CN105506130A - Molecular marker for authenticating antiviral disease QTL_BrTuA09 on Chinese cabbage A09 chromosome and application of molecular marker - Google Patents
Molecular marker for authenticating antiviral disease QTL_BrTuA09 on Chinese cabbage A09 chromosome and application of molecular marker Download PDFInfo
- Publication number
- CN105506130A CN105506130A CN201610025560.1A CN201610025560A CN105506130A CN 105506130 A CN105506130 A CN 105506130A CN 201610025560 A CN201610025560 A CN 201610025560A CN 105506130 A CN105506130 A CN 105506130A
- Authority
- CN
- China
- Prior art keywords
- chinese cabbage
- sequence
- nucleotide
- karyomit
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP molecular marker which is used for authenticating a Chinese cabbage viral disease TuMV-C4 microspecies resistance and located on the A09 chromosome and application of the SNP molecular marker. The SNP molecular marker is composed of single stranded DNA molecules as shown in sequence 2, single stranded DNA molecules as shown in sequence 3 and single stranded DNA molecules as shown in sequence 4; the verification result of the molecular marker by a BC 1 group formed by 92 single plants shows that the selection accuracy of the SNP molecular marker is 85% and above, the molecular marker can be used for molecular marker assistant breeding, and a good foundation is laid for further positioning and cloning genes.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of molecule marker and the application thereof of identifying the viral diseases QTL-BrTuA09 on Chinese cabbage A09 karyomit(e), can be used for the Resistance Identification of virus disease TuMV-C4 microspecies.
Background technology
Chinese cabbage (BrassicarapaL.ssp.Pekinensis) is one of important cash crop of China, the seed output and quality of virus disease serious threat Chinese cabbage, can cause the production loss of 5% ~ 10% every year on average, popular time sickness rate can reach 80%, even has no harvest.There is no beneficial agents and control techniques at present, cultivating disease-resistant variety becomes most effectively preventing measure.Along with the development of molecular biology and information biology, excavate and the resistance main effect QTL being separated different sources, and carry out high-efficiency polymerization by Molecular design breeding, seed selection is stable, permanent disease-resistant kind, becomes one of effective way ensureing that Chinese cabbage safety non-pollution is produced.
Virus disease is serious to the harm of multiple Brassica Crops, excavate with resistant gene or the chain molecule marker of QTL very important in acceleration molecular marker-assisted breeding.Rusholme navigates to two QTL with DH colony for material abroad, is positioned at the TuRB01b of A6 linkage group and is positioned at the retr01 of R4 linkage group; Rnt1 is positioned in A6 linkage group by Fujiwara (2011); Recent Jin (2014) located the QTL-TuRB07 of an anti-TuMV-C4 in A6 linkage group, and obtains candidate gene.State's introflexion refined flat (2008) detects the QTL site of 4 anti-TuMV-C3 on Chinese cabbage; Korea Spro's peace (2004) has found a dominant marker relevant to TuMV-C5 resistance; Zhang Junhua etc. (2008) report the QTL of 4 anti-TuMV-C3; Zhang Xiaowei etc. (2009) find the QTL site of 3 anti-TuMV-C4; Zhang (2008), by research, on the genetic map that comprises 376 molecule markers, has found 4 QTLs relevant to the anti-TuMV-C4 of Chinese cabbage.
Research shows that molecule marker screens at target resource, and the application of locating the aspects such as the gene of the specific economical character of regulation and control, gene pyramiding and cultivar identification is more and more extensive.SNP belongs to molecule marker of new generation, have abundance high, detect easily realize the features such as automatization.SNPline genotype tests based on KASP (competitive ApoE gene) is the high-throughput SNP typing method of Britain LGC (LaboratoryoftheGovernmentChemist) company limited exploitation, and it has accurately, flexible, low cost, high-throughout feature.The core of the program is KASP technology, i.e. CompetitiveAllele-SpecificPCR.This technology comes SNP somatotype based on the special coupling of prime end base and detect InDels (InsertionsandDeletions inserts and disappearance), become one of main stream approach of snp analysis in the world at present.
Summary of the invention
First object of the present invention there is provided a kind of qualification or assistant identification breeds of Chinese cabbage to be measured to the method for virus disease TuMV-C4 microspecies resistance.
Qualification provided by the invention or the method for assistant identification breeds of Chinese cabbage to be measured to virus disease TuMV-C4 microspecies resistance to be the genotype detecting Chinese cabbage to be measured be CC genotype or TT genotype or TC genotype, determine the resistance of described breeds of Chinese cabbage to virus disease TuMV-C4 microspecies according to the genotype of described Chinese cabbage: the genotypic breeds of Chinese cabbage of TT is susceptible to the resistance of virus disease TuMV-C4 microspecies, the genotypic breeds of Chinese cabbage of TC and the genotypic breeds of Chinese cabbage of CC are disease-resistant to the resistance of virus disease TuMV-C4 microspecies;
Described CC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of C;
Described TT genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of T;
Described TC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the heterozygote of C and T.
In aforesaid method, the genotype of described detection Chinese cabbage to be measured is CC genotype or the genotypic method of TC is following A) or B):
A) genomic dna of direct Sequencing Chinese cabbage;
B) pcr amplification product of order-checking containing the 9805885th deoxyribonucleotide on Chinese cabbage A09 karyomit(e);
Described pcr amplification product primer used is following 1) or 2):
1) the primer set A be made up of the single strand dna shown in sequence 4 in the single strand dna shown in sequence 3 in the single strand dna shown in sequence in sequence table 2, sequence table and sequence table;
2) the primer set B be made up of the single strand dna shown in the single strand dna shown in sequence A, sequence B and the single strand dna shown in sequence C;
Described sequence A for sequence 2 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 2;
Described sequence B for sequence 3 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 3;
Described sequence C for sequence 4 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 4.
In aforesaid method, the breeds of Chinese cabbage of disease index within the scope of 0-33.33 is disease-resistant to the resistance of virus disease TuMV-C4 microspecies; The breeds of Chinese cabbage of disease index within the scope of 33.34-100 is susceptible to the resistance of virus disease TuMV-C4 microspecies.
Second object of the present invention is to provide the novelty teabag of the material of the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th.
The material that the invention provides the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th in qualification or assistant identification breeds of Chinese cabbage to be measured to the application in virus disease TuMV-C4 microspecies resistance.
The material that present invention also offers the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th in characterization or assistant identification breeds of Chinese cabbage to be measured to the application in the product of virus disease TuMV-C4 microspecies resistance.
Present invention also offers the application of material in Chinese cabbage breeding of the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th.
Present invention also offers the application of material in the product of preparation Chinese cabbage breeding of the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th.
Present invention also offers the application of material in the Chinese cabbage of seed selection viral diseases TuMV-C4 microspecies of the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th.
Present invention also offers the application of material in the product of the Chinese cabbage of preparation seed selection viral diseases TuMV-C4 microspecies of the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th.
3rd object of the present invention is to provide a kind of qualification or assistant identification breeds of Chinese cabbage to be measured to the product of virus disease TuMV-C4 microspecies resistance.
Provided by the inventionly to identify or the product of assistant identification breeds of Chinese cabbage to be measured to virus disease TuMV-C4 microspecies resistance is the material of the deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th.
In above-mentioned application or the said products,
The described material detecting the deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is following 1) or 2) or 3) or 4):
1) the primer set A be made up of the single strand dna shown in sequence 4 in the single strand dna shown in sequence 3 in the single strand dna shown in sequence in sequence table 2, sequence table and sequence table;
2) the primer set B be made up of the single strand dna shown in the single strand dna shown in sequence A, sequence B and the single strand dna shown in sequence C;
Described sequence A for sequence 2 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 2;
Described sequence B for sequence 3 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 3;
Described sequence C for sequence 4 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 4;
3) containing 1) described in primer set A or 2) described in the PCR reagent of primer set B;
4) containing 1) described in primer set A or 2) described in primer set B or 3) described in the test kit of PCR reagent.
4th object of the present invention is to provide a kind of method of breeds of Chinese cabbage of seed selection viral diseases TuMV-C4 microspecies.
The method of the breeds of Chinese cabbage of seed selection viral diseases TuMV-C4 microspecies provided by the invention comprises selects the genotypic breeds of Chinese cabbage of TC or the genotypic breeds of Chinese cabbage of CC to carry out breeding;
Described TT genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of T;
Described TC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the heterozygote of C and T.
In aforesaid method or above-mentioned application or the said products, described Chinese cabbage is the Chinese cabbage with viral diseases QTL-BrTuA09; The described Chinese cabbage with viral diseases QTL-BrTuA09 is the Chinese cabbage with viral diseases QTL-BrTuA09.
The present invention to resurvey sequence information according to parents' genome, develop further between target QTL-BrTuA09 location 1 with the closely linked SNP marker of virus disease resistance, this molecule marker can be used for the Resistance Identification of the virus disease TuMV-C4 microspecies to breeds of Chinese cabbage.Checking display by the BC1 colony of 92 individual plant compositions: the selection accuracy rate of this mark, all more than 93%, can be used for molecular mark, and for location and clone gene are had laid a good foundation further.
Accompanying drawing explanation
Fig. 1 is that Tu-A099805885T/C verifies somatotype effect as shown in Figure 1 to the BC1 colony that 92 individual plants form.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
0.05M (PH=7.0) phosphoric acid buffer liquid making method in following embodiment: the 0.2mol/LNa measuring 61.0mL respectively
2hPO
4the 0.2mol/LNaH of mother liquor and 39.0mL
2pO
4mother liquor, is settled to 200mL after mixing, is 0.05M (PH=7.0) phosphoric acid buffer.Wherein, 0.2mol/LNa
2hPO
4the preparation method of mother liquor: Na
2hPO
42H
2o35.61g, Na
2hPO
47H
2o53.65g or Na
2hPO
412H
2o71.64g, dissolves with distilled water and is settled to 1000mL; 0.2mol/LNaH
2pO
4the preparation method of mother liquor: NaH
2pO
4h
2o27.6g or NaH
2pO
42H
2o31.2g, dissolves with distilled water and is settled to 1000mL.
Male parent 91-112 in following embodiment is that the Chinese cabbage in continuous selfing 9 generation is high for self-mating system, high resistance TuMV-C4; Maternal T12-19 is double haploid strain, high sense TuMV-C4.Male parent 91-112 and maternal T12-19 is all disclosed in document " GeneticmappingandlocalizationofamajorQTLforseedlingresis tancetodownymildewinChinesecabbage (Brassicarapassp.pekinensis; MolBreeding (2009) 23:573 – 590 ", and the public can obtain from agricultural and forest science institute Vegetable Research center, Beijing.
Virus disease TuMV-C4 microspecies in following embodiment are disclosed in document " Tian Xihui etc.; a new Chinese Cabbage Seedling TuMV-C4 resistance main effect QTL location and linkage molecule marker development; " North China agronomy report "; 2014 (06): 1-5 ", and the public can obtain from agricultural and forest science institute Vegetable Research center, Beijing.
The acquisition of embodiment 1, molecule marker
To derive from the DH colony of 100 strain compositions of T12-19 × 91-112 for mapping population, carry out the structure research of molecular genetic linkage map.Finally on A09, detect that QTL site QTL-BrTuA09, a LOD value is 18.6, additive effect is 16.2%, and explainable phenotypic variation reaches 62.0%, and this site is a newfound main effect QTL site.Above-mentioned result of study is see document " Tian Xihui etc., a new Chinese Cabbage Seedling TuMV-C4 resistance main effect QTL location and linkage molecule marker development " North China agronomy report ", 2014 (06): 1-5 ".
QTL site QTL-BrTuA09, between flag F ito518 and mark MR172, utilizes sequence information of resurveying screen in this interval and design SNP marker further, finally obtains 1 polymorphism SNP marker, called after Tu-A099805885T/C.Tu-A099805885T/C mark is made up of upstream primer A099805885-FF, upstream primer A099805885-FV and downstream primer A099805885-R.A099805885-FF, A099805885-FV and A099805885-R primer entrusts Britain LGC (LaboratoryoftheGovernmentChemist, government chemist laboratory) company limited to obtain, and primer sequence is as follows:
Upstream primer A099805885-FF:GAAGGTGACCAAGTTCATGCTTCTCTGGTGAACTACAGTTCC CTTCc (sequence 2);
Upstream primer A099805885-FV:GAAGGTCGGAGTCAACGGATTTCTCTGGTGAACTACAGTTCC CTTCt (sequence 3);
Downstream primer A099805885-R:CAAACCACTCCCGAATAGATACAGG (sequence 4).
The 300th of the corresponding sequence 1 of last bit base of above-mentioned upstream primer c/t, the also i.e. SNP site of the 9805885th on Chinese cabbage (Brassicarapapekinensis) A09 karyomit(e).The version number of the reference whole genome sequence of Chinese cabbage Brassicarapapekinensis is V1.5 (download address http://brassicadb.org/brad).
Application in embodiment 2, the molecule marker viral diseases TuMV-C4 microspecies resistance on qualification Chinese cabbage A09 karyomit(e)
One, the Resistance Identification of TuMV-C4 microspecies
1, BC
1the acquisition of colony
With disease-resistant parent 91-112 be male parent, Susceptible parent T12-19 hybridizes for female parent, obtains first-filial generation (F
1generation), then by F
1in generation, once backcrosses with maternal T12-19, obtains the BC of 92 individual plant compositions
1colony.
2, inoculation and Disease investigation and grade scale
The sick TuMV-C4 microspecies of virus inoculation are carried out, the virus disease TuMV-C4 microspecies resistance of qualification 92 BC1 individual plants to 92 BC1 individual plants, disease-resistant parent 91-112, Susceptible parent T12-19 and first-filial generation F1 that step 1 obtains.Concrete steps are as follows:
By the seed of 92 BC1 individual plants, disease-resistant parent 91-112, Susceptible parent T12-19 and first-filial generation F1, be seeded in 8cm nutrition pot after vernalization, soil used and the peat composed of rotten mosses for be mixed to get in 1:1 ratio after autoclave sterilization.Treat that seedling the 3rd true leaf of experiment material fully launches laggard row artificial inoculation.During inoculation, first on identified material, spray 300 ~ 400 object quartz sands, then dip the sick juice of virus disease TuMV-C4 microspecies respectively to two panels true leaf frictional inoculation with finger, with distilled water, blade is rinsed well immediately after inoculation, cultivation 24 hours of sheltering from heat or light.Postvaccinal 3rd day of first time again repeated inoculation once, day temperature controls at 25 DEG C ~ 28 DEG C, nocturnal temperature 20 DEG C ~ 22 DEG C, cultivates after 25 ~ 28 days, carries out TuMV Resistance Identification in greenhouse.28 days after inoculation, investigate the degree of disease of each young plant, record disease level, then be converted into disease index, finally carry out Analysis of Resistance.The grade scale of sick level is divided into 0,1,3,5,7,9 grade by the weight of Disease symptoms.Disease index=∑ (typical value × this disease morbidity strain number of sick level)/investigate total strain number × 9 (other highest typical value of partition level) × 100.The BC1 individual plant of disease index within the scope of 0-33.33 is disease-resistant to the resistance of virus disease TuMV-C4 microspecies; The BC1 individual plant of disease index within the scope of 33.34-100 is susceptible to the resistance of virus disease TuMV-C4 microspecies.
The grade scale of sick level is as follows:
0 grade: without any symptom;
1 grade: minority blade has chlorisis spot, or the slight floral leaf of minority blade;
3 grades: most blade to complete stool shows light floral leaf, or minority blade has erosion line spot;
5 grades: the heavy floral leaf of complete stool, plant type is short and small or petiole local necrosis obviously, minority leaf malformation;
7 grades: the serious floral leaf of complete stool, with withered spot, partial blade is withered: or complete stool leaf-shrinkage deformity, plant is downgraded;
9 grades: the withered so that whole strain of most of blade is dead.
Disease resistance evaluation standard is as follows:
Immunity I: disease index=0;
High resistance HR: disease index 0.01 ~ 11.11;
Disease-resistant R: disease index 11.12 ~ 33.33;
Resistance to sick T: disease index 33.34 ~ 55.55;
Susceptible S: disease index 55.56 ~ 77.77;
High sense HS: disease index 77.78 ~ 100.
Phenotypic examination result shows: in 92 BC1 individual plants, and 44 BC1 individual plants, parent 91-112 and first-filial generation F1 are all accredited as disease-resistant, and 48 BC1 individual plants and parent T12-19 are all accredited as susceptible.
Two, the correlation analysis of genotype and viral diseases TuMV-C4 microspecies resistance
1, the extraction of genomic dna
92 the BC1 individual plants obtained in extraction step one respectively, the genomic dna of disease-resistant parent 91-112 and Susceptible parent T12-19, extracting method can adopt conventional CTAB method or fast high-flux to extract the method for plant genome DNA.The present invention adopts conventional CTAB method to extract genomic dna.Concrete steps are as follows:
The leaf sample of each sample is loaded in 2mL centrifuge tube, writes numbering clearly after adding the steel ball of 1 0.4mm, put into the freezing 5-10min of liquid nitrogen, re-use tissue grinder and smash.Often pipe adds the CTAB damping fluid of 800 μ L65 DEG C preheatings, and rapid oscillation mixes, and put into 65 DEG C of water-bath water-bath 30min, period at least puts upside down mixing once.800 μ L chloroform/primary isoamyl alcohol (chloroform: primary isoamyl alcohol is 24:1) are added again, vibration mixing in centrifuge tube, after static 5min, the centrifugal 10min of 12000r/min.Inhale 600 μ L supernatant liquors to proceed in another 2mL centrifuge tube, add the Virahol of equal-volume-20 DEG C of precoolings, gentle inversion mixes, and be put in-20 DEG C of refrigerator cooling 20min, then the centrifugal 5min of 10000r/min, abandons supernatant.With 800 μ L75% ethanol rinse 2 times, the centrifugal 5min of each 10000r/min, abandons supernatant collection precipitation, dries up precipitation, add 50 μ LddH under last room temperature
2o dissolving DNA.
Detected the quality extracting the genomic dna obtained respectively by 1% agarose electrophoresis and Nanodrop2100, qualified DNA requires: agarose electrophoresis display DNA band is single, does not have obvious disperse; Nanodrop2100 detects A260/280 (DNA sample does not have protein contamination) between 1.8-2.0; A260/230 is (DNA sample salt ionic concentration is low) between 1.8-2.0; 270nm does not have obvious photoabsorption (DNA sample does not have phenol to pollute).Conversing DNA consumption according to the KASP detection technique of LGC company of Britain and Chinese cabbage Genome Size is the every sample of 4 ~ 10ng/, and dilution DNA concentration becomes 4 ~ 10ng/ μ l, for subsequent use.
2, the preparation of primer premixed liquid
Upstream primer A099805885-FF in embodiment 1, upstream primer A099805885-FV and downstream primer A099805885-R are all diluted to 10 μm of ol, and are the ratio mixing of 6:6:15 according to volume ratio, obtain primer premixed liquid.
3, gene type
Utilize KASP technology to the BC1 individual plant of 92 in step 1 based on the SNP site (on A09 karyomit(e) the 9805885th) in embodiment 1, male parent 91-112 and maternal T12-19 carries out SNP gene type, SNP genotyping process carries out according to the experiment flow of the KASP technology that LGC company provides, the reagent below used, consumptive material and instrument do not have providing by LGC company of specified otherwise, comprise reagent dosage, usage, and whole experimental procedure is carried out according to the operational guidance KASPuserguideandmanual (www.lgcgenomics.com) of LGC company, reaction is carried out in 384 orifice plates (PartNo.KBS-0750-001) or 1536 microwell plates (PartNo.KBS-0751-001), reaction system is 3ul or 1ul.Concrete steps are as follows:
First DNA profiling to be measured (4 ~ 10ng/ μ l) 1.5ul and blank (Notemplatecontrol utilizing K-pette separatory workstation step 1 to be diluted, NTC) add in 384 holes or 1536 hole Sptting plates respectively, dry 30min (loft drier for 60 DEG C, LGC company), it is for subsequent use that DNA becomes dry powder.Then under Kraken operating system, utilize Meridian application of sample workstation respectively to adding 1 × Mastermix (384 orifice plate article No. PartNo.KBS-1016-002 or 1536 microwell plate article No. PartNo.KBS-1016-011) and primer mixed solution in each reacting hole, the complete Kube that is successively placed on by microwell plate immediately of Mix packing seals instrument and Fusion laser sealer instrument upper sealing film, utilizes Hydrocyler to carry out high-throughput water-bath pcr amplification.Reaction system is as shown in table 1.
The reaction system of table 1,384 orifice plates or 1536 orifice plates
Note: Meridian is that exhaust steeps the reaction solution that need lose 230 μ l when often adding 1 pair of primer, i.e. 2xMastermix and ddH in separatory process
2the each 115 μ l of O.
PCR reaction is carried out in high-throughput water-bath system Hydrocycler, and specific procedure is 94 DEG C of denaturations, 15 minutes; 94 DEG C, DEG C-55 DEG C, 20 seconds (sex change)-61,1 minute (renaturation & extends: increase 10 with touchdown program and circulate, often circulation reduction by 0.6 DEG C); 94 DEG C, 20 seconds (sex change)-55 DEG C, continue amplification 26 circulation in 60 seconds.After amplification terminates, BMGPHERAstar instrument is utilized to detect fluorescent signal and check somatotype situation.If somatotype is insufficient, then continue amplification, somatotype situation is checked in every 3 circulations, until somatotype is complete, from Kraken software, derives experimental result.
To the somatotype design sketch of 92 parts of BC1 individual plants as shown in Figure 1, in figure, each round dot represents a detected materials to Tu-A099805885T/C, and wherein red spots represents that this site is homozygous genotype " TT "; Blue round dot represents that this site is homozygous genotype " CC "; Green round dot represents that this site is heterozygous genotypes " TC "; Black round dot represents NTC, is water contrast.Wherein resistance parent 91-112 is CC genotype in the genotype in this site, and Susceptible parent T12-19 is TT genotype in the genotype in this site.In 92 BC1 individual plants, 41 BC1 individual plants are accredited as TC genotype, and 50 BC1 individual plants are accredited as TT genotype, and 1 BC1 individual plant fails somatotype.Somatotype success ratio is 99%, illustrates that Tu-A099805885T/C somatotype is respond well, Tu-A099805885T/C mark can this site of special differentiation be CC genotype of isozygotying, TT genotype of isozygotying or heterozygosis TC genotype.
4, the association analysis of genotype and induction reactance disease
The association analysis result of 92 BC1 individual plant genotype and induction reactance disease is as shown in table 2: phenotype is in 44 disease-resistant individual plants, identified gene type be TC have 41 strains, genotype be CC have 3 strains, so select accuracy rate be 93%; Phenotype is in 48 susceptible individual plants, identified gene type be TT have 46 strains, genotype be TC have 1 strain, not obtaining genotypicly has 1 strain, so select accuracy rate to be 95.8%; Therefore the comprehensive accuracy rate of this Marker selection is 94.6%.
The association analysis result of table 2, genotype and induction reactance disease
In sum, can by determining that the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th determines that Chinese cabbage to be measured is CC genotype or TT genotype or TC genotype, thus assistant identification breeds of Chinese cabbage to be measured is to virus disease TuMV-C4 microspecies resistance: the genotypic breeds of Chinese cabbage of TT is susceptible to the resistance of virus disease TuMV-C4 microspecies, the genotypic breeds of Chinese cabbage of TC and the genotypic breeds of Chinese cabbage of CC are disease-resistant to the resistance of virus disease TuMV-C4 microspecies;
CC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of C;
TT genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of T;
TC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the heterozygote of T and C.
Claims (9)
1. a qualification or assistant identification breeds of Chinese cabbage to be measured are to the method for virus disease TuMV-C4 microspecies resistance, CC genotype that to be the genotype detecting Chinese cabbage to be measured be or TT genotype or TC genotype, determine the resistance of described breeds of Chinese cabbage to virus disease TuMV-C4 microspecies according to the genotype of described Chinese cabbage: the genotypic breeds of Chinese cabbage of TT is susceptible to the resistance of virus disease TuMV-C4 microspecies, the genotypic breeds of Chinese cabbage of TC and the genotypic breeds of Chinese cabbage of CC are disease-resistant to the resistance of virus disease TuMV-C4 microspecies;
Described CC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of C;
Described TT genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of T;
Described TC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the heterozygote of C and T.
2. method according to claim 1, is characterized in that: the genotype of described detection Chinese cabbage to be measured is CC genotype or the genotypic method of TC is following A) or B):
A) genomic dna of direct Sequencing Chinese cabbage;
B) pcr amplification product of order-checking containing the 9805885th deoxyribonucleotide on Chinese cabbage A09 karyomit(e);
Described pcr amplification product primer used is following 1) or 2):
1) the primer set A be made up of the single strand dna shown in sequence 4 in the single strand dna shown in sequence 3 in the single strand dna shown in sequence in sequence table 2, sequence table and sequence table;
2) the primer set B be made up of the single strand dna shown in the single strand dna shown in sequence A, sequence B and the single strand dna shown in sequence C;
Described sequence A for sequence 2 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 2;
Described sequence B for sequence 3 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 3;
Described sequence C for sequence 4 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 4.
3. the material detecting the deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th in qualification or assistant identification breeds of Chinese cabbage to be measured to the application in virus disease TuMV-C4 microspecies resistance;
Or the material of deoxyribonucleotide detecting on Chinese cabbage A09 karyomit(e) the 9805885th in characterization or assistant identification breeds of Chinese cabbage to be measured to the application in the product of virus disease TuMV-C4 microspecies resistance.
4. detect the application of material in Chinese cabbage breeding of the deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th;
Or detect the application of material in the product of preparation Chinese cabbage breeding of deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th.
5. detect the application of material in the Chinese cabbage of seed selection viral diseases TuMV-C4 microspecies of the deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th;
Or detect the application of material in the product of the Chinese cabbage of preparation seed selection viral diseases TuMV-C4 microspecies of deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th.
6. qualification or assistant identification breeds of Chinese cabbage to be measured are to a product for virus disease TuMV-C4 microspecies resistance, for detecting the material of deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th.
7., according to arbitrary described application or product according to claim 6 in claim 3-5, it is characterized in that:
The described material detecting the deoxyribonucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is following 1) or 2) or 3) or 4):
1) the primer set A be made up of the single strand dna shown in sequence 4 in the single strand dna shown in sequence 3 in the single strand dna shown in sequence in sequence table 2, sequence table and sequence table;
2) the primer set B be made up of the single strand dna shown in the single strand dna shown in sequence A, sequence B and the single strand dna shown in sequence C;
Described sequence A for sequence 2 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 2;
Described sequence B for sequence 3 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 3;
Described sequence C for sequence 4 being deleted or increasing or change one or several Nucleotide, and has the Nucleotide of identical function with sequence 4;
3) containing 1) described in primer set A or 2) described in the PCR reagent of primer set B;
4) containing 1) described in primer set A or 2) described in primer set B or 3) described in the test kit of PCR reagent.
8. a method for the breeds of Chinese cabbage of seed selection viral diseases TuMV-C4 microspecies, comprises and selects the genotypic breeds of Chinese cabbage of TC or the genotypic breeds of Chinese cabbage of CC to carry out breeding;
Described CC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the homozygote of C;
Described TC genotype is the Nucleotide of on Chinese cabbage A09 karyomit(e) the 9805885th is the heterozygote of C and T.
9. arbitrary described application or the product described in claim 6 or 7 or method according to claim 8 in method according to claim 1 and 2 or claim 3-5, is characterized in that: described Chinese cabbage is Chinese cabbage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025560.1A CN105506130B (en) | 2016-01-15 | 2016-01-15 | It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025560.1A CN105506130B (en) | 2016-01-15 | 2016-01-15 | It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105506130A true CN105506130A (en) | 2016-04-20 |
| CN105506130B CN105506130B (en) | 2019-03-08 |
Family
ID=55714420
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610025560.1A Active CN105506130B (en) | 2016-01-15 | 2016-01-15 | It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105506130B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070055889A (en) * | 2005-11-28 | 2007-05-31 | 주식회사 바이오브리딩연구소 | Scar marker related with tumv-c4 resistance |
| CN101392293A (en) * | 2008-09-25 | 2009-03-25 | 上海交通大学 | Molecular marker method of turnip mosaic virus resistance gene in non-heading Chinese cabbage |
| CN101838645A (en) * | 2010-05-24 | 2010-09-22 | 山东省农业科学院蔬菜研究所 | A pair of cabbage turnip mosaic virus EST-SSR markers and application thereof |
| KR101235862B1 (en) * | 2010-11-04 | 2013-02-20 | 주식회사 바이오브리딩연구소 | Ssr markers and primers related with tumv-c4 resistance gene in brassica rapa |
| CN103060338A (en) * | 2012-12-27 | 2013-04-24 | 中国农业科学院蔬菜花卉研究所 | TuMV resistance gene retr02 of Chinese cabbage and allele retr02 Retr02, and encoded protein and application thereof |
| CN103571832A (en) * | 2013-10-17 | 2014-02-12 | 山东省农业科学院蔬菜花卉研究所 | Molecular marker tightly interlocked with resistance gene TuRBCS01 of brassica rapa pekinensis TuMV |
-
2016
- 2016-01-15 CN CN201610025560.1A patent/CN105506130B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070055889A (en) * | 2005-11-28 | 2007-05-31 | 주식회사 바이오브리딩연구소 | Scar marker related with tumv-c4 resistance |
| CN101392293A (en) * | 2008-09-25 | 2009-03-25 | 上海交通大学 | Molecular marker method of turnip mosaic virus resistance gene in non-heading Chinese cabbage |
| CN101838645A (en) * | 2010-05-24 | 2010-09-22 | 山东省农业科学院蔬菜研究所 | A pair of cabbage turnip mosaic virus EST-SSR markers and application thereof |
| KR101235862B1 (en) * | 2010-11-04 | 2013-02-20 | 주식회사 바이오브리딩연구소 | Ssr markers and primers related with tumv-c4 resistance gene in brassica rapa |
| CN103060338A (en) * | 2012-12-27 | 2013-04-24 | 中国农业科学院蔬菜花卉研究所 | TuMV resistance gene retr02 of Chinese cabbage and allele retr02 Retr02, and encoded protein and application thereof |
| CN103571832A (en) * | 2013-10-17 | 2014-02-12 | 山东省农业科学院蔬菜花卉研究所 | Molecular marker tightly interlocked with resistance gene TuRBCS01 of brassica rapa pekinensis TuMV |
Non-Patent Citations (2)
| Title |
|---|
| LGC: "KASP genotyping technology", 《WWW.LGCGROUP.COM/GENOMICS》 * |
| 田希辉 等: "一个新的白菜苗期TuMV-C4抗性主效QTL定位及连锁分子标记开发", 《华北农学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105506130B (en) | 2019-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Uga et al. | Identification of qSOR1, a major rice QTL involved in soil-surface rooting in paddy fields | |
| Rao et al. | The use of biotechnology for conservation and utilization of plant genetic resources | |
| CN108588272B (en) | Molecular marker closely linked with main effect QT L of wheat plant height and ear length characters and application thereof | |
| CN106755480A (en) | A kind of SSR molecular marker I for identifying Gala apple Progeny plants and its application | |
| CN103789306B (en) | The SNP marker and its method of a kind of rice blast resistance gene Pia and application | |
| CN107217098A (en) | The KASP molecular labeling related to wheat anti growing out character and its application | |
| CN107868847B (en) | Molecular marker closely linked with melon yellow-green leaf color gene ygl | |
| CN104805080A (en) | Rapeseed pod number major QTL molecular marker and application thereof | |
| CN106434944A (en) | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica | |
| CN105331615A (en) | InDel molecular marker for identifying watermelon fusarium wilt and primer and application thereof | |
| CN106148510A (en) | Resistance gene of rice blast Pi5 specific Function molecular marker and application thereof | |
| Liao et al. | Aus rice root architecture variation contributing to grain yield under drought suggests a key role of nodal root diameter class | |
| CN106811462A (en) | Gray leaf spot gene Sm anti-with tomato chain Indel marks and its amplimer and application | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN105238866B (en) | One SNP site related to upland cotton Early mature apricot and its application | |
| CN110241245A (en) | Detect KASP primer and its application of cucumber bacterial angular leaf spot gene | |
| CN106498048A (en) | A kind of QTL related to soybean nodulation number, SNP marker and application | |
| CN104498484A (en) | Linked molecular marker for powdery mildew resistant gene pm1 of cucurbita pepo L. and application of linked molecular marker | |
| CN106086180A (en) | A kind of molecule labelling method of lodging resistance in rice main effect QTL qSR5.1 | |
| CN105063201A (en) | Molecular marker of corn chromosome 9 ear row number major QTL and application thereof | |
| CN105506130A (en) | Molecular marker for authenticating antiviral disease QTL_BrTuA09 on Chinese cabbage A09 chromosome and application of molecular marker | |
| CN105567790B (en) | The selection of the plant of DNA fragmentation containing target gene group | |
| CN113278723A (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN106399495A (en) | Soybean dwarf trait closely linked SNP marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |