CN105624301A - PCR (polymerase chain reaction) primer and kit for detecting pathogenic canine leptospirosis - Google Patents
PCR (polymerase chain reaction) primer and kit for detecting pathogenic canine leptospirosis Download PDFInfo
- Publication number
- CN105624301A CN105624301A CN201610077204.4A CN201610077204A CN105624301A CN 105624301 A CN105624301 A CN 105624301A CN 201610077204 A CN201610077204 A CN 201610077204A CN 105624301 A CN105624301 A CN 105624301A
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- test kit
- kit
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to detection primers and detection kits and particularly discloses a PCR (polymerase chain reaction) primer and a kit for detecting pathogenic canine leptospirosis. The PCR primer includes a forward primer: 5'-CTTGGGATTCTTCTAATMCSGATA-3' and a reverse primer: 5'-GATCCTTGTATTCCACCGATG-3'. The amplified fragment length of the PCR primer is 124bp. The PCR primer and the kit for detecting the pathogenic canine leptospirosis have the advantages that LigB genes are selected as a detection object so as to achieve the purpose of detecting the pathogenic canine leptospirosis; the PCR primer and the kit, which are used for detecting the LigB genes of the canine leptospirosis, are time saving, labor saving and excellent in specificity and sensitivity; the PCR primer and the kit can be used for early diagnosis of the canine leptospirosis during experiments, an established and assembled canine leptospirosis PCR method is high in specificity, and leptospira concentration detection sensitivity can reach 101 copies/microliters.
Description
Technical field
The present invention relates to detection primer and test kit, specifically, relate to the PCR primer and the test kit that detect pathogenic leptospira canicola.
Background technology
Leptospirosis (Leptospirosis) is a kind of zoonosis propagated in worldwide, is called for short Leptospirosis, and this disease is especially widely present in developing country and torrid areas. Dog, to this disease susceptible, diverse clinical manifestations after infection, not easily diagnoses. The pathogen of Leptospirosis can be continuously present in host body, the further diffusion pollution environment of meeting, infects other humans and animals, and harm is serious. Thus, dog suffers from this after being ill, while endangering the health of itself, also can threaten the safety of its owner. Accordingly, it would be desirable in early days this disease is made diagnosis, control this disease as early as possible. At present, the method of diagnosis dog Leptospirosis has the test in laboratory methods such as direct microscopy, separation and Culture, Serologic detection, animal inoculation, and compared with these methods, PCR method is more time saving and energy saving, specificity and sensitivity are excellent, and can be used for the early diagnosis of Leptospirosis.
Publication number is that the Chinese patent application of CN103205502A discloses and a kind of detects the primer of quantitative fluorescent PCR of Canis familiaris L. leptospira nucleic acid, probe and test kit, and described primer is for the leptospiral LigA gene order design of pathogenic Canis familiaris L.. But, in the serotype of numerous coupler bodies, wherein jaundice hemorrhage 56601 type does not have LigA gene, and jaundice hemorrhage 56601 type can cause leptospirosis. Therefore pathogenic Canis familiaris L. leptospira cannot be carried out complete detection by technique scheme.
The Chinese patent application that publication number is CN101935696A discloses a kind of detection leptospiral fluorescence quantifying PCR method of dog cat and primer thereof and detection kit, and it adopts 16srRNA gene order for design primer. But, pathogenic and non-pathogenic coupler body all contains 16srRNA gene, and technique scheme detects dog cat leptospira by detecting 16srRNA gene, it is impossible to accurately differentiate to detect pathogenic and non-pathogenic coupler body.
Summary of the invention
In order to solve problems of the prior art, it is a kind of time saving and energy saving to it is an object of the invention to provide, and specificity and sensitivity are excellent, detects PCR primer and the test kit of leptospira canicola LigB gene, can be used for the early diagnosis of canicola fever.
The principle of the invention is in that to have selected leptospira canicola LigB gene as detection object, and is specially designed primer for leptospira canicola LigB gene, makes primer have specificity and the sensitivity of excellence.
In order to realize the object of the invention, technical scheme is as follows:
The present invention provides a kind of PCR primer detecting pathogenic leptospira canicola, and described primer is as follows:
Forward primer: 5 '-CTTGGGATTCTTCTAATMCSGATA-3 ';
Downstream primer: 5 '-GATCCTTGTATTCCACCGATG-3 '.
The expanding fragment length of described primer is 124bp.
Present invention also offers described primer and detect the application in the test kit of pathogenic leptospira canicola in preparation.
Owing to the amplified fragments of described primer is able to demonstrate that the existence of leptospira canicola LigB gene, thus proving the existence of pathogenic leptospira canicola, therefore, described primer can be used to prepare the test kit detecting pathogenic leptospira canicola.
For these reasons, present invention also offers the reagent containing described primer or test kit.
Being specially a kind of test kit detecting pathogenic leptospira canicola, described test kit includes aforementioned primer, positive control, negative control, Taq enzyme, dNTP, 10 �� Buffer, ddH2O��
Further, the construction method of described positive control is:
1) rub that genomic DNA of 56608 as template using ripple, utilize the primer described in claim 1 to carry out pcr amplification, PCR primer is purified recovery, is attached with pMD18-T;
2) clone to Trans1-T1 competence adds step 1) the connection product that obtains, screening positive clone, extract plasmid.
Bo Mona 56608 is purchased from Nat'l Pharmaceutical & Biological Products Control Institute's leptospira laboratory, and deposit number is 56608.
In order to better realize the detection to pathogenic leptospira canicola, present invention optimizes the working procedure of described test kit (especially annealing temperature), enable described primer farthest to increase reaction success rate and reaction effect.
Optimizing the working procedure obtained is: 94 DEG C of denaturation 3min; 94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 29 circulations; 72 DEG C extend 5min.
The beneficial effects of the present invention is:
The present invention selects LigB gene as detection object, it is achieved the purpose of detection pathogenic leptospire. It is time saving and energy saving to the invention provides, and specificity and sensitivity are excellent, detects PCR primer and the test kit of leptospira canicola LigB gene. Primer provided by the invention and test kit, can be used for the early diagnosis of canicola fever in this experiment, the dog Leptospirosis PCR method high specificity set up and assemble, and the sensitivity detecting coupler body concentration can reach 101copies/��L��
Accompanying drawing explanation
Fig. 1 is the electrophoresis detection result figure groping annealing temperature in the embodiment of the present invention 2: wherein, M:2000bpMarker, swimming lane 1��5: annealing temperature is followed successively by 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C.
Fig. 2 is the electrophoresis detection result figure of the embodiment of the present invention 3 medium sensitivity test: wherein, M:2000bpMarker, and swimming lane 1��6 is respectively; 1 �� 10-6Ng/ �� L-1ng/ �� L, 10 times of gradients.
Fig. 3 is the electrophoresis detection result figure of replica test in the embodiment of the present invention 4: wherein, M:2000bpMarker, and swimming lane 1��3 is the template DNA of same batch of same concentration.
The electrophoresis detection result figure of specific test in Fig. 4 embodiment of the present invention 5: wherein, M:2000bpMarker, swimming lane 1��8 template concentrations is followed successively by jaundice hemorrhage 56601, dog 56603, Bo Mona 56608, non-pathogenic coupler body 566505, influenza typhoid fever 56609, nanukayami 56610, Maksim Tarasov 56635 and blank.
The sensitivity electrophoresis result figure of Fig. 5 embodiment of the present invention 8 Plays positive plasmid: swimming lane 1-9 respectively 100-108copies/��L��
In Fig. 6 embodiment of the present invention 8 PCR detection sensitivity electrophoresis result figure: swimming lane 1-7 of bacterium solution respectively 101-107Coupler body/ml.
Detailed description of the invention
Below in conjunction with embodiment, the preferred embodiment of the present invention is described in detail. It will be appreciated that providing merely to play descriptive purpose of following example, be not used to the scope of the present invention is limited. Those skilled in the art is when without departing substantially from the objective of the present invention and spirit, it is possible to the present invention carries out various amendment and replacement.
The experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, all commercially obtain.
1, bacterial strain and clinical sample
Leptospira reference culture jaundice hemorrhage 56601, dog 56603, ripple rub that 56608, influenza typhoid fever 56609, nanukayami 56610, Maksim Tarasov 56635, non-pathogenic coupler body 566505, by problem place laboratory passage cultivate preserve.
2, key instrument and reagent
Gel electrophoresis images analyzes system (Liuyi Instruments Plant, Beijing, China); Grads PCR instrument (BiometraUNO, Germany); CO2Constant incubator (SANYO, Japan), bacterial genomes DNA extraction kit and glue reclaim test kit purchased from Tian Gen company, plasmid Mini Kit purchased from OMEGA company; Taq enzyme, pMD-18t carrier, Trans1-T1 clone competence purchased from Dalian treasured biology company limited; Tryptone is purchased from Oxoid company of Britain, and ampicillin is purchased from NEB company, and the conventional reagent such as sodium chloride, agarose is purchased from domestic company.
Embodiment 1 design of primers and synthesis
According to the LigB gene order delivered in GenBank, application PrimerPremier5.0 software design obtains primer, obtains primer of the present invention through screening.
The primer that screening obtains carries out specificity identification by the BLAST in NCBI, as shown in table 1. Primer synthesizes by Dalian treasured biotech firm.
Table 1 universal primer sequence
The optimization of embodiment 2PCR response procedures
According to the antibacterial group DNA extraction kit description of product, extract DNA as template from well-grown coupler body bacterium solution.
With coupler body DNA for template, first the annealing temperature of PCR reaction is groped, reaction system and condition: 10 �� L, Taq enzyme 0.1 �� L, each 0.5 �� L, the dNTP0.8 �� L of upstream and downstream primer described in embodiment 1, masterplate 1 �� L, 10 �� Buffer1 �� L, ddH2O supplies.
Reaction condition: 94 DEG C of 3min; 94 DEG C of 30s, annealing temperature 30s, 72 DEG C 30s, 29 circulations; 72 DEG C of 5min. Carrying out on grads PCR instrument, annealing temperature arranges thermograde, is respectively as follows: 56.0 DEG C, 57.0 DEG C, 58.0 DEG C, 59.0 DEG C, 60.0 DEG C. Carry out PCR reaction, and PCR primer is carried out agarose gel electrophoresis observed result, as shown in Figure 1. As shown in Figure 1, when annealing temperature is 58.0 DEG C, band is the brightest, and Detection results is best.
Embodiment 3 sensitivity test
DNA profiling embodiment 2 extracted as standard substance through quantitatively, is diluted to 1ng/ �� L, then carries out 10 times of gradient dilutions, be diluted to 1ng/ �� L-1 �� 10 respectively-6Ng/ �� L. Utilize PCR system described in embodiment 2 and working procedure to carry out PCR reaction, and PCR primer is carried out agarose gel electrophoresis detection, as indicated with 2. As shown in Figure 2, minimal detectable concentration is 10-5ng/��L��
Embodiment 4 replica test
Using same concentrations coupler body DNA standard substance as masterplate, in a PCR reaction, carrying out multitube and reflect simultaneously, configure 2% agarose gel, when carrying out application of sample before carrying out electrophoresis, the application of sample amount in every hole keeps consistent, and result is as shown in Figure 3. From the figure 3, it may be seen that the band of each sample is all bright, repeatability is good.
Embodiment 5 specific test
Respectively with the DNA of reference culture, the DNA of non-pathogenic coupler body 566505 and blank for template, primer described in embodiment 1 is utilized to carry out PCR reaction.
Wherein, reference culture is the coupler body bacterial strain the most easily dog caused a disease, including jaundice hemorrhage 56601, dog 56603, ripple rub that 56608, influenza typhoid fever 56609, nanukayami 56610, Maksim Tarasov 56635.
PCR primer is carried out agarose gel electrophoresis detection, as shown in Figure 4. As shown in Figure 4, all there is band in pathogenic strain, it was shown that specificity is good.
Embodiment 6 builds standard positive plasmid (positive control)
Rub that DNA of 56608 as template extracting from ripple, utilizes primer described in embodiment 1 to carry out pcr amplification, carry out 5 pipe 10 �� L reactions, 94 DEG C of 3min; 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 29 circulations; 72 DEG C of 5min. PCR reactant liquor is added in the agarose gel preparing 2%, carries out 25 minutes electrophoresis with 120V voltage, then under uviol lamp after observation, quickly the purpose fragment after Purified in electrophoresis is cut. The genes of interest reclaiming genes of interest fragment gained carries out with pMD18-T, and the reaction system of connection is as follows: pMD18-Tvector0.5 �� L, PCR primer 4.5 �� L, SolutionI5 �� L. 4 DEG C of refrigerators carry out overnight coupled reaction.
Take out Trans1-T1 from-80 DEG C of refrigerators and clone competence, carry out ice bath dissolving. Then sterile working is rapidly added 10 �� L connection products, carries out slowly slightly blowing and beating mixing with liquid-transfering gun. Then carry out 30min ice bath, stand. During this period, getting out 42 DEG C of water-baths, ice bath terminates rear 42 DEG C of water-bath heat shocks 30 seconds, and then quick ice bath 2 minutes, can not shake centrifuge tube in whole process. Adding the 500 �� L LB culture medium (without resistance) through preheating, and be placed on 37 DEG C, 1h cultivated by 200rpm shaking table. Then carrying out the centrifugal 2min of 6000rpm, discard supernatant, stay 200 �� L piping and druming mixings, draw 100 �� L bacterium solution and be applied on Amp resistance LB solid medium flat board, 37 DEG C of incubators are inverted and are proceeded overnight incubation 12h after placing 30min.
Sterile working, picking converts bacterium colony on flat board and accesses in the test tube containing Amp resistance LB fluid medium, carry out labelling, it is placed in 37 DEG C, 200rpm shaking table is cultivated, 12 hours at the latest, take the muddy bacterium solution test tube of growth and carry out PCR qualification, amplifiable go out to meet purpose clip size person, can be tentatively positive colony depending on corresponding invisible spectro bacterium solution. And positive bacterium solution is carried out amplification culture again, extract plasmid for next step and prepare.
Choose PCR in experiment and be accredited as the bacterium solution of positive, be sent to Sheng Gong company and check order. Sequencing result is: CTTGGGATTCTTCTAATACCGATATTCTCTCAATTTCCAATGCAAGTGATAGCCAC GGATTAGCTTCCACACTCAACCAAGGGAATGTTAAAGTCACTGCTTCCATCGGTGG AATACAAGGATC. And preserving the bacterium solution of this pipe bacterium solution amplification culture again with glycerol, to be positioned over-80 DEG C of refrigerators standby. Often pipe preserves 1mL, and wherein glycerol and bacterium solution ratio are 3:7.
Plasmid is extracted by the plasmid extraction kit description of product.
The assembling of embodiment 7 test kit
In PCR detection kit, including each pipe of positive control and negative control article, each pipe of upstream and downstream primer described in embodiment 1, Premix mono-manages, ddH2O mono-manages. Wherein positive control article is plasmid standard (such as embodiment 6 gained) constructed in experiment, and negative control is aseptic ddH2O, upstream and downstream primer concentration is 10 ��Ms, comprises Taq enzyme, dNTP, 10 �� Buffer in Premix. Preservation condition is-20 DEG C.
Embodiment 8 test kit parameter detecting
Sensitivity technique:
(1) the constructed plasmid standard of the quantitative mistake of gradient dilution, detects by PCR kit, and minimal detectable concentration is 101Copies/ �� L. . (Fig. 5)
(2) choose well-grown 56601 coupler body bacterium solution to count, be diluted to 108Thalline/mL, extracts phage gene group DNA, then by culture medium, bacterium solution is carried out 10 times of gradient dilutions, and detection can detect minimum bacterial concentration, is the 6th hole bacterial concentration 1 �� 102Coupler body/mL. (Fig. 6)
Specific detection: by two kinds of methods to reference culture jaundice hemorrhage 56601, dog 56603, ripple rub that 56608, influenza typhoid fever 56609, nanukayami 56610, Maksim Tarasov 56635, non-pathogenic coupler body 566505 and blank detect. Only pathogenic coupler body is positive, and non-coupler body and blank are feminine gender.
Repeatability detection: choose the standard substance of 3 variable concentrations, carry out quantitative fluorescent PCR reaction respectively, the standard substance of each concentration carry out three repetitions, calculate the coefficient of variation, the repeatability of verification method, and repeatability is good.
Determine storage life: being placed in by two kinds of test kits at-20 DEG C and preserve, interval is detected for two weeks, it is determined that its storage life. After six months, testing result is still good, it is determined that preservation condition is-20 DEG C, and storage life the shortest is six months.
Test kit recall rate detects: clinical acquisitions dog blood and urine sample, and with goldstandard method microscopic agglutination test (MAT) method of coupler body detection, and the PCR method set up detects, and contrasts recall rate. It is consistent that the positive sample that PCR method detects detects positive sample number with MAT method, and recall rate is good.
Although, above the present invention is described in detail with a general description of the specific embodiments, but on basis of the present invention, it is possible to it is made some modifications or improvements, and this will be apparent to those skilled in the art. Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to the scope of protection of present invention.
Claims (6)
1. the PCR primer detecting pathogenic leptospira canicola, it is characterised in that described primer is as follows:
Forward primer: 5 '-CTTGGGATTCTTCTAATMCSGATA-3 ';
Downstream primer: 5 '-GATCCTTGTATTCCACCGATG-3 '.
2. the primer described in claim 1 detects the application in the test kit of pathogenic leptospira canicola in preparation.
3. contain reagent or the test kit of primer described in claim 1.
4. the test kit detecting pathogenic leptospira canicola, it is characterised in that described test kit includes: the PCR primer described in claim 1, positive control, negative control, Taq enzyme, dNTP, 10 �� Buffer, ddH2O��
5. test kit according to claim 4, it is characterised in that the construction method of described positive control is:
1) using the genomic DNA of 56608 bacterial strains as template, utilize the primer described in claim 1 to carry out pcr amplification, PCR primer is purified recovery, is attached with pMD18-T;
2) clone to Trans1-T1 competence adds step 1) the connection product that obtains, screening positive clone, extract plasmid.
6. test kit according to claim 4, it is characterised in that the working procedure of described test kit is: 94 DEG C of denaturation 3min; 94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, 29 circulations; 72 DEG C extend 5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610077204.4A CN105624301A (en) | 2016-02-03 | 2016-02-03 | PCR (polymerase chain reaction) primer and kit for detecting pathogenic canine leptospirosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610077204.4A CN105624301A (en) | 2016-02-03 | 2016-02-03 | PCR (polymerase chain reaction) primer and kit for detecting pathogenic canine leptospirosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105624301A true CN105624301A (en) | 2016-06-01 |
Family
ID=56039643
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610077204.4A Pending CN105624301A (en) | 2016-02-03 | 2016-02-03 | PCR (polymerase chain reaction) primer and kit for detecting pathogenic canine leptospirosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105624301A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114262742A (en) * | 2021-12-29 | 2022-04-01 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting leptospira |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004032599A2 (en) * | 2002-10-10 | 2004-04-22 | Cornell Research Foundation, Inc. | Novel immunogenic proteins of leptospira |
| CN101935696A (en) * | 2010-04-01 | 2011-01-05 | 中国农业科学院上海兽医研究所 | Fluorescent quantization PCR (Polymerase Chain Reaction) method for detecting dog-cat leptospira as well as primer and detection kit thereof |
-
2016
- 2016-02-03 CN CN201610077204.4A patent/CN105624301A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004032599A2 (en) * | 2002-10-10 | 2004-04-22 | Cornell Research Foundation, Inc. | Novel immunogenic proteins of leptospira |
| CN101935696A (en) * | 2010-04-01 | 2011-01-05 | 中国农业科学院上海兽医研究所 | Fluorescent quantization PCR (Polymerase Chain Reaction) method for detecting dog-cat leptospira as well as primer and detection kit thereof |
Non-Patent Citations (1)
| Title |
|---|
| 龚悦: "犬钩端螺旋体病PCR和荧光定量PCR诊断试剂盒的研制", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114262742A (en) * | 2021-12-29 | 2022-04-01 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting leptospira |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551846B (en) | Cpf1 kit for quickly detecting African swine fever virus nucleic acid and detection method thereof | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN108103240A (en) | Prawn infectivity muscle necrosis virus（IMNV）RAA constant temperature fluorescence detection method and reagent | |
| Fischer et al. | Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis | |
| CN107988326A (en) | Prawn Acute Hepatic pancreatic necrosis（AHPND）RAA constant temperature fluorescence detection method and reagent | |
| CN104726567A (en) | Streptococcus agalactiae loop-mediated isothermal amplification kit and application thereof | |
| CN106399486A (en) | Primer group and kit for detecting diarrhea-causing parasites through multi-PCR technology | |
| CN107988426A (en) | Prawn Taura syndrome（TSV）RAA constant temperature fluorescence detection method and reagent | |
| CN114774563B (en) | Detection reagent for brucellosis in dog and application | |
| CN105734158A (en) | Fluorescent PCR (polymerase chain reaction) detection kit for babesia caballi disease | |
| Li et al. | Rapid detection of porcine deltacoronavirus and porcine epidemic diarrhea virus using the duplex recombinase polymerase amplification method | |
| CN105624300A (en) | Fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting pathogenic leptospira canicola | |
| CN107460255A (en) | A kind of RT LAMP primers group, kit and application for detecting pig fourth type coronavirus | |
| JP4903722B2 (en) | Method for detecting live cells in a sample by using a virus | |
| CN101481742A (en) | Detection kit for Mycoplasma hyopneumoniae and use thereof | |
| CN103276099A (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN107513583A (en) | Detect the absolute fluorescence quantification PCR primer and kit of the pestivirus of atypia pig | |
| CN102154270B (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| CN102337352B (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN105624301A (en) | PCR (polymerase chain reaction) primer and kit for detecting pathogenic canine leptospirosis | |
| CN111172301A (en) | PCR fluorescence detection kit for clostridium difficile toxin B and application thereof | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN107385084A (en) | Application and its kit and detection method of the astragalus polyose in ring mediated isothermal amplification | |
| CN106701994A (en) | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer | |
| CN105821160A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for porcine kobuvirus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160601 |