CN105732153A - Phosphate solubilizing bacterium induction fertilizer capable of improving effectiveness of phosphor element in acidic soil and applications thereof - Google Patents
Phosphate solubilizing bacterium induction fertilizer capable of improving effectiveness of phosphor element in acidic soil and applications thereof Download PDFInfo
- Publication number
- CN105732153A CN105732153A CN201511030524.6A CN201511030524A CN105732153A CN 105732153 A CN105732153 A CN 105732153A CN 201511030524 A CN201511030524 A CN 201511030524A CN 105732153 A CN105732153 A CN 105732153A
- Authority
- CN
- China
- Prior art keywords
- fertilizer
- phosphate solubilizing
- phosphate
- induction
- solubilizing bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05B—PHOSPHATIC FERTILISERS
- C05B1/00—Superphosphates, i.e. fertilisers produced by reacting rock or bone phosphates with sulfuric or phosphoric acid in such amounts and concentrations as to yield solid products directly
- C05B1/02—Superphosphates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01C—PLANTING; SOWING; FERTILISING
- A01C21/00—Methods of fertilising, sowing or planting
- A01C21/005—Following a specific plan, e.g. pattern
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05D—INORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C; FERTILISERS PRODUCING CARBON DIOXIDE
- C05D9/00—Other inorganic fertilisers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Soil Sciences (AREA)
- Organic Chemistry (AREA)
- Environmental Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Inorganic Chemistry (AREA)
- Fertilizers (AREA)
Abstract
The invention relates to microbial fertilizer, and specifically discloses a phosphate solubilizing bacterium induction fertilizer capable of improving the effectiveness of phosphor element in acidic soil and applications thereof. The fertilizer is prepared by adding a phosphor fertilizer into an induction matrix and then subjecting the mixture to a stress treatment of acidic rain with a pH value of 3.5 to 4. The reproduction of most species of phosphate solubilizing microorganisms in the induction matrix is activated; after the stress treatment, the step of using a specific culture medium to screen high efficient phosphate solubilizing bacteria is eliminated, the activated induction matrix containing a plurality of phosphate solubilizing floras is subjected to aerobic culture, then the induction matrix is directly mixed into the cultivation soil according to a ratio of 10 to 15%, and the whole induction matrix is taken as a phosphate solubilizing bacterium fertilizer. The method breaks the limitation of a method using a specific culture medium to select high efficient phosphate solubilizing bacteria, largely enlarges and enriches the resources of phosphate solubilizing bacteria, moreover, the operation is simple and convenient, the cost is low, and the practicality is strong.
Description
Technical field
The present invention relates to microbial manure, specifically, relate to a kind of phosphorus decomposing induction fertilizer improving acid ground P bioavailability and application thereof.
Background technology
Phosphorus is nutrient necessary to growth and development of plants, is also one of main nutrient elements limiting crop yield.The serious phosphorus deficiency of southern area red soil self, in soil, the phosphorus of more than 95% is invalid phosphorus, and plant is difficult with.Soil phosphorus deficiency and the low situation of phosphate fertilizer utilization efficiency, making a large amount of inputs significantly increasing production the phosphate fertilizer that invariably accompanies of grain, this not only causes the waste of limited phosphate fertilizer resource, also necessarily causes the raising of phosphorus concentration in track and field stream, cause the eutrophication of water body, cause the pollution of environment.Therefore, seek to dissolve crop in soil and be difficult by the approaches and methods of phosphorus, improve phosphate fertilizer utilization efficiency, sustainable development and the holocoenotic maintenance to agricultural, all have great importance.
Phosphorus-solubilizing bacteria (Phosphate～solubilizingmicroorganisms, PSM) is a kind of special microbe groups in soil, it is possible to the phosphorus being difficult to plant absorb is converted into the form that can absorb.Phosphate solubilizing microorganism includes the microorganism of the multiple monoids such as phosphate-solubilizing bacteria, phosphorus decomposing fungus, actinomycetes.What current people studied at most is phosphorus bacteria fertilizer, and its kind has bacillus (Bacillus), Erwinia (Erwinia), Rhodopseudomonas (Pseudomonas), Chromobacterium (Clromobacterium) etc.；The phosphate solubilization of P-dissolving fungi is generally better than antibacterial, but it less than phosphorus bacteria fertilizer, mainly has Penicillium (Penicillium), Eurotium (Aspergillus), Rhizopus (Rhizopus) etc. on value volume and range of product；Actinomycetes are mainly streptomyces (Streptomyces) molten phosphorus.According to the difference dissolving substrate, also phosphorus-solubilizing bacteria is divided into inorganic phosphorus-solubilizing bacteria and organic phosphorus-solubilizing bacteria.The Inorganic phosphorus compound that directly can not be absorbed by crop of slightly solubility in soil can be dissolved and be converted into a quasi-microorganism of the available P compound that crop can absorb and be called inorganic phosphorus-solubilizing bacteria, can decompose the beneficial microbe of organic phosphide (lecithin, nucleic acid and plant plain etc.) in soil organic phosphorus-solubilizing bacteria.Additionally also having phosphate solubilizing bacteria greatly can solve inorganic phosphorous compound, can solve again organic phosphorus compound, they are mainly some kinds of Arthrobacter and streptomyces.Generally speaking, phosphate solubilizing bacteria is of a great variety, and decomposition mechanism is not quite similar and more complicated, studies phosphate solubilizing bacteria to people and causes certain puzzlement.
Screening efficient phosphorus-dissolution bacterium produces the phosphate solubilizing bacterial manure possessing efficient phosphate-solubilizing function, thus, it is the effective approach of utilization ratio improving plant to phosphorus element.Current people obtain certain efficient phosphate-solubilizing bacterium mainly through selecting the culture medium of high accumulation ability to carry out screening and separating, and prepare phosphate solubilizing bacterial manure by Inoculant expanding propagation and utilization in addition.Culture medium culturing method can be enriched with and obtain certain specific efficient phosphate-solubilizing bacterial strain, but culture medium the bacterial strain of culture of isolated can only account for the 1% of microbial count.And of a great variety due to phosphate solubilizing microorganism, decomposition mechanism is not quite similar and more complicated, this screening technique is made to can be obtained with efficient phosphate-solubilizing bacterium very limited, in addition separating under laboratory controllable environment because the change of microhabitat affects the performance of its phosphate solubilization after the high efficient strain obtained enters land for growing field crops, phosphate solubilizing bacterial manure hardly results in guarantee at the implementation result of big Tanaka.Screening and the production of the current phosphate solubilizing bacteria particularly phosphate solubilizing bacteria of applicable acid ground are subject to great limitation, it would be highly desirable to develop more more rich phosphate solubilizing bacteria resource.
The study find that in inducer substance, add phosphorus element, and adopt acid rain stress, many of phosphate solubilizing bacteria quantity and kind can be effectively increased, no longer adopt culture medium concentration and separation afterwards, in directly the inducer substance containing multiple phosphate solubilizing bacteria (wherein comprising a large amount of not educable phosphate solubilizing bacteria population) being manured into soil, make multiple phosphate solubilizing bacteria that original microhabitat can be relied on to continue expanding propagation in soil, play phosphate solubilization.The phosphate solubilizing bacteria hybrid composting that this kind of mode produces can be prevented effectively from the simple limitation adopting enrichment medium to cultivate, with low cost, easy and simple to handle.
Summary of the invention
In order to solve problems of the prior art, it is an object of the invention to provide a kind of phosphate solubilizing bacterial manure improving acid ground P bioavailability and application thereof.
In order to realize the object of the invention, technical scheme is as follows:
First aspect, the invention provides a kind of phosphate solubilizing bacteria induction fertilizer improving acid ground P bioavailability, described phosphate solubilizing bacteria induction fertilizer by adding phosphate fertilizer in inducer substance, and after the artificial acid rain stress of pH3.5～4.5 processes, cultivate the induction containing a large amount of not educable phosphate solubilizing microorganisms obtained then through expanding propagation fertile.Finding through experiment, utilizing the artificial acid rain of pH3.5～4.5 that the inducer substance adding phosphate fertilizer is carried out Stress treatment, in substrate, the gene band of phosphate solubilizing microorganism is the abundantest, and band colourity is the deepest, it was shown that its phosphate solubilizing bacteria quantity and population are maximum.
Further, described inducer substance is formed by fermentation of fully becoming thoroughly decomposed after the mixing of deadwood leaf, cattle manure, coal ash soil and straw, and C/N is 24～30, and moisture content is 50～60%, and the content of organic matter is 50～60%.Meet the inducer substance of above-mentioned condition, with low cost, it is easy to obtain, and the microbial population resource enough enriched can be provided, it is adapted as the inducer substance of phosphate solubilizing microorganism.
When adding phosphate fertilizer in inducer substance, described phosphate fertilizer is 1-5g kg relative to the addition of inducer substance-1, namely every 1kg inducer substance adds containing 1-5g phosphate fertilizer.This addition can stimulate the breeding of phosphate solubilizing microorganism, does not result in again the leaching loss of phosphorus during later stage acid rain leaching.
Described phosphate fertilizer is the mixture of organic phosphatic fertiliser and inorganic phosphorus fertilizer.The present invention finds through experiment and confirms, processes then through acid rain stress, activated the phosphate solubilizing microorganism quantity obtained the abundantest in inducer substance after adding organic phosphatic fertiliser and inorganic phosphorus fertilizer process.
As preferably, described organic phosphatic fertiliser is ground phosphate rock, and described inorganic phosphorus fertilizer is calcium superphosphate.
Further, described artificial acid rain adds water and is made into after being made into artificial acid rain mother solution by sulphuric acid and nitric acid 3:1 in molar ratio.This proportioning have references to the S:N ratio of current China's nature acid rain, when leaching enters soil, and can effective simulating nature circle soil acidification environment.
Described artificial treatment with simulated acid rain is every 1kg compost configuration artificial acid rain of leaching 80～100ml, every time slow uniformly leaching, and once, leaching continues 30 days to every 48 hours leachings.This processing mode can make spray acid solution every time fully infiltrate all substrate, 48 hours soil moisture of interval leaching once again after reducing, and makes leaching liquor to ooze out and causes the leaching loss of nutrient of substrate.
During leaching, use the flat Plastic Drum of column type as the instrument of splendid attire, contain inducer substance 1.0～3.0kg.Open aperture at the bottom of Plastic Drum in order to leak, let slip a remark down and lay undertaking bottle.By adding phosphate fertilizer the compost loading Plastic Drum mixed, placing several anyhow staggered glass fibre on surface again, both ensured that leaching was uniform after installing, when being possible to prevent again to spray acid rain, fertilizer grain spills.It should be noted that those skilled in the art can use any means carry out leaching and ensure that leaching is uniform, not limitation and said method.
Further, after artificial treatment with simulated acid rain, under the aerobic condition of 25～37 DEG C, expanding propagation is cultivated 7～10 days.
Second aspect, the invention provides the fertile application in improving acid ground P bioavailability of described phosphate solubilizing bacteria induction.
Described application is particularly as follows: apply topsoil soils by described phosphate solubilizing bacteria induction fertilizer by relative to the mass ratio of topsoil soils 10～15%.
The beneficial effects of the present invention is:
The present invention in rich in the inducer substance of microorganism in add organic phosphatic fertiliser and inorganic phosphorus fertilizer, after mix homogeneously, adopt the acidic aqueous solution interval leaching of certain acidity, excite the breeding of various phosphate solubilizing microorganisms in inducer substance, then efficient phosphate-solubilizing bacterium is not screened again through specific enrichment medium, but by after the aerobic cultivation of the inducer substance rich in multiple phosphorus solution bacteria community that is activated, overall induce fertilizer to use as phosphate solubilizing bacteria.So, the phosphate solubilizing bacteria induction fertilizer obtained contains and by the phosphorus solution bacteria community of defined medium separation purification, can not widen the living resources of phosphate solubilizing bacteria.Phosphate solubilizing bacteria induction fertilizer is directly used in ecosystem, also significantly increases the phosphorus solution bacteria community definite value ability when land for growing field crops is used and dissolving P capacity.This preparation method is easy and simple to handle, with low cost, the compound phosphorus solution bacteria community strong adaptability prepared, and is the preparation method of the phosphate solubilizing bacteria compound fertilizer of effective raising acid ground phosphorus extract plant available phosphorus.
Accompanying drawing explanation
Fig. 1 is the DGGE collection of illustrative plates of soil microorganism in comparative example 2 of the present invention；
Fig. 2 is soil phosphate solubilizing microorganism phyletic evolution developmental analysis tree in comparative example 2 of the present invention.
Detailed description of the invention
Following example are used for illustrating the present invention, but are not limited to the scope of the present invention.
The preparation of embodiment 1 phosphate solubilizing bacteria induction
1. choosing the windrow become thoroughly decomposed as inducer substance, be mainly composed of deadwood leaf, cattle manure, coal ash soil and straw, C/N is 25.7, moisture content 55.5%, the content of organic matter 45.6%.
2. using the flat Plastic Drum of column type of internal diameter 18cm, high 28cm, every barrel contains 1kg inducer substance, adds inorganic phosphorus fertilizer (1g calcium superphosphate) and organic phosphatic fertiliser (5g ground phosphate rock) is sufficiently stirred for mixing.
3., after being made into artificial acid rain mother solution with analytical pure sulfuric acid and nitric acid 3:1 in molar ratio, add tap water (pH7.0) and be made into the acidic aqueous solution of pH3.5.
4. every barrel of spray acidic aqueous solution 100ml, uniformly slow leaching, first sprays 50ml during leaching, and several minutes of resting sprays 50ml again after the abundant moistening of substrate.Make spray acid solution every time can fully infiltrate substrate will not drench and cause leaching loss of nutrient again.Every 48 hours sprays once.Persistently spray 30 days.
5. after leaching terminates, fertile expanding propagation cultivation 10 days, the mix homogeneously under 37 DEG C of aerobic conditions of phosphate solubilizing bacteria induction that will have activated, to obtain final product.
Comparative example 1
1. choosing the windrow become thoroughly decomposed as inducer substance, be mainly composed of deadwood leaf, cattle manure, coal ash soil and straw, C/N is 25.7, moisture content 55.5%, the content of organic matter 45.6%.
2. use the flat Plastic Drum of column type of internal diameter 18cm, high 28cm, every barrel contains 1kg inducer substance, it is divided into interpolation organic phosphatic fertiliser (5g ground phosphate rock), adds inorganic phosphorus fertilizer (1g calcium superphosphate), add inorganic phosphorus fertilizer (1g calcium superphosphate) and organic phosphatic fertiliser (5g ground phosphate rock) four process simultaneously, comparison is for without phosphate fertilizer, being sufficiently stirred for mixing, each process arranges 5 repetitions, amounts to 20 basins.
3., after being made into artificial acid rain mother solution with analytical pure sulfuric acid and nitric acid 3:1 in molar ratio, add tap water (pH7.0) and be made into the acidic aqueous solution of pH4.1.
4. every barrel of spray acidic aqueous solution 100ml, uniformly slow leaching, first sprays 50ml during leaching, and several minutes of resting sprays 50ml again after the abundant moistening of substrate.Make spray acid solution every time can fully infiltrate substrate will not drench and cause leaching loss of nutrient again.Every 48 hours sprays once.Persistently spray 30 days.
5. after leaching terminates, fertile expanding propagation cultivation 10 days, the mix homogeneously under 37 DEG C of aerobic conditions of phosphate solubilizing bacteria induction that will have activated.Culture method is adopted to detect its phosphate solubilizing microorganism quantity as shown in table 1:
The phosphate solubilizing microorganism quantity of the phosphate solubilizing bacteria induction fertilizer of table 1 different phosphate fertilizers addition manner
Visible, process then through acid rain stress after inducer substance adds organic phosphatic fertiliser and inorganic phosphorus fertilizer process, activated the phosphate solubilizing microorganism quantity obtained the abundantest.
Comparative example 2
1. choosing the windrow become thoroughly decomposed, be mainly composed of deadwood leaf, cattle manure, coal ash soil and straw, C/N is 26.7, and moisture content is 52.8%, and the content of organic matter is 55.3%.
2. use internal diameter 12cm, the flat Plastic Drum of column type of high 20cm contains 1000g windrow, applies 2.0g calcium superphosphate, 5g ground phosphate rock, is sufficiently stirred for mixing.
3., after being made into artificial acid rain mother solution with analytical pure sulfuric acid and nitric acid 3:1 in molar ratio, add tap water (about pH6.5) and be made into the acidic aqueous solution that pH value is 3.5,4.5,5.5,6.5 respectively, compare as tap water.Each pH value processes 5 basins.
4. take the acidic aqueous solution 80ml leaching of different pH value every 48 hours, continue 30 days.
5. leaching takes inducer substance sample 10g after terminating, and after cultivating 10 days, adopts molecular biotechnology to analyze its phosphate-solubilizing bacteria Allelic richness under 37 DEG C of aerobic conditions.
Fetch earth earth microorganism total DNA, adopts PCR DGGE to change in conjunction with sequencing analysis soil phosphorus decomposing functional microorganism.Rely on acid phosphatase functional gene design primer, it is thus achieved that pH3.5, pH4.5, pH5.5, pH6.5 acid rain leaching after soil phosphate solubilizing microorganism population gene diversity change.
Soil microorganism total DNA extraction: adopt U.S. Mo～Bio test kit to extract soil microbial DNA.Amplimer adopts ALPS～F730 and ALPS～R1101.
PCR primer sequence is:
ALPS～F730:5`～ACTCCTACGGGAGGCAGCAG～3`；
ALPS～R1101:ATTACCGCGGCTGCTGG～3`.
PCR reaction system: adopt 50 μ L amplification systems, including: 10 × PCRBuffer5 μ L；DNTPMixture (each 2.5mM) 4 μ L；Primer 338F (20 μMs) 1 μ L；Primer 534R (20 μMs) 1 μ L；Template DNA 2.5ng；TaKaRarTaq(5U/μL)0.25μL；DdH2O mends to 50 μ L.Pcr amplification program: 94 DEG C of 10min, then { 72 DEG C extend 1min30s}, and final 72 DEG C extend 10min for 94 DEG C of degeneration 1min, 55 DEG C of annealing 1min (each circulation reduces by 0.1 DEG C) in 30 circulations.
DGGE atlas analysis: (H=-∑ (Pi) (log2Pi) analyzes the change of phosphorus element microbial multiformity to adopt Shannon index.Adopt Phylip4.0 computed in software separating degree, and adopt Mega3.1 analysis to do cluster analysis.DGGE reclaims band clone: (TaKaRa numbers: D102A/D102B) to adopt the TaKaRa PMD19～carrier T produced, (TaKaRa numbers DH5 α competent cell: D9057S/D9057A), (TaKaRa numbers: D9031A) clone for IPTG (TaKaRa numbering D9030A), X～Gal.
Research conclusion:
Protocols in Molecular Biology can effectively detect microbe species and the changes of function of soil 98%, can be appreciated more fully from microbiologic population's information compared with traditional culture method.In this research in the PCR collection of illustrative plates of soil microorganism STb gene PCR primer in 250bp position, it is judged that for the purpose of fragment.DGGE electrophoresis result such as Fig. 1.Research finds, compared with comparison pH6.5, under pH3.5 acidity environment, soil phosphate solubilizing microorganism gene band is the abundantest, and band colourity is the deepest, it was shown that its phosphate solubilizing bacteria quantity and population are maximum.
Selecting the specific band cloning and sequencing under different disposal, band is numbered: 1,11,16,20,21,23,26,28 totally 8 bands (Fig. 1).On flat board, random 3 positive colonies of picking carry out sequencing analysis, and bacterium solution checks order, sequencing primer: M13F (-47).Through NCBI order-checking comparison analysis (table 2), obtain 13 different soils microbial strains that homology is good altogether.
Table 2NCBI checks order comparison analysis
Further 13 bacterial strains that homology is good are made phyletic evolution developmental analysis tree such as Fig. 2, it has been found that the special phosphate solubilizing microorganism wherein occurred when pH4.5 has the floras such as MassiliaaerilataB101 (HF585364.1), Acinetobactersp.strainB2188 (KF295190.1) RaoultellaterrigenastrainPKG-3X-1D (KJ685494.1), Acinetobacterlwoffiistrain214 (AB976100.1).What occur when pH3.5 has the flora such as Actinomycessp.V172011441 (KF926012.1) and not educable UnculturedTepidimonassp.cloneNJFUSLX-S357 (KC775702.1).This achievement in research provides foundation for widening phosphate solubilizing microorganism population scope in acid ground from now on.
Rape seedling is inhaled the impact of phosphorus and soil phosphorus by the different phosphate solubilizing bacterial manure of comparative example 3
Adopting pot experiment, soil collecting is in school of Agricultural University Of Hunan, and soil pH value is 4.6, full phosphorus 0.78g.kg-1, rapid available phosphorus 5.11mg.kg-1, organic 22.9%.Test and begin to carry out in agricultural college of Agricultural University Of Hunan greenhouse from October, 2013.Test adopts 15cm × 20cm plastic tub to carry out, every basin dress soil 5kg, often processes and is applied fertilizer to the subsoil as N0.15g.kg-1, K2O0.1g.kg-1, phosphate fertilizer sets 3 P levels, 10mg.kg altogether-1(P1)、50mg.kg-1And 100mg.kg (P2)-1(P3), often processing 4 repetitions, every basin stays Seedling 5 strain.Routine Management during growth of rape, May 2, results plant, gathered pedotheque.Measure soil quick-effective phosphor and plant phosphorus content.
The different bacterial manure used are as follows respectively:
A. phosphorus decomposing list bacterium: strains tested is the phosphate solubilizing bacteria PW-246 being stored in Microbiological Lab of Agricultural University Of Hunan for examination strain.Mix with common compost by 1:10 before using.
B. phosphorus decomposing mixing bacterial manure: the mixing phosphate solubilizing bacteria that resource environment institute of Agricultural University Of Hunan develops is (by La Enshi bacterium, pseudomonas mixed fermentation in high density fermentation tank, the mixing phosphobacteria bacterium solution fermented mixes in the ratio of 1:10 with common compost, make phosphobacteria bio-matrix, these flora living bacteria count >=0.5 × 107cfu.g-1, the content of organic matter >=50%).
C. the phosphate solubilizing bacteria induction fertilizer described in embodiment 1.Apply in topsoil soils by induction fertile mix with the mass ratio of topsoil soils 10～15% when applying land for growing field crops.
Experimental result is in Table 3.
The impact on rape seedling P uptake by plants and soil phosphorus of table 3 different disposal
As seen from the above, compared with the control, using phosphorus decomposing list bacterium, phosphorus decomposing mixed vaccine, phosphate solubilizing bacteria induction fertilizer all can be effectively improved soil quick-effective phosphor and rapeseed plants P uptake by plants, and wherein phosphate solubilizing bacteria induction fertilizer efficiency fruit becomes apparent from.
The different phosphate solubilizing bacterial manure impact on Maize at Seedling Stage P uptake by plants and availability of soil phosphorus of comparative example 4
Adopt field plot trial.In May, 2013 starts seeding corn, is experimental field positioned at school of Agricultural University Of Hunan, soil pH value 5.2, rapid available phosphorus 7.62mg.kg-1, full phosphorus 0.82g.kg-1, organic 22.9%.Arrange A (phosphorus decomposing list bacterial manure) altogether, B (mixing phosphate solubilizing bacteria), C (the phosphate solubilizing bacteria induction fertilizer described in embodiment 1) 3 process, and compare as not using any bacterial manure,.Each plot area is 2.5*8=20m2.Each process 3 repetition, altogether 240m2.P fertilizer consumption 50mg.kg-1, other manage same conventional method.Gathering in the crops after corn growth 45d, measure Semen Maydis plant height, fresh weight, complete at 105 DEG C 30min, dries to constant weight and claims dry weight for 75 DEG C.After Plant samples is pulverized, molybdenum antimony resistance colorimetric method measures phosphorus content, and result is in Table 4, table 5.
The impact on Maize at Seedling Stage overground part and underground part root phosphorus content of table 4 different disposal
| Underground part root phosphorus content | Overground part plant phosphorus content | |
| CK | 1.92±0.32a | 10.42±2.61a |
| A | 2.24±0.23b | 12.85±3.22b |
| B | 2.45±0.45b | 13.55±3.34c |
| C | 2.82±0.56c | 14.81±4.45d |
The impact on seedling growth of corn of table 5 different disposal
| Plant height cm | Root dry weight g | Plant weights g | |
| CK | 54.43±7.16a | 2.11±0.61a | 6.14±1.16a |
| A | 72.15±11.22b | 2.71±0.45b | 6.77±1.53b |
| B | 74.21±12.12b | 2.72±0.67b | 7.02±2.12b |
| C | 77.52±8.36c | 2.89±0.88c | 7.93±2.77c |
By testing above it can be seen that compared with the control, singly execute phosphate solubilizing bacteria, mixed vaccine, the phosphate solubilizing bacteria fertile bacterium of induction etc. and all promoted corn growth.Comparing, the fertile C of phosphate solubilizing bacteria induction more can be effectively increased underground part phosphorus content and the overground part phosphorus content of milpa, hence it is evident that has promoted plant height and plant weights.Although, above the present invention is described in detail with a general description of the specific embodiments, but on basis of the present invention, it is possible to it is made some modifications or improvements, and this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to the scope of protection of present invention.
Claims (9)
1. the phosphate solubilizing bacteria induction fertilizer improving acid ground P bioavailability, it is characterized in that, described phosphate solubilizing bacteria induction fertilizer by adding phosphate fertilizer in inducer substance, and after the artificial acid rain stress of pH3.5～4.5 processes, cultivate the induction containing a large amount of not educable phosphate solubilizing microorganisms obtained then through expanding propagation fertile.
2. phosphate solubilizing bacteria according to claim 1 induction fertilizer, it is characterized in that, described inducer substance is formed by fermentation of fully becoming thoroughly decomposed after the mixing of deadwood leaf, cattle manure, coal ash soil and straw, and C/N is 24～30, moisture content is 50～60%, and the content of organic matter is 50～60%.
3. phosphate solubilizing bacteria according to claim 2 induction fertilizer, it is characterised in that described phosphate fertilizer is 1-5g 〃 kg relative to the addition of inducer substance-1。
4. phosphate solubilizing bacteria according to claim 3 induction fertilizer, it is characterised in that described phosphate fertilizer is organic phosphatic fertiliser and inorganic phosphorus fertilizer；Described organic phosphatic fertiliser is ground phosphate rock, and described inorganic phosphorus fertilizer is calcium superphosphate.
5. the phosphate solubilizing bacteria induction fertilizer according to any one of Claims 1 to 4, it is characterised in that described artificial acid rain adds water and is made into after being made into artificial acid rain mother solution by sulphuric acid and nitric acid 3:1 in molar ratio.
6. phosphate solubilizing bacteria according to claim 5 induction fertilizer, it is characterised in that described artificial treatment with simulated acid rain is every 1kg compost configuration artificial acid rain of leaching 80～100ml, and every 48 hours leachings once, continue 30 days.
7. phosphate solubilizing bacteria according to claim 6 induction fertilizer, it is characterised in that after artificial treatment with simulated acid rain, expanding propagation is cultivated 7～10 days under the aerobic condition of 25～37 DEG C.
8. the fertile application in improving acid ground P bioavailability of phosphate solubilizing bacteria induction described in any one of claim 1～7.
9. application according to claim 8, it is characterised in that described phosphate solubilizing bacteria induction fertilizer is applied in topsoil soils by relative to the mass ratio of topsoil soils 10～15%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511030524.6A CN105732153B (en) | 2015-12-31 | 2015-12-31 | A kind of phosphate solubilizing bacteria induction fertilizer for improving acid ground P bioavailability and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511030524.6A CN105732153B (en) | 2015-12-31 | 2015-12-31 | A kind of phosphate solubilizing bacteria induction fertilizer for improving acid ground P bioavailability and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105732153A true CN105732153A (en) | 2016-07-06 |
| CN105732153B CN105732153B (en) | 2017-04-05 |
Family
ID=56296427
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201511030524.6A Active CN105732153B (en) | 2015-12-31 | 2015-12-31 | A kind of phosphate solubilizing bacteria induction fertilizer for improving acid ground P bioavailability and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105732153B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112280563A (en) * | 2020-10-28 | 2021-01-29 | 福建龙净环保股份有限公司 | Phosphate solubilizing bacteria mineralization conditioner, preparation method thereof and heavy metal contaminated soil remediation and improvement method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030167811A1 (en) * | 2001-12-31 | 2003-09-11 | Microbes, Inc. | Fertilizer compositions and methods of making and using same |
| CN101693641A (en) * | 2009-10-22 | 2010-04-14 | 南京信息工程大学 | Compound bio-fertilizer containing ardealite and application thereof |
| CN104177133A (en) * | 2014-09-18 | 2014-12-03 | 中山市巴斯德农业科技有限公司 | Technique for manufacturing active phosphorus organic fertilizer from pig manure |
| CN104692967A (en) * | 2015-02-14 | 2015-06-10 | 湖南湘牧生物科技有限公司 | Soil improved organic fertilizer using cow dung as main material and preparation method thereof |
-
2015
- 2015-12-31 CN CN201511030524.6A patent/CN105732153B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030167811A1 (en) * | 2001-12-31 | 2003-09-11 | Microbes, Inc. | Fertilizer compositions and methods of making and using same |
| CN101693641A (en) * | 2009-10-22 | 2010-04-14 | 南京信息工程大学 | Compound bio-fertilizer containing ardealite and application thereof |
| CN104177133A (en) * | 2014-09-18 | 2014-12-03 | 中山市巴斯德农业科技有限公司 | Technique for manufacturing active phosphorus organic fertilizer from pig manure |
| CN104692967A (en) * | 2015-02-14 | 2015-06-10 | 湖南湘牧生物科技有限公司 | Soil improved organic fertilizer using cow dung as main material and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 徐华勤等: "模拟酸雨胁迫对赤红壤磷素形态特征的影响", 《农业环境科学学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112280563A (en) * | 2020-10-28 | 2021-01-29 | 福建龙净环保股份有限公司 | Phosphate solubilizing bacteria mineralization conditioner, preparation method thereof and heavy metal contaminated soil remediation and improvement method |
| CN112280563B (en) * | 2020-10-28 | 2022-04-26 | 福建龙净环保股份有限公司 | Phosphate solubilizing bacteria mineralization conditioner, preparation method thereof and heavy metal contaminated soil remediation and improvement method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105732153B (en) | 2017-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xu et al. | Arbuscular mycorrhizal fungi influence decomposition and the associated soil microbial community under different soil phosphorus availability | |
| Luo et al. | Long-term biochar application influences soil microbial community and its potential roles in semiarid farmland | |
| Thies et al. | Biochar effects on the abundance, activity and diversity of the soil biota | |
| Subhashini | Growth promotion and increased potassium uptake of tobacco by potassium-mobilizing bacterium Frateuria aurantia grown at different potassium levels in vertisols | |
| EP1248754B1 (en) | Biological addition to organic-mineral fertilizers | |
| CN107216227A (en) | A kind of apple special bio charcoal base microbe bacterial manure and preparation method thereof | |
| Li et al. | Artificial soil aeration increases soil bacterial diversity and tomato root performance under greenhouse conditions | |
| CN111909708B (en) | Mining area soil remediation agent and preparation method and application thereof | |
| Xie et al. | Successive biochar amendment affected crop yield by regulating soil nitrogen functional microbes in wheat-maize rotation farmland | |
| CN113215028B (en) | Microbial flora and microbial agent and application thereof | |
| Liu et al. | Spatiotemporal differences in the arbuscular mycorrhizal fungi communities in soil and roots in response to long-term organic compost inputs in an intensive agricultural cropping system on the North China Plain | |
| Rao et al. | Microbiology and biochemistry of soil organic matter, carbon sequestration and soil health | |
| Ding et al. | Effect of potassium solubilizing bacteria and humic acid on faba bean (Vicia faba L.) plants grown on sandy loam soils | |
| Ding et al. | Contribution and fate of maize residue-15N and urea-15N as affected by N fertilization regime | |
| CN105669331A (en) | Mining area land repair agent and repair method | |
| Wang et al. | Response of peanut plant and soil N-fixing bacterial communities to conventional and biodegradable microplastics | |
| Li et al. | Inoculating maize fields with earthworms (Aporrectodea trapezoides) and an arbuscular mycorrhizal fungus (Rhizophagus intraradices) improves mycorrhizal community structure and increases plant nutrient uptake | |
| Rezig et al. | Decomposition and nutrient release pattern of wheat (Triticum aestivum) residues under different treatments in desert field conditions of Sudan | |
| Liu et al. | Effects of saline-alkali stress on bacterial and fungal community diversity in Leymus chinensis rhizosphere soil | |
| Yuan et al. | The addition of biochar and nitrogen alters the microbial community and their cooccurrence network by affecting soil properties | |
| Mukherjee et al. | Effect of integrated nutrient management in sunflower (Helianthus annuus L.) on alluvial soil | |
| Zhou et al. | Influence of different microbial inoculants on nitrogen retention and diazotroph community succession during cotton straw composting | |
| Zhang et al. | Trichoderma biofertilizer facilitating Leymus chinensis production in different growth stages is strongly linked to dynamically altered soil microbiomes | |
| Shrestha et al. | Comparison of microbially enhanced compost extracts produced from composted cattle rumen content material and from commercially available inocula | |
| Niazi et al. | Phosphate solubilizing bacteria in combination with pressmud improve growth and yield of mash bean. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |