CN105603128B - A kind of relevant virus detection kit of encephalitis and its application - Google Patents
A kind of relevant virus detection kit of encephalitis and its application Download PDFInfo
- Publication number
- CN105603128B CN105603128B CN201610192895.2A CN201610192895A CN105603128B CN 105603128 B CN105603128 B CN 105603128B CN 201610192895 A CN201610192895 A CN 201610192895A CN 105603128 B CN105603128 B CN 105603128B
- Authority
- CN
- China
- Prior art keywords
- virus
- seq
- encephalitis
- probe
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of relevant virus detection kit of encephalitis and its applications, the kit is used based on multiplex PCR combination nucleic acid intrusion reaction and nanogold colour developing principle, 5 kinds of primer combination of probe are contained, can be used for detecting eastern equine encephalitis virus, western equine encephalitis virus, epidemic encephalitis B virus, west nile virus and Nipah virus simultaneously.Strong, the high sensitivity that detects this 5 kinds of virus-specifics using the kit, does not need to be equipped with expensive instrument, is observable testing result by naked eyes, can be applied in base.
Description
Technical field
The present invention relates to technical field of molecular biology, and in particular to eastern equine encephalitis virus (EEEV), western equine encephalitis
While viral (WEEV), epidemic encephalitis B virus (JEV), west nile virus (WNV) and Buddhist nun's pa (NiPA) virus infection
Multiple PCR primer, nucleic acid invasion reaction probe, kit and the application of detection.
Background technique
Viral encephalitis is the infection of central nervous system different degrees of caused by virus infection.Its clinical manifestation are as follows:
Fever, headache, vomiting, clouding of consciousness, neck rigidity, respiratory failure etc..The common virus packet that may induce encephalitis meningitis
Eastern equine encephalitis virus, western equine encephalitis virus, epidemic encephalitis B virus and the west nile virus of arboviruse class are included, it is secondary
The Nipah virus etc. that myxovirus Ke Nipa Hendra virus belongs to, this 5 kinds of viruses are RNA virus, and are all deadly infectious disease disease
Original can cause deadly infectious disease eruption and prevalence, seriously endanger sanitarian safety.
In existing laboratory diagnostic technique, although virus purification culture is detection " goldstandard ", but this method operation is multiple
Miscellaneous, time-consuming, is not suitable for early diagnosing.Serology antibody test is although easy to operate, but its sensitivity and specificity becomes
Change larger, is easy to appear false positive and false negative.In recent years, PCR detection technique is because it has preferable sensibility and special
Property, it is widely applied and develops in various molecular diagnosises, but be substantially for single viral diagnosis (such as encephalitis B
Virus) and be difficult to make unknown pathogen cases of infection and quick and precisely diagnose.Especially it is used clinically for encephalitis viruses detection
Sample cerebrospinal fluid limited amount, thus multiplex PCR is particularly important to the clinical diagnosis of encephalitis class disease.It is directed to encephalitis viruses at present
Detection has had multiplex PCR detection technique, but there is also some common problems: (1) specificity is low with sensitivity；(2) due to
Amplified production is identical as target nucleic acid sequence, therefore easily causes product cross-contamination, and detection of nucleic acids is made false positive often occur
As a result；(3) its amplified production needs to be identified by agarose gel electrophoresis, not only cumbersome, needs electrophoresis equipment, and
And it is difficult to distinguish and the close non-specific amplification product of purpose band size；(4) multiplex PCR needs rule of thumb to carry out adjusting body
Concentration difference and dNTP and MgCl in system between each pair of primer2Concentration etc., require designer relatively high, condition
And 5 kinds of encephalitis viruses are Zoonosis disease of natural focus in this research, mostly occur in the health cares such as mountain area and hills
The relatively poor area of condition, so, it would be highly desirable to establish a kind of quick, reliable, the nucleic acid detection technique of suitable grass-roots unit.
Summary of the invention
Technical problem solved by the invention is to provide a kind of easy to operate, low-cost and with higher sensitivity encephalitis phase
Virus detection kit and its application are closed, it is B-mode to detect eastern equine encephalitis virus, western equine encephalitis virus, popularity simultaneously
Encephalitis viruses, west nile virus and Nipah virus.
The present invention is to invade reaction and nanogold colour developing based on multiple PCR technique combination nucleic acid to detect encephalitis related diseases
Poison forms our target nucleic acid first after multi-PRC reaction, then by nucleic acid invade reaction generate signal amplification, finally with
Nanogold particle reaction generates visual chromogenic reaction.Nucleic acid intrusion experiment be develop in recent years one kind do not expand target nucleic acid, and
It is to cause the amplification of other signaling molecules by target nucleic acid, the nucleic acid signal amplification detection method that target nucleic acid is detected indirectly,
To avoid the cross contamination of amplified production, and the sensitivity of detection is improved, also solving needs in single multiplex PCR detection
It will be to various primer concentrations and dNTP and MgCl2Concentration carry out complex optimization the problem of.Its amplifying nucleic acid intrusion reaction and nanometer
Golden chromogenic reaction principle is shown in Fig. 1, in nucleic acid intrusion reaction, is separately added into upstream and downstream probe and a hairpin probe, upstream and downstream
Probe can form a kind of single base intrusion overlay structure in nucleic acid intrusion reaction system with target nucleic acid.This special structure
It after being identified by endonuclease, can be severed, the segment cut is known as flap segment, can be as the signal of template specificity point
Son.Flap segment can be accumulated constantly, can simultaneously serve as second step intrusion cleavage reaction intrusion probe, with hair fastener probe into
Row hybridization forms single base again and invades overlay structure, and under the action of endonuclease, hair fastener probe is also cut into two
Point.If for hair fastener probe before not cut, 3 ' ends and 5 ' ends can be miscellaneous with Nano-Au probe complementation respectively without target nucleic acid
It hands over, forms nanogold particle-polynucleotides poly reticular structure, form precipitating, reaction system presentation is colorless and transparent, is considered as yin
Property reaction (Fig. 1).And when reaction system is there are cascade signal iodine when target nucleic acid, is caused, a large amount of hair fastener probes are cut,
It complementary with two kinds of Nano-Au probes cannot connect, the characteristic ion absorption that can not cause nanogold changes, and reaction system is in
Existing red, is considered as positive (Fig. 1).This research finally carries out result judgement with nanogold chromogenic reaction, does not need electrophoresis equipment, fits
Close the detection of grass-roots work personnel.
The invention discloses a kind of primer of the relevant virus multiple PCR detection of encephalitis and the spies of nucleic acid invasion reaction
Needle, the primer and probe combinations are as follows:
First group:
Eastern equine encephalitis virus upstream and downstream primer respectively as shown in SEQ ID NO:1 and SEQ ID NO:2,
Eastern equine encephalitis virus upstream and downstream probe respectively as shown in SEQ ID NO:11 and SEQ ID NO:12,
Second group:
Western equine encephalitis virus upstream and downstream primer respectively as shown in SEQ ID NO:3 and SEQ ID NO:4,
Western equine encephalitis virus upstream and downstream probe respectively as shown in SEQ ID NO:13 and SEQ ID NO:14,
Third group:
West nile virus upstream and downstream primer respectively as shown in SEQ ID NO:5 and SEQ ID NO:6,
West nile virus upstream and downstream probe respectively as shown in SEQ ID NO:15 and SEQ ID NO:16,
4th group:
Nipah virus upstream and downstream primer is respectively as shown in SEQ ID NO:7 and SEQ ID NO:8, Nipah virus upstream and downstream
Probe is respectively as shown in SEQ ID NO:17 and SEQ ID NO:18；
5th group:
Epidemic encephalitis B virus upstream and downstream primer respectively as shown in SEQ ID NO:9 and SEQ ID NO:10,
Epidemic encephalitis B virus upstream and downstream probe is respectively as shown in SEO ID NO:19 and SEQ ID NO:20.
Five pairs of primers are respectively to specific amplification EEEV, WEEV, WNV, NiPA and JEV target nucleic acid；Five pairs of probes point
It Yong Yu not be in nucleic acid intrusion reaction to the amplification of signal of target nucleic acid.
The invention also discloses a kind of kit of the relevant viral diagnosis of encephalitis, the kit at least contains
State one group in primer combination of probe.
Preferably, the kit also contains hair fastener probe and Nano-Au probe.
Preferably, primer concentration all in the multiplexed PCR amplification reaction system is identical.
Preferably, the primer concentration is 1 μM.
Preferably, all probes in the primer combination of probe are 5 μM identical in the concentration of invasion reaction.
The application method of kit provided by the invention, includes the following steps:
S1 nucleic acid extraction: nucleic acid extraction kit MagNA Pure LC Total Nucleic Acid Isolation
Kit and the MagNA Pure LC Full automatic instrument for extracting nucleic acid used are provided by Roche company, are extracted nucleic acid and are placed in -80 DEG C
It saves.
S2 reverse transcription: according to Invitrogen company SuperScript III First-Strand Synthesis
SuperMix specification operating method, the random primer provided using the kit are set 5 kinds of viral nucleic acid reverse transcriptions for cDNA
It is saved in -20 DEG C.
S3 multi-PRC reaction: using multiple PCR primer in table 1, referring to QIAGEN Multiplex PCR Kit specification
Respective reaction system is configured for different nucleic acid, contains 5 pairs of amplimers in each system, amplified production passes through QIAxcel
Capillary electrophoresis (Qiagen) is detected.
S4 nucleic acid intrusion reaction and nanogold chromogenic reaction: upstream and downstream probe needed for nucleic acid intrusion reaction is as shown in table 2,
Contain hairpin probe in reaction system.Nucleic acid invades after the reaction was completed, and Nano-Au probe is added and carries out hybridization reaction, reaction terminates
Result is determined by colour developing afterwards.
The present invention finally discloses primer and the nucleic acid invasion reaction of the relevant virus multiple PCR detection of above-mentioned encephalitis
Probe and the relevant viral diagnosis of above-mentioned encephalitis kit preparing eastern equine encephalitis virus, western equine encephalitis disease
Application in poison, west nile virus, Nipah virus and/or epidemic encephalitis B virus detection reagent.
The beneficial effects of the present invention are: kit provided by the present invention for the first time invades multiple PCR technique combination nucleic acid instead
It answers and nanogold colour developing is applied to 5 kinds of encephalitis correlated virus detections, the positive colour developing result of sample is macroscopic red,
And negative control be it is colourless, common PCR instrument can be completed, and not need to be equipped with expensive instrument, by visually i.e. considerable
Testing result is examined, it is low in cost.And nucleic acid intrusion reaction does not depend on nucleic acid sequence, and only rely on the specificity knot of nucleic acid formation
Structure, and since the reaction not expands template to be measured itself, the risk of template cross contamination is greatly reduced, it can be in base
Layer hospital and Disease Control Agency are used widely.
In addition, the high specificity of primer and probe of the invention, high sensitivity can disposably analyze great amount of samples, simultaneously
A variety of encephalitis correlation pathogen are detected, operating procedure is reduced, saves resource.
Detailed description of the invention
Fig. 1 is nucleic acid of the present invention intrusion reaction and nanogold reaction principle figure
Specific embodiment
The present invention is further explained combined with specific embodiments below, it should be appreciated that embodiment is for illustrating rather than
It limits the scope of the invention.
The synthesis of the probe of primer and nucleic acid the invasion reaction of the relevant virus multiple PCR detection of 1 encephalitis of embodiment
Design of primers: 5 kinds of encephalitis correlated virus (eastern equine encephalitis virus, west are downloaded in NCBI Genebank database
Square equine encephalitis virus, epidemic encephalitis B virus, west nile virus and Nipah virus) gene order, it is soft by MEGA 5.1
Part carries out sequence alignment, and the related pathogenic genes conserved sequence of lookup is compared by blast and excludes homologous gene fragment, final true
Fixed viral target fragment to be measured.Multiplexed PCR amplification primer is designed by Primer 5.0.Up and down for conserved region gene design
Swim amplification (table 1) of the primer for each target gene in multiplex PCR.Utilize Universal Invader 1.2.4 software design
Upstream probe and downstream probe (table 2) needed for nucleic acid intrusion is reacted.The above primer is synthesized by Shanghai Sheng Gong bio-engineering corporation.
1 multiple PCR primer of table
Upstream and downstream probe needed for the intrusion of 2 nucleic acid of table is reacted
2 encephalitis correlated virus detection kit detection method of embodiment
S1 samples selection: EEEV virus raq gene, WEEV virus E1 gene, WNV virus non-structural
5 gene of protein and NiPA virus nucleoprotein gene are the synthesis of Beijing six directions Hua Da Gene Tech. Company Limited, and
It is cloned in pUC57 carrier, JEV virus stain is the separation of this laboratory, identification, saves.
S2 nucleic acid extraction: nucleic acid extraction is according to Roche company MagNA Pure LC Full automatic instrument for extracting nucleic acid and MagNA
The requirement of Pure LC Total Nucleic Acid Isolation Kit extracts nucleic acid and is placed in -80 DEG C of preservation
S3 reverse transcription: according to Invitrogen company SuperScript III First-Strand Synthesis
SuperMix specification operating method, the random primer provided using the kit are set JEV viral nucleic acid reverse transcription for cDNA
It is saved in -20 DEG C.
S4 configures multiplex PCR using multiple PCR primer in table 1, referring to QIAGEN Multiplex PCR Kit specification
Reaction system (20 μ L), wherein 10 μ L of PCR master Mix, amplimer Mix (1 μM) 3 μ L, 5 μ L of water.Divide into each system
Not Jia Ru the nucleic acid-templated 2 μ L of EEEV, WEEV, WNV, NiPA and JEV, and negative control is set.For ease of operation, we are 5
MiX is mixed into amplimer equal proportion, is transferred to the final concentration of each primer unanimously, is 1 μM, PCR reaction condition are as follows: 95 DEG C
It is denaturalized 15min, 94 DEG C, 30s, 60 DEG C, 90s, 72 DEG C, 90s, 40 circulations, 72 DEG C of extension 10min, 99 DEG C, 10min inactivates DNA
Enzyme.Amplified production carries out detection verifying by QIAxcel capillary electrophoresis.Testing result occurs in predicted position single
Purpose band.
The intrusion of S5 nucleic acid and nanogold hybridization reaction: nucleic acid intrusion reaction system (20 μ L) includes: nucleic acid intrusion reaction solution 2
Probe (5 μM) (table 2) 0.8 μ L, 2 μ L of hair fastener probe (2 μM), hair fastener probe sequence are as follows: 5 '-are reacted in μ L, the intrusion of upstream and downstream nucleic acid
GTCTTGTGGTACTGCACTCGTCTCGGTTTTCCGAGACGAGTCCTCGGCGCGAATAT TGATAATCAT-3 ' (invade by nucleic acid
Enter reaction solution and hair fastener probe be that the total institute Zhou Guohua collaborative project group of Nanjing Military Command provides), endonuclease AfuFEN1 μ L, body
After the completion of system prepares, 10 μ L mineral oil are added in every pipe, add 5 μ L multiplex PCR amplification products；Nucleic acid invades response procedures are as follows:
85 DEG C, 1min, 63 DEG C, 20min.6 μ L (Nanjing Military Command of Nano-Au probe is added into the nucleic acid intrusion reaction system that reaction is completed
Total institute Zhou Guohua collaborative project group provides), 55 DEG C after 5 μ L of 3M NaCl concussion mixing, 30min carries out nanogold chromogenic reaction.
Nucleic acid intrusion reaction and nanogold colour developing are and negative the results show that the colour developing result of each sample is macroscopic red
Control is colourless.
Embodiment 3 detects the specificity of 5 kinds of encephalitis correlated virus using kit of the present invention
Multiplex PCR system expands the nucleic acid and Plasmid samples of 5 kinds of encephalitis viruses, and reaction product is using described in embodiment 2
Nucleic acid intrusion reaction and nanogold coloration method are detected.The results are shown in Table 3, combines using multi-PRC reaction technology
When nucleic acid intrusion reaction and nanogold colour developing only use corresponding primed probe when being detected, can just it be shown after nanogold colour developing
Show the positive, result is feminine gender when detecting other pathogens, and it is higher special to show that this method detection respiratory pathogen has
Property.
3 multiplex PCR combination nucleic acid of table intrusion reaction and nanogold developing technology detect specificity result
+ indicate that testing result is the positive ,-indicate that testing result is feminine gender
Embodiment 4 detects the sensibility of 5 kinds of encephalitis correlated virus using kit provided by the present invention
For RNA virus JEV, EEEV, WEEV, WNV and NiPA Virus Sample, to have t7 rna polymerase promoter sequence
The upstream primer and downstream primer for arranging (5'-AATTCTAATACGACTCACTATAGGGAG-3') expand viral nucleic acid,
After amplified production purification and recovery, carry out that 5 kinds of viral RNA of acquisition are transcribed in vitro with t7 rna polymerase, quantitative latter 10 times of purifying dilute
It is interpreted into 1 × 101~1 × 105Copy template/μ L.Reaction and nanogold colour developing are invaded using above-mentioned multi-PRC reaction combination nucleic acid
Technology is detected.The results show that it is 1000 copies that the kit, which detects this 5 kinds viral lowest detection lines,.
The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention.The technology of the industry
Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this
The principle of invention, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, these changes
Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its
Equivalent thereof.
Claims (8)
1. a kind of primer of the relevant virus multiple PCR detection of encephalitis and the probe of nucleic acid invasion reaction, which is characterized in that
The primer and probe includes following five kinds combinations:
First group:
Eastern equine encephalitis virus upstream and downstream primer respectively as shown in SEQ ID NO:1 and SEQ ID NO:2,
Eastern equine encephalitis virus upstream and downstream probe respectively as shown in SEQ ID NO:11 and SEQ ID NO:12,
Second group:
Western equine encephalitis virus upstream and downstream primer respectively as shown in SEQ ID NO:3 and SEQ ID NO:4,
Western equine encephalitis virus upstream and downstream probe respectively as shown in SEQ ID NO:13 and SEQ ID NO:14,
Third group:
West nile virus upstream and downstream primer respectively as shown in SEQ ID NO:5 and SEQ ID NO:6,
West nile virus upstream and downstream probe respectively as shown in SEQ ID NO:15 and SEQ ID NO:16,
4th group:
Nipah virus upstream and downstream primer respectively as shown in SEQ ID NO:7 and SEQ ID NO:8,
Nipah virus upstream and downstream probe is respectively as shown in SEQ ID NO:17 and SEQ ID NO:18；
5th group:
Epidemic encephalitis B virus upstream and downstream primer respectively as shown in SEQ ID NO:9 and SEQID NO:10,
Epidemic encephalitis B virus upstream and downstream probe is respectively as shown in SEO ID NO:19 and SEQ ID NO:20.
2. a kind of kit of the relevant viral diagnosis of encephalitis, which is characterized in that the kit contains claim 1 institute
The primer combination of probe stated.
3. kit according to claim 2, which is characterized in that the kit also contains hair fastener probe and nanogold is visited
Needle.
4. kit according to claim 2, which is characterized in that all in the multiplexed PCR amplification reaction system
Primer concentration is identical.
5. kit according to claim 4, which is characterized in that the primer concentration is 1 μM.
6. kit according to claim 2, which is characterized in that all probes in the primer combination of probe are in nucleic acid
Concentration is identical in invasion reaction.
7. kit according to claim 6, which is characterized in that all probes in the primer combination of probe are in core
Concentration is 5 μM in acid invasion reaction.
8. the primer of the relevant virus multiple PCR detection of encephalitis according to claim 1 and the spy of nucleic acid invasion reaction
The kit of needle, the relevant viral diagnosis of encephalitis described in claim 2-7 any claim is preparing eastern equine encephalitis
Answering in virus, western equine encephalitis virus, west nile virus, Nipah virus and/or epidemic encephalitis B virus detection reagent
With.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610192895.2A CN105603128B (en) | 2016-03-30 | 2016-03-30 | A kind of relevant virus detection kit of encephalitis and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610192895.2A CN105603128B (en) | 2016-03-30 | 2016-03-30 | A kind of relevant virus detection kit of encephalitis and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105603128A CN105603128A (en) | 2016-05-25 |
| CN105603128B true CN105603128B (en) | 2019-09-20 |
Family
ID=55983464
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610192895.2A Expired - Fee Related CN105603128B (en) | 2016-03-30 | 2016-03-30 | A kind of relevant virus detection kit of encephalitis and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105603128B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399586B (en) * | 2016-08-31 | 2019-09-06 | 北京卓诚惠生生物科技股份有限公司 | Multiplex PCR detects encephalitis meningitis correlated virus primer sets and kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101629215A (en) * | 2009-03-06 | 2010-01-20 | 中国人民解放军第二军医大学 | Kit for rapid joint detection of epidemic JEV, DEV and WNV and detection method thereof |
| CN102796827A (en) * | 2011-05-24 | 2012-11-28 | 上海透景生命科技有限公司 | Method and kit for detecting multiple encephalitis related viruses |
| CN105018644A (en) * | 2015-07-17 | 2015-11-04 | 江苏省疾病预防控制中心 | Respiratory tract pathogen detecting kit |
-
2016
- 2016-03-30 CN CN201610192895.2A patent/CN105603128B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101629215A (en) * | 2009-03-06 | 2010-01-20 | 中国人民解放军第二军医大学 | Kit for rapid joint detection of epidemic JEV, DEV and WNV and detection method thereof |
| CN102796827A (en) * | 2011-05-24 | 2012-11-28 | 上海透景生命科技有限公司 | Method and kit for detecting multiple encephalitis related viruses |
| CN105018644A (en) * | 2015-07-17 | 2015-11-04 | 江苏省疾病预防控制中心 | Respiratory tract pathogen detecting kit |
Non-Patent Citations (2)
| Title |
|---|
| Development of Multiplex Real-Time Reverse Transcriptase PCR Assays for Detecting Eight Medically Important Flaviviruses in Mosquitoes;Day-Yu Chao等;《JOURNAL OF CLINICAL MICROBIOLOGY》;20061105;第45卷(第2期);第584–589页 * |
| 脑炎脑膜炎症候群12种病毒Taqman一步法荧光定量RT-PCR Array检测方法的建立以及假病毒参考标准品的构建;蔡丽娟;《中国优秀硕士学位论文数据库 医药卫生科技辑》;20130415(第04期);E70-26 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105603128A (en) | 2016-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | A one-step, one-pot CRISPR nucleic acid detection platform (CRISPR-top): Application for the diagnosis of COVID-19 | |
| CN104342503B (en) | A kind of method simultaneously detecting 12 kinds of common Respiroviruses | |
| Zheng et al. | Reverse transcription recombinase-aided amplification assay with lateral flow dipstick assay for rapid detection of 2019 novel coronavirus | |
| CN110468237A (en) | Detect the primed probe mixed liquor and kit of Middle East respiration syndrome coronavirus | |
| CN105018644B (en) | A kind of respiratory pathogen detection kit | |
| CN104513865B (en) | Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus | |
| CN104561377A (en) | Real-time fluorescent multiplex PCR (polymerase chain reaction) based kit for rapidly detecting common respiratory pathogens | |
| CN106167833B (en) | A kind of while 8 kinds of entomophila encephalitis viruses of detection RT-PCR primers and probe combinations and kit | |
| Estrela et al. | Ten-minute direct detection of Zika virus in serum samples by RT-LAMP | |
| CN106868220A (en) | A kind of LAMP primer group and kit for expanding MERS CoV | |
| CN105936946A (en) | One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof | |
| CN103074448A (en) | Kit for synchronously detecting twenty-three meningitis pathogens and detection method of kit | |
| CN107619885A (en) | A kind of fluorescence RT RAA primers, probe and detection method for being used to detect dengue virus | |
| Ren et al. | Development of a super-sensitive diagnostic method for African swine fever using CRISPR techniques | |
| CN113025726A (en) | Primer, probe, kit and method for visual rapid detection of schistosoma japonicum nucleic acid by LFD-RPA | |
| CN101363063B (en) | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR | |
| Gao et al. | Establishment of a dual real-time PCR assay for the identification of African swine fever virus genotypes I and II in China | |
| CN106636454A (en) | Real-time fluorescence multi-RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method for simultaneously detecting human coronaviruses 229E, OC43, NL63 and HKU1 | |
| CN105483284B (en) | A kind of RT-qPCR kits of three kinds of citrus virus of synchronous detection | |
| CN105603128B (en) | A kind of relevant virus detection kit of encephalitis and its application | |
| CN103911462B (en) | Identification and detection method for yellow fever, Japanese encephalitis, chikungunya fever and west Nile fever, primers and probes | |
| CN106119421B (en) | QYYZ plants of pig blue-ear disease of fluorogenic quantitative detection primer, probe and kit | |
| CN102994648B (en) | Multi-gene detection method of respiratory viruses based on capillary electrophoresis | |
| CN105316431B (en) | Differentiate the quick detection primer groups of GeXP, kit and its application of three kinds of H5 subtype avian influenza virus combination of infection people simultaneously | |
| CN105463131B (en) | Human bocavirus LAMP detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190920 Termination date: 20200330 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |