degeneration 2min；94 DEG C of 30sec, 58 DEG C of 45sec, 72 DEG C of 40sec, 35 circulations；72 DEG C extend 5min, 4 DEG C of preservations.
4, the detection of PCR primer: PCR primer is separated by electrophoresis on the denaturing polyacrylamide gel of 8%, electrophresis apparatus merit
Rate is 15W, and electrophoresis time is about 1.5 hours.After electrophoresis terminates, first soak 30min, then with the glacial acetic acid solution of 10%
Distilled water flushing 5min, the silver nitrate solution of 0.1% soaks 30min, and the sodium carbonate liquor colour developing 5min of 3%, finally with 10%
Glacial acetic acid solution soak 5min i.e. can get the Xinjiang Alaska grayling polymorphism figure at Thymall-01 microsatellite core sequence
Spectrum, as shown in Figure 1.Fig. 1 result shows, 20 individual coamplifications of Xinjiang Alaska grayling go out 10 allele, and micro-defending is described
Asterisk note Thymall-01 has more much higher state property, is appropriate to Xinjiang Alaska grayling genetic diversity and hereditary constitution divides
The research of the aspects such as analysis, individual identification and genealogical identification and application.
<110>Xinjiang University
<120>Xinjiang based on microsatellite marker Thymall-01 Alaska grayling detection primer and method
<160> 1
<210> 1
<211> 394
<212> DNA
<213>Xinjiang Alaska grayling (Thymallus arcticus grubei)
<220>
<221> repeat_region
<222> (180)...(200)
<400> 1
1 ccaatgcaac agcttttgaa cgtggacttt ggataagtag gtatacccag aggataagta
61 ggtataccca gaggtataaa tgtgtgttcg acacccatgc tatctataca gcaacctctg
121 gtcctggtgg aattgtcaac ttgtgaattc agactttgct ttcatttaca cttttatgtg
181 tcgtcgtcgt cgtcgtcgtc gttctcagta ggtagacatt tttttgaata ataacagggt
241 aacatgtaac aacttactcc tcgttagtat agtggtgagt atccccgcct gtcacgcggg
301 agaccggggt tcaattcccc gacggggagg aatgactaca ccttttacga agacgctatg
361 tggcagtcgt gcaaggcgtc tgtgtttcag tggt
Claims (5)
1. one group utilizes the primer that Xinjiang Alaska grayling genotype is detected by microsatellite marker Thymall-01, and its feature exists
In,
Wherein said primer is sequence:
Normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ',
Minus strand 5 '-TGTAGTCATTCCTCCCCGTC-3 ', uses annealing temperature during this primer to be 58 DEG C.
2. utilize the method that Xinjiang Alaska grayling genotype is detected by microsatellite marker Thymall-01, it is characterised in that
First the genomic DNA in the Alaska grayling muscle of Xinjiang diluted for use are extracted；Recycling Xinjiang Alaska grayling DNA sequence contains
Some microsatellite core sequences, use specific primer that the genomic DNA of Xinjiang Alaska grayling Different Individual is carried out PCR expansion
Increase, PCR primer is carried out denaturing polyacrylamide gel electrophoresis detection, so that it is determined that Xinjiang Alaska grayling Different Individual exists
The genotype in Thymall-01 core sequence district, wherein said Xinjiang Alaska grayling microsatellite marker Thymall-01 is the most special
Property primer is:
Normal chain 5 '-TCTGGTCCTGGTGGAATTGT-3 ',
Minus strand 5 '-TGTAGTCATTCCTCCCCGTC-3 ', uses annealing temperature during this primer to be 58 DEG C.
Utilize microsatellite marker Thymall-01 that Xinjiang Alaska grayling genotype is detected the most as claimed in claim 2
Method, it is characterised in that the PCR amplification that the genomic DNA that different Xinjiang Alaska grayling is individual is carried out, its sample-adding parameter is:
Each PCR reaction cumulative volume is 25 μ l, including 100ng Xinjiang Alaska grayling genomic DNA；10 × PCR Buffer, 2.5 μ l；
Mg2+1.5 mmol/L；Taq enzyme 1u；dNTP 0.1mmol/L；Each 10 pmol of specific primer in claim 1；Finally add
ddH2O to 25 μ l；The program parameter arranging PCR instrument is: 94 DEG C of degeneration 5min；94 DEG C of 45sec, 58 DEG C of 1min, 72 DEG C
40sec, this reaction carries out 35 circulations；72 DEG C extend 5 min, 4 DEG C of preservations.
Utilize microsatellite marker Thymall-01 that Xinjiang Alaska grayling genotype is detected the most as claimed in claim 2
Method, it is characterised in that PCR primer is carried out the step of denaturing polyacrylamide gel electrophoresis detection: by PCR primer 8%
Denaturing polyacrylamide gel within 1.5 hours, separate with 15W invariable power electrophoresis, with 10% glacial acetic acid solution soak
30min, then distilled water flushing 5min, then soak 30min with the silver nitrate solution of 0.1%, the sodium carbonate liquor with 3% develops the color
5min, finally soaks 5min with the glacial acetic acid solution of 10%.
5. the application on genetic polymorphism map construction between the Alaska grayling colony of Xinjiang of the method described in claim 2-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610241439.2A CN105779616B (en) | 2016-04-19 | 2016-04-19 | Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610241439.2A CN105779616B (en) | 2016-04-19 | 2016-04-19 | Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105779616A true CN105779616A (en) | 2016-07-20 |
| CN105779616B CN105779616B (en) | 2019-07-02 |
Family
ID=56396717
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610241439.2A Active CN105779616B (en) | 2016-04-19 | 2016-04-19 | Xinjiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105779616B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007084499A2 (en) * | 2006-01-13 | 2007-07-26 | San Diego State University | Disease control in shrimp |
-
2016
- 2016-04-19 CN CN201610241439.2A patent/CN105779616B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007084499A2 (en) * | 2006-01-13 | 2007-07-26 | San Diego State University | Disease control in shrimp |
Non-Patent Citations (2)
| Title |
|---|
| 刘云国等: "茴鱼微卫星标记开发及保护遗传学研究进展", 《水产科学》 * |
| 马波等: "下游黑龙江茴鱼种群遗传变异及地理分化的微卫星分析", 《中国水产科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105779616B (en) | 2019-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103387980B (en) | A kind of Portunus trituberculatus Miers microsatellite locus and primer | |
| CN104357553B (en) | A kind of Pelteobagrus fulvidraco microsatellite Parentage determination method | |
| Sotowa et al. | Molecular relationships between Australian annual wild rice, Oryza meridionalis, and two related perennial forms | |
| CN103757113B (en) | Microsatellite fluorescent multiple PCR (Polymerase Chain Reaction) method used in paternity testing of grass carps | |
| CN105385697A (en) | Sesame inflorescence restricted gene Sidt1 and SNP marker thereof | |
| CN102146460A (en) | Detecting method for Litopenaeus vannamei Boone LvE165 microsatellite DNA marker | |
| CN105331731B (en) | A kind of and SNP marker of sesame seed seed coat colour gene close linkage | |
| CN105779614B (en) | Utilize the Xinjiang Alaska grayling hereditary variation detection method of microsatellite marker Thymalag | |
| CN105779613B (en) | Xinjiang Alaska grayling genotype detection method based on microsatellite marker Tarcticusg | |
| CN105779616A (en) | Sinkiang Alaska grayling detection primer and method based on microsatellite marker Thymall-01 | |
| CN105755165B (en) | A kind of the genotype detection primer and method of lefteye flounder microsatellite marker Paraoliva-2 | |
| CN105779617A (en) | Primer and method for Sinkiang Alaska grayling detection through microsatellite marker Thymall-02 | |
| CN105779615B (en) | A kind of genotype detection method of Xinjiang Alaska grayling microsatellite marker Thymallus | |
| CN105950727B (en) | Lefteye flounder genotype detection primer and method based on microsatellite marker Paraoliva-1 | |
| CN105349677B (en) | Recover round-grained rice Rice Resistance black streak dwarf site and molecule labelling method | |
| CN104818341B (en) | A kind of saladifish microsatellite marker Epinmoss detection primer and method | |
| CN104846110B (en) | Saladifish detection primer and method based on microsatellite marker Epinmoyzh | |
| CN110042169B (en) | Molecular marker primer, kit and identification method for group specificity of Fennel fish in Heilongjiang | |
| CN102758021B (en) | Recombination activating gene (RAG) 2 molecular marker restriction fragment length polymorphism (RFLP) identifying method for aquaculture of catfish hybrids | |
| CN101038269B (en) | Detecting method of cynoglossus semilaevis microsatellite marker HSTS_lx | |
| CN104894257B (en) | Utilize the microsatellite marker Epinmoyn primers detected to saladifish genotype and method | |
| CN113881780A (en) | Application of rs81439307 SNP molecular marker in breeding of live pig strain related to body length | |
| CN105219771A (en) | The molecule marker that chicken frizzled feather proterties is relevant and application thereof | |
| Li et al. | Genetic variation within the endangered mangrove species Sonneratia paracaseolaris (Sonneratiaceae) in China detected by inter-simple sequence repeats analysis | |
| CN104099412A (en) | Evaluation method for releasing effect of Marsupenaeus Japonicus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |