CN105671066B - It is a kind of to adjust the expression vector of human colon tumor's cell, preparation method and applications - Google Patents
It is a kind of to adjust the expression vector of human colon tumor's cell, preparation method and applications Download PDFInfo
- Publication number
- CN105671066B CN105671066B CN201610120895.1A CN201610120895A CN105671066B CN 105671066 B CN105671066 B CN 105671066B CN 201610120895 A CN201610120895 A CN 201610120895A CN 105671066 B CN105671066 B CN 105671066B
- Authority
- CN
- China
- Prior art keywords
- cell
- c10orf10
- expression vector
- human colon
- colon tumor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
Abstract
The present invention adjusts the expression vector of human colon tumor's cell, preparation method and applications.A kind of expression vector adjusting human colon tumor's cell, it is formed by C10orf10 gene and Pcdna3.1-HisA vector construction.Preparation method obtains cDNA (2) for (1) and above-mentioned cDNA is connected to TOPO PCR Blunt carrier, and transformed competence colibacillus Escherichia coli are cultivated, picking positive colony culture in the LB plate of culture containing penicillin, selects correct clone through sequencing；(3) building of C10orf10 expression vector.The present invention constructs people's C10orf10 gene overexpression carrier and discloses its purposes.C10orf10 gene overexpression carrier provided by the invention is capable of the specific expression for promoting people C10orf10 gene after being transfected into human colon cancer cell, leads to tumor cell senescence and inhibits the proliferation of tumour cell.
Description
Technical field
The invention belongs to technical field of pharmaceutical biotechnology, in particular it relates to a kind of human cancer suppressor gene C10orf10
(Chromosome 10Open Reading Frame 10)/DEPP(Decidual Protein Induced By
Progesterone) the application in treatment of colon cancer drug.
Background technique
Colon cancer is the common malignant tumor of digestive tract for betiding colon site, is apt to occur in rectum and sigmoid colon has a common boundary
Place.Disease incidence accounts for the 3rd of gastroenteric tumor.The concealment of colon cancer onset, early stage often without apparent clinical manifestation, progression of the disease compared with
Slowly, occur having arrived middle and advanced stage when apparent symptom mostly, the death rate is only second to lung cancer and liver cancer, accounts for China's malignant tumour third
Position.Therefore, treatment of colon cancer becomes the important directions of tumor research.Generation, the development of colon cancer are influenced by many factors,
In, it has been found that part oncogene (such as Bcl-2, c-myc, set, survivin) and tumor suppressor gene (such as APC, DCC, nm23,
P53, PP2A, PTEN etc.) with the generation of colorectal cancer, development have substantial connection, but so far there are many more and Human colorectal carcinoma
The relevant oncogene that falls ill not yet finds.To the discoveries of these genes and research facilitate the gene therapy for colon cancer, more after
And the research and development of anticancer drug provide new direction.
C10orf10 is initially determined to the gene of fasting and progesterone induced expression, and the albumen of expression is DEPP albumen.
DEPP albumen secretes progestational hormone and the insulin level in adjusting adipose tissue and liver by adjusting endometrial stromal cell,
Induce the reaction of malignant glioma cells hypoxia stress.But currently, DEPP expression increase inhibit tumour growth not yet by
It proves, the mechanism of action in colon cancer is not fully understood, and the clinical meaning of function and expression variation not yet has been reported that.
Therefore, the relationship of DEPP and colon cancer occurrence and development are analyzed, explores the diagnosis of colon cancer for being directed to DEPP approach and therapeutic strategy extremely
It closes important.
Summary of the invention
The object of the present invention is to provide a kind of new tumor suppressor gene C10orf10 expression vectors, and prove the expression vector
It can be applied in the drug of preparation treatment colorectal cancer.
People C10orf10 gene is registered in GenBank, and number of registration NM_007021.3 is positioned at 10q11.21, overall length
2060bp, encodes 212 amino acid, and nucleotides sequence is classified as in sequence table described in SEQ ID NO:1.
A kind of expression vector adjusting human colon tumor's cell, it is carried by C10orf10 gene and Pcdna3.1-HisA
Body is built-up.
The expression vector of adjusting human colon tumor's cell is applied in vitro cancer cell, and the expression vector inhibits
The proliferation of human colon tumor's cell.
The expression vector of adjusting human colon tumor's cell is applied in vitro cancer cell, and the expression vector accelerates
The aging of human colon tumor's cell.
The present invention constructs a kind of expression vector for treating colon cancer, is by C10orf10 gene and Pcdna3.1-HisA
Plasmid construction forms, the preparation method is as follows:
(1) it obtains cDNA: the CDS (protein coding region, SEQ ID NO.2) of overall length C10orf10 gene and uses RT-PCR
Method is obtained from the total serum IgE of colon cancer HCT116, is then expanded, and amplification the primer is
C10orf10-cF:(SEQ ID NO.3) atgaggtccc ggcttctgct c
C10orf10-cR:(SEQ ID NO.4) cggtgatcca tgaactctga
(2) above-mentioned cDNA is connected to TOPO PCRBlunt carrier, transformed competence colibacillus Escherichia coli are trained containing penicillin
It supports and is cultivated in LB plate, picking positive colony culture selects correct clone through sequencing；
(3) building of C10orf10 expression vector
The plasmid correctly cloned is extracted, after I digestion of EcoR, recycles purpose piece after the separation of 1% agarose gel electrophoresis
Section, is connected into the pcDNA3.1 carrier of linearisation, transformed competence colibacillus Escherichia coli are cultivated, picking in the LB plate of culture containing penicillin
Positive colony culture saves correct clone after digestion and the double identifications of sequencing, extract plasmid to get.
The utility model has the advantages that the expression vector contains His label protein, facilitate identification transfection；Connect in expression vector structure
The gene entered is to obtain from the total serum IgE of colon cancer HCT116, and the albumen expressed after transfection and archaeocyte albumen homology were easier to
It expresses successfully；The CDS that C10orf10 gene is directly amplified by RT-PCR method, the exon phase with amplification C10orf10 gene
Shorter than amplification length, amplification difficulty is small, and plasmid length is short after being built into plasmid, and transfection is also easier to；The expression vector transfection
Administering effect has the advantages that effect is good, long half time compared to classic chemotherapy.
The present invention has detected the cell Proliferation and aging situation after colon cancer HCT116 cell transfecting over-express vector.
Experiment shows for the expression vector to be transfected into human colon cancer cell, and expression vector can lead to colon cancer cell
Aging and the proliferation for inhibiting colon cancer cell, therefore, expression vector of the present invention is in the drug of preparation treatment colon cancer
Using.
Detailed description of the invention
Fig. 1 is Pcdna3.1-HisA Plasmid diagram
Fig. 2 is the DEPP albumen WB figure of the experimental group of human colon cancer cell strain HCT116, negative control group, blank control group
Spectrum
Fig. 3 is the thin of the experimental group, negative control group, blank control group of human colon cancer cell strain HCT116 in CCK8 experiment
Born of the same parents' vigor histogram
Fig. 4 is the cell ageing β-half of the experimental group of human colon cancer cell strain HCT116, negative control group, blank control group
Lactoside enzyme dyeing figure
Fig. 5 is the cell ageing β-of the experimental group of human colon cancer cell strain HCT116, negative control group, blank control group
Galactosidase stained positive rate histogram
Specific embodiment
Below with reference to embodiment, the invention will be further described.Test method without specific conditions in embodiment,
It is such as condition described in the written Molecular Cloning: A Laboratory room handbook such as Sambrook according to normal conditions, or according to manufacture
The condition of manufacturers instruction suggestion.
The clone of embodiment 1:C10orf10cDNA and the building of expression vector
1. cloning dedicated cDNA synthesis
Reverse transcription reaction (RT) is the HiFiScript 1st Strand cDNA Synthesis of ShiJi Co., Ltd using health
Kit kit, each reaction use 2 μ g total serum IgEs.Reaction total volume be 20 μ L:5 × RT buffer, 4 μ L, 5 μ L of total serum IgE,
2 μ L, 2.5mM dNTP of Primer Mix, 4 μ L, 0.1M DTT 2 μ L, HiFiScript 1 μ L, 2 μ L of high purity deionized water.Make
Reverse transcription reaction is carried out with Bio-Rad PCR instrument, carrying out practically parameter is as follows: 42 DEG C of 10min；85℃5min；It is cooled to 4 DEG C.-
20 DEG C save backup.
2.C10orf10cDNA clone
With TOPO technology, it is connected to TOPO PCRBlunt carrier.Specific step is as follows: taking fresh 2 μ L of PCR product, adds
Enter 1 μ L of carrier, 1 μ L of NaCl solution, 2 μ L of high purity deionized water in kit.At room temperature be incubated for 10min after transformed cells: will
TOPO reaction product is added in ice bath melted competent bacteria, and ice bath is incubated for 30min, 42 DEG C of hot activation 90s, and kit is added
Middle SOB culture solution 1mL, 37 DEG C of vulgar culture 1h, then inoculum is seeded in the LB plate of culture containing penicillin and continues routine
Overnight incubation.Second day, picked clones culture selected correct clone through sequencing.
3.C10orf10 cloning primer
C10orf10-cF:(SEQ ID NO.3) atgaggtccc ggcttctgct c
C10orf10-cR:(SEQ ID NO.4) cggtgatcca tgaactctga
4.C10orf10 the building of expression vector
The plasmid correctly cloned is extracted, after I digestion of EcoR, recycles purpose piece after the separation of 1% agarose gel electrophoresis
Section, is connected into the Pcdna3.1-HisA of linearisation (Plasmid diagram is as shown in Figure 1).Connection reaction is as follows: 1 μ L of carrier, recycling
It is inserted into 5 μ L, 2 μ L, T4DNA ligase of ligase buffer solution, 1 μ L.16 DEG C of connections are overnight.Connection product is referring in step 2 overnight
Bacterium Transformation Program carries out conversion and microbionation.Picked clones culture saves correct gram after digestion and the double identifications of sequencing
It is grand, plasmid is extracted, is transfected for gene.
5. interpretation of result
Through digestion identification and sequencing analysis, the mammalian expression vector of C10orf10 gene is constructed successfully.
Embodiment 2: the overexpression efficiency experiment of expression vector
1, cell culture
The RMPI-1640 culture medium for being 10% with the volume ratio of fetal calf serum (buying from Gibico company) is in 37 DEG C, 5%
CO2Cell incubator in cultivate human colon carcinoma HCT116 cell strain (buying from ATCC company, the U.S.) to confluent cultures bottle.
2, it is overexpressed plasmid transfection HCT116 cell
Take initial concentration 7.5 × 104The tumor cell inoculation of a/mL sets incubator culture in tissue culture plate.It is every kind thin
Three groups are respectively set in born of the same parents' strain: experimental group (transfects matter with liposome Lipofectamine 2000 (invitrogen company)
Grain), negative control group (with liposome Lipofectamine 2000 transfect empty plasmid), blank control group (stuffing when transfection
Plastid Lipofectamine2000).When cell it is long to 40-60% when transfected.Room temperature after plasmid and transfection reagent are mixed
It is incubated for 10min, nucleic acid-nano-complex is added in cell and is softly mixed, incubator is set and continues to cultivate.It is right afterwards for 24 hours to transfect
Cell progress is normally changed liquid or is administered.
3, total protein extraction
It takes transfection to be overexpressed the colon cancer HCT116 cell after plasmid 48h, discards culture medium supernatant, washed with PBS buffer solution
It washs cell 2 times；Protein Extraction Reagent is placed on ice bath, the lysate of appropriate amount is taken, preceding interior addition PMSF is being used, is making PMSF
Final concentration of 1mM；The total protein of cell that proper volume is added extracts reagent 3-5 minutes.Period shakes culture plate repeatedly, makes to try
Agent comes into full contact with cell.Cell and reagent are scraped with cell scraper, are collected into 1.5mL centrifuge tube.Ice bath 30min, phase
Between blown and beaten repeatedly with pipettor, it is ensured that cell cracks completely.12000g is centrifuged 5min, collects supernatant, as total protein solution.
4, WB detects DEPP expression
4.1. protein concentration is measured
It is dense by BCA determination of protein concentration kit (enhanced) the specification measurement albumen of green skies biotech company
Degree.
4.2SDS-PAGE electrophoresis
Prepare separation gel in proportion, after mixing by gel solution injection layer glass extremely in, then on liquid level inject one layer
Water stands 40min.Ditto concentration glue is prepared in proportion.Suck the moisture in discontinuous system on lower layer's separation gel, continuous and stable
Injection gel solution, then carefully insertion comb and must not pay attention to that there are bubbles in tooth tip, quiet 60min or more processed is to have guaranteed
Full polymerization.Loading volume is calculated, then in sample: the ratio of loading buffer=4:1 is added loading buffer and mixes, boiling water boiling
10min.Sequentially add standard items (Marker) and sample to be analysed.Sample-adding finishes, and 80V constant pressure is selected to carry out electrophoresis, and electrophoresis is straight
Reach two glue intersections to Bromophenol Blue dye forward position, replacement to 120V constant pressure electrophoresis, electrophoresis until Bromophenol Blue dye forward position down toward
Gel end, i.e. stopping electrophoresis.
4.3 transferring film
The glue that electrophoresis finishes completely is placed on and fills electric turn in the glass dish of liquid.By the size of glue cut film and filter paper (, filter
Paper immersion fills electricity and turns 10s in the glass dish of liquid, and film is put into 10s in the glass dish for filling 10% methanol, then will both put
Enter and fill 3min in the glass dish of deionized water, be further put into fill electricity turn 3min in the glass dish of liquid.It is fallen into electric turn trough
Enter part electricity and turn liquid, sponge is immersed.Make " sandwich " in the following order.It is arranged in the following order from anode to cathode: just
Pole-sponge-double-layer filter paper-pvdf membrane-gel-double-layer filter paper-sponge-is negative to notice that positive and negative anodes are correct.Sandwich sponge, filter paper and
To good positive and negative anodes (wherein cannot there are bubbles) after film, clamping transferring film plate fills electricity in electric turn trough and turns liquid, transferring film plate is immersed electricity
It in turn trough, plugs in, 250mA constant current transfers 1.5h.
4.4 closing
Film is put into 5%BSA confining liquid, shaking table vibration, 70 turns/min, room temperature closes 2h.
4.5 primary antibodies are incubated for
By corresponding antibodies potency be added primary antibody dilution [DEPP antibody be 1:500, β-Actin antibody be 1:1000, one
Anti- dilution is 1%TBST.] film after closing is put into hybridization bag, primary antibody about 1mL, room temperature shaker (70 revs/min) is added
It is incubated for 1h.Film 10min × 3 time are washed with TBST.
4.6 secondary antibodies are incubated for
It is diluted by 1:10000 and secondary antibody diluent is added.Film after primary antibody is incubated for is put into secondary antibody, room temperature shaker (70 turns/
Minute) it is incubated for 2h.Film 10min × 3 time are washed with TBST.
4.7ECL colour developing
In A liquid in the container being protected from light: B liquid=1:1 ratio prepares ECL working solution.Press film: working solution=10cm2:
ECL working solution is covered film surface by the ratio of 1mL, is observed, is taken pictures in gel imaging system after placing 1~2 minute.As a result
As shown in Figure 2.
The detection of embodiment 3:CCK8 method is overexpressed the influence of plasmid pair human colon cancer cell strain HCT116 proliferation
The proliferative conditions of colon cancer cell HCT116 are detected using CCK8 experiment.The HCT116 for collecting the growth index phase is thin
Born of the same parents' strain, and cultivated in 96 orifice plates, every group sets 6 holes, and adjustment cell concentration is 4 × 105A/hole is covered to tissue culture plate
Rate about 40%~60%, is then transfected, and step is the same as the step 1 in embodiment 2.It is sucked in hole after transfecting 48h
Culture medium is added the diluted CCK solution of 115 μ L (+100 μ L serum free medium of 15 μ L CCK solution), with enzyme mark after incubation 1h
Instrument detects the light absorption value (OD) at each hole 595nm wavelength, and the proliferative conditions of cell are indicated with the mean value of each group light absorption value.Detection knot
Fruit sees Fig. 3.
CCK8 experiment display: after interference 24 hours, compared with blank control group and negative control group, experimental group
There is apparent Proliferation Ability in HCT116 cell strain, and inhibiting rate is 41.9% (P < 0.0001), illustrates to be overexpressed C10orf10 base
Because can obviously inhibit the proliferation of colon cancer cell HCT116.
Embodiment 4: it is overexpressed the influence of plasmid pair human colon cancer cell strain HCT116 aging
It is thin to detect colon cancer using the cell ageing beta galactosidase staining kit of green skies biotech company
The aging situation of born of the same parents HCT116.The HCT116 cell strain of growth index phase is collected, and is cultivated in tissue culture plate, cell is adjusted
Concentration is 4 × 105Then a/hole is transfected to tissue culture plate coverage rate about 40%~60%, step is the same as embodiment 2
In step 1.Culture medium in hole is sucked after transfecting 48h, washs cell with PBS, it is solid that beta galactosidase dyeing is added
Determine liquid, the fixed 15min of room temperature.It sucks fixer and washs 3min × 3 time with PBS.Dyeing working fluid is added to be incubated overnight.Take out dye
Simple microscope observation takes pictures, counts after color working solution.Coloration result is shown in Fig. 4 and Fig. 5.
Claims (3)
1. it is a kind of adjust human colon tumor's cell expression vector application, characterized in that the expression vector be by
C10orf10 gene and Pcdna3.1-HisA vector construction form, the increasing for being adjusted to inhibit in vitro human colon tumor's cell
It grows；The preparation method of the expression vector includes the following steps:
(1) obtain cDNA: the open reading frame of overall length C10orf10 gene is obtained from the total serum IgE of normal tissue using RT-PCR method
, it is then expanded, amplification the primer is
C10orf10-cF:(SEQ ID NO.3) atgaggtcccggcttctgctc
C10orf10-cR:(SEQ ID NO.4) cggtgatccatgaactctga
(2) above-mentioned cDNA is connected to TOPO PCR Blunt carrier, transformed competence colibacillus Escherichia coli are trained in LB containing penicillin
It supports and is cultivated in plate, picking positive colony culture selects correct clone through sequencing；
(3) building of C10orf10 expression vector
The plasmid correctly cloned, digestion are extracted, electrophoretic separation recycles target fragment, is connected into the pcDNA3.1 carrier of linearisation, turns
Change competent E.coli, cultivated in the culture plate of LB containing penicillin, picking positive colony culture, through digestion and the double mirror of sequencing
After fixed, save correct clone, extract plasmid to get.
2. it is a kind of adjust human colon tumor's cell expression vector application, characterized in that the expression vector be by
C10orf10 gene and Pcdna3.1-HisA vector construction form, described to be adjusted to accelerate declining in vitro human colon tumor's cell
Always.
3. the application of the expression vector according to claim 1 or 2 for adjusting human colon tumor's cell, the application is system
The purposes of standby treatment human colon tumor's drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610120895.1A CN105671066B (en) | 2016-03-03 | 2016-03-03 | It is a kind of to adjust the expression vector of human colon tumor's cell, preparation method and applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610120895.1A CN105671066B (en) | 2016-03-03 | 2016-03-03 | It is a kind of to adjust the expression vector of human colon tumor's cell, preparation method and applications |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105671066A CN105671066A (en) | 2016-06-15 |
| CN105671066B true CN105671066B (en) | 2019-06-14 |
Family
ID=56306579
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610120895.1A Expired - Fee Related CN105671066B (en) | 2016-03-03 | 2016-03-03 | It is a kind of to adjust the expression vector of human colon tumor's cell, preparation method and applications |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105671066B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005520521A (en) * | 2002-03-20 | 2005-07-14 | ノバルティス アクチエンゲゼルシャフト | Diagnosis and treatment method for schizophrenia |
-
2016
- 2016-03-03 CN CN201610120895.1A patent/CN105671066B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| C10ORF10/DEPP, a transcriptional target of FOXO3, regulates ROS-sensitivity in human neuroblastoma;Stefan Salcher et al.;《Molecular Cancer》;20140930;第13卷;第1-17页 |
| The c10orf10 gene product is a new link between oxidative stress and autophagy;Marcus W. Stepp et al.;《Biochimica et Biophysica Acta》;20140214;第1843卷;第2.10节、图6-7 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105671066A (en) | 2016-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108715850B (en) | GING2 gene knockout in epidermal stem cells by using CRISPR-Cas system | |
| Chen et al. | Maintenance of amelogenin gene expression by transformed epithelial cells of mouse enamel organ | |
| CN105671082A (en) | Lentivirus vectors expressing exosome markers and building method and application of lentivirus vectors | |
| CN108707655A (en) | The application of serodiagnosis marker occurs as Japanese schistosomiasis liver fibrosis for β-actin albumen | |
| CN111607571A (en) | Replicative oncolytic adenovirus for specifically activating immune co-stimulation pathway and preparation method and application thereof | |
| CN105671066B (en) | It is a kind of to adjust the expression vector of human colon tumor's cell, preparation method and applications | |
| Zhang et al. | Tumor-derived exosomal lincRNA ROR promotes angiogenesis in nasopharyngeal carcinoma | |
| CN103923942A (en) | Transposable element carrier expressing pig telomerase reverse transcriptase, building method thereof and application in building pig immortalization cell line | |
| CN105543183B (en) | Application of the human liver cancer cell Egfl8 gene overexpression slow virus in preparation treatment liver-cancer medicine | |
| CN113136402B (en) | Method for over-expressing PCNP gene and application of PCNP gene in treatment of human liver cancer | |
| CN109706122A (en) | It constructs FSCN1 gene and stablizes knockout cell system, method and plasmid or plasmid combinations and application | |
| CN109337903A (en) | Long-chain non-coding RNA lncRNA-6585, antibody and application thereof | |
| CN111333710B (en) | C20orf24 protein deletion mutant and application thereof | |
| CN114134145A (en) | Role of HOXC10 in gastric cancer pathogenesis | |
| CN106177906B (en) | The application of Ddb1 albumen | |
| Bao et al. | DKK1 eukaryotic expression plasmid and expression product identification | |
| CN111053906B (en) | Reagent for regulating and controlling GSK-3 beta expression and application thereof | |
| CN107881174B (en) | Method for regulating and controlling translation level gene expression and application | |
| CN109182341A (en) | A kind of anti-tumor protein and its application | |
| CN111518808B (en) | Three ribonucleic acid sequences with anti-tumor effect and application thereof | |
| CN108251437A (en) | A kind of method for improving cyp3A5 expression enzyme metabolic activities | |
| WO2019037131A1 (en) | Construction of cd27 eukaryotic expression vector and preparation of cell strain highly expressing cd27 | |
| CN108410985B (en) | SPIN1 promotes growth of non-small cell lung carcinoma tumors | |
| NL2032314A (en) | The application of phosphorylation of c20orf112 protein at ser295 in detecting cancer cell proliferation | |
| CN116286997A (en) | Cell strain for over-expressing TZAP gene, construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190614 |