CN106399495A - Soybean dwarf trait closely linked SNP marker and application thereof - Google Patents
Soybean dwarf trait closely linked SNP marker and application thereof Download PDFInfo
- Publication number
- CN106399495A CN106399495A CN201610810781.XA CN201610810781A CN106399495A CN 106399495 A CN106399495 A CN 106399495A CN 201610810781 A CN201610810781 A CN 201610810781A CN 106399495 A CN106399495 A CN 106399495A
- Authority
- CN
- China
- Prior art keywords
- snp marker
- soybean
- semen sojae
- sojae atricolor
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a soybean dwarf trait closely linked SNP marker, which comprises GM19_45000827 and GM19_45361938, wherein a basic group, in the No.19 chromosome 45000827 position of a soybean genome v1.0, of the GM19_45000827 is C or A; a basic group, in the No.19 chromosome 44902890 position of a soybean genome v1.0, of the GM19_45361938 is G or A; meanwhile, application and a method of the marker used for screening dwarf trait soybean materials are recorded. The soybean genotype is detected through a KASP SNP marking technology; dwarf soybean can be identified according to the genotype, so that a soybean dwarf strain breeding process can be accelerated; meanwhile, foundation is laid for a dwarf gene cloning and dwarf mechanism study by the two SNP markers.
Description
Technical field
The invention belongs to gene engineering technology field is and in particular to a kind of SNP marker of Semen sojae atricolor short bar character close linkage
And its application.
Background technology
The application of crop short bar character achieves the first time Green revolution, is first milestone of SOYBEAN IN HIGH-YIELD BREEDING.From
1967, after Semen sojae atricolor dwarf character is applied to breeding, constantly create in world wide high yield of soybean record (Cooper, 1981,
Cooper, 1991), therefore short bar character has become an important research content of soybean breeder.But in soybean breeder, though
So plant height is easy to identifying by naked eye, but because the factors such as water, fertilizer, planting density and period of duration impact ratio is more serious, especially
In breeding morning generation Single-plant selection, the identification of short bar character is not convenient and accurate.
With the development of biotechnology, molecular marking technique is applied to crop breeding, accelerates the efficiency of crop breeding.Point
Sub- labelling technique can be identified to the genotype of objective trait, is not subject to environment, and growthdevelopmental stage etc. is a lot of to be limited.The short bar of Semen sojae atricolor
Character belongs to simple qualitative genetics character, be by a pair or two to stealthy major gene resistance control (kilen, 1975；Boerma),
Have also controls (what is flat, Chen Henghe, W.R.Feh) with some modifying genes.Therefore, using the molecular marker of the short bar linkage of characters
The identification carrying out short bar character is feasible.
Currently, with respect to the Genes location research of Dwarfing gene, carry out more strain currently with short bar or semi-dwarf mutant material
High character QTL positioning.Statistics Semen sojae atricolor data base find, in A1, B1, C1, C2, D1a, D1b, E, F, G, H, I, J, L, M, N and O etc.
Article 16, about 31 QTL on chromosome, wherein at B1 (47Mb-72Mb), C2 (106Mb-131Mb), F (1Mb-22.5Mb,
60Mb-85Mb), J (11Mb-28Mb), L (8Mb-15Mb), 65Mb-93Mb), M (17Mb-41Mb) site, in different heredity groups
It was found that the QTL of general character in body.But the gene mapping research due to carrying out currently for short bar qualitative trait have not been reported,
Therefore, we to molecular genetic and the mechanism of the short bar of Semen sojae atricolor it is not understood that.
The identification technology of the short bar character of existing Semen sojae atricolor or method are in the soybean blossoming later stage, and plant height stabilizes, by naked eyes
Whether go to identify is short bar material；The identification time and growthdevelopmental stage is limited.Further, since plant height is subject to planting density, machinery
Damage, the impact of the environmental condition such as field precipitation, only one plant of investigation can not accurately judge high or short it is necessary to mass survey
Accurately；In short bar breeding, because short bar is that recessive gene controls, only accounts for 1/2 [1- (1/2) r] of segregating population, such as educating
Kind early carries out selection-breeding from generation to generation, show as in breeding population that short bar material is less, therefore, Breeding Scale ratio is larger, can sieve
Select excellent short bar breeding material, breeding high cost, breeding efficiency is low.
Content of the invention
In order to solve above-mentioned problems of the prior art, the invention provides a kind of Semen sojae atricolor short bar character close linkage
SNP marker, and its this labelling is used for screening application and the method for short bar character soybean material.
The present invention is achieved through the following technical solutions：
A kind of SNP marker of the short bar character close linkage of Semen sojae atricolor, according to embodiments of the invention, described SNP marker bag
Contain：First SNP marker GM19_45000827 and the second SNP marker GM19_45361938, described the first SNP marker GM19_
45000827 be soybean gene group v1.0 No. 19 chromosome 45000827 position base be C or A；The 2nd described SNP
Labelling GM19_45361938 is the base of No. 19 chromosome 44902890 position of soybean gene group v1.0 is G or A.
At GM19_45000827 of the present invention base be C Semen sojae atricolor be short bar, base be A Semen sojae atricolor be high bar；Institute
At the GM19_45361938 stating base be G Semen sojae atricolor be short bar, base be A Semen sojae atricolor be high bar.
Another object of the present invention, present invention also offers a kind of KASP for detecting foregoing SNP marker
Primer pair, specifically described primer pair include：
The forward primer 1 of GM19_45000827：ACATGCCTACCAACAAAAG, forward primer 2：
CGGTGTAGTTCGGGAAACAA, reverse primer：CGGTGTAGTTCGGGAAACAC；
The forward primer 1 of GM19_45361938：AGATTCCCAGGCGCAACTTG, forward primer 2：
AGATTCCCAGGCGCAACTTA, reverse primer：TTTGTAGCTTCTGTTTATAG.
SNP that can be effectively related to the above-mentioned of Semen sojae atricolor to be measured and Semen sojae atricolor short bar character using the primer pair of the present invention marks
The fragment that note is located enters performing PCR amplification, and then by detecting the fluorescence signal of PCR primer, determines this kind of SNP marker of Semen sojae atricolor to be measured
The genotype in site, and then can effectively predict Semen sojae atricolor to be measured short bar character.
Another object of the present invention, present invention also offers for the test kit detecting foregoing SNP marker, should
Test kit comprises the primer pair being described previously for the SNP marker detecting the present invention, and that is, test kit of the present invention comprises with SEQ
ID NO：The primer pair of the nucleotide sequence shown in 1-6.
Another object of the present invention, present invention also offers the SN P labelling of the foregoing present invention, primer pair or
Application in Semen sojae atricolor short bar trait molecular marker assistant breeding for the test kit.
Another object of the present invention, present invention also offers a kind of screening has the side of the soybean material of short bar character
Method, its step is as follows：
1) extract Soybean genomic DNA to be detected；
2) detect：With Soybean genomic DNA to be detected as template, carry out pcr amplification reaction using foregoing primer；
3) result judges：Endpoint analysis module detection PCR amplification using LightCycler 480 software (v1.5)
Product, shows according to signal and distinguishes genotype.Wherein, green signal is consistent with public transport 9112 genotype, is high bar genotype.Lan Xin
Number consistent with Jimidou 1 genotype, it is Dwarfing gene type；Red signal is heterozygous genotypes, and lower generation height bar separates；Pink colour and
Other does not know for genotype or sample disappearance.
Wherein, the detection short bar accuracy rate of the first labelling GM19_45000827 is 96.77%, the second labelling GM19_
45361938 detect that short bar accuracy rate is 93.48%.
Beneficial effects of the present invention：
1) simplify genome method Genes location to 2 and the most close SNP marker of the Semen sojae atricolor short bar linkage of characters, utilize this
Two SNP marker combine KASP round pcr, can identify dwarf character from genotype, can be in the different growth of Semen sojae atricolor
Phase, it is not subject to the restriction of the conditions such as environment, group size and growthdevelopmental stage, being capable of ripe soon, accurate, scale ground identification soybean plant strain
Short bar character.
2) in Semen sojae atricolor breeding of short stem, solve short bar character and only could investigate with single plant by ring in the later stage of blooming
Border affects the problem that character investigates inaccurate necessary mass survey；And in short bar breeding progeny material selective breeding, in seed stage
The material of the Dwarfing gene of recessive gene control just can be identified.
3) under reaching identical breeding effect, greatly reduce field breeding area, so reduce field test material and
Labour cost.
Brief description
Fig. 1 is 377 individual plant height distribution frequency curves in the application No. 1 × public transport of close bean 9112 combination F2 colony；
Fig. 2 is Δ (SNP_index) matched curve of the last SNP of 20 chromosomes of the application Semen sojae atricolor；
Fig. 3 is 11 SNP of the application in close No. 1 polymorphic detection result and between public transport 9112 of bean；Wherein, a is public transport
9112, b is Jimidou 1,1-12 GM19_44412186 respectively, GM19_44546232, GM19_44595030, GM19_
44622364, GM19_44779426, GM19_44815533, GM19_44902890, GM19_45000827, GM19_
45361938, GM19_45423153, GM19_4549471611 SNP primer；
Fig. 4 is 8 genetic linkage mapses stablized constructed by polymorphic association SNP marker；Dwarf is Dwarfing gene；
Fig. 5 is after embodiment of the present invention close linkage labelling GM19_45000827 hybridizes to Jimidou 1 and public transport 9112
Detection for KASP SNP PCR primer；
Fig. 6 is after embodiment of the present invention close linkage labelling GM19_45361938 hybridizes to Jimidou 1 and public transport 9112
Detection for KASP SNP PCR primer.
Specific embodiment
To describe presently filed embodiment in detail below in conjunction with drawings and Examples, thereby how the application to be applied
Technological means are solving technical problem and to reach realizing process and fully understanding and implement according to this of technology effect.
The acquisition of the SNP marker of embodiment 1 and Semen sojae atricolor short bar character close linkage
1st, Genes location short bar character
(1) 377 F being obtained using " Jimidou 1 " and " public transport 9112 " hybridization2Individual plant DNA and its F2:3Plant height shows
Carry out the Genes location of Semen sojae atricolor short bar character.
(2) investigate F2:3The plant height of each strain of genetical population, 55 row spacings, 15 centimetres of spacing in the rows, the cultivation of 2 two sowings
Under training density conditions, the definition more than 70 is non-short bar, and the definition less than or equal to 70 is short bar.Using X2Test Analysis F2:3Strain
It is plant height separates whether meet 3:1 (Fig. 1), if meet 3:1, then short bar character is Dominant gene, is considered as qualitative trait.
(3) CTAB method extracts its F2Individual plant DNA, sterilized water dissolving DNA, concentration is greater than 50ng/ul, OD260/280=1.8-
2.1；Detect DNA using 0.1% agarose gel, band is complete.
(4) select its F2:3The extremely high 40F of plant height performance2Individual plant and the extremely short 40F of plant height2Individual plant.Mixed in equal amounts 40
Individual F2Individual plant DNA, builds Dwarfing gene pond and non-Dwarfing gene pond respectively.
(5) simplify genome BSA method and build Jimidou 1, public transport 9112, Dwarfing gene pond and non-Dwarfing gene pond library
(Sun et al, 2013) is simultaneously sequenced.
(6) Δ (SNP_index) matched curve correlation fractal dimension positions short bar character (Hill, 2013), and determines Δ
(SNP_index) the regression threshold value is 0.8704.Interior in genomic region, there are 3 or more than three to be more than threshold value and continuous
The SNP of distribution, the region between such genomic region, as with short bar trait associations.Research finds such interval only one
Individual (Fig. 2), positioned at No. 19 chromosome 44372629bp-45495014bp positions of williams 82 soybean gene group (1.0 version)
Interval, interval physical distance is 1.12Mb.There are 18 SNP labels (table 1) being continuously more than threshold value in this region, and zone leveling is intended
Closing regressand value is 0.8796.
Table 1 18 SNP match values being continuously more than threshold value in short bar trait-associated regions
The SNP marker exploitation of the short bar linkage of characters of embodiment 2
(1) be directed to wherein equally distributed 12 labels (Marker1098514, Marker1168024,
Marker1143721, Marker1110430, Marker1120990, Marker1086045, Marker1118571,
Marker11080703, Marker1093726, Marker1102167, Marker1094495, Marker1061721) in 12
Individual SNP site (44412186,44546232,44595030,44622364,44779426,44815533,44902890,4,
5000827,45361938,45423153,45494716), 11 are designed and synthesized using KASP technology (LGC biotech firm)
SNP primer, concrete primer pair sequence is as follows：
GM19_44412186 primer pair sequence：
F1:TACTTTATTTCGTTAGGTCT
F2:TACTTTATTTCGTTAGGTCC
R:TTACCATAACATACAAAGAC
GM19_44546232 primer pair sequence:
F1:ATGGAAACAATTTAAATGA
F2:ATGGAAACAATTTAAATGT
R:ATTGTGACTAATTAATCGTA
GM19_44595030 primer pair sequence:
F1:TTTAACTCATTAAGGTTTAT
F2:TTTAACTCATTAAGGTTTAG
R:CATTAGCAAACAAAAAAGGA
GM19_44622364 primer pair sequence:
F1:TTCGCTAACTGCCTTGCCCG
F2:TTCGCTAACTGCCTTGCCCA
R:CTTTTCGGACACCCTCTTAG
GM19_44779426 primer pair sequence:
F1:TCTAGATTATTAGTATAAGT
F2:TCTAGATTATTAGTATAAGC
R:AGTGAGACCTTTAATTTACT
GM19_44815533 primer pair sequence:
F1:TCATGTGCGGTATACTTACT
F2:TCATGTGCGGTATACTTACC
R:ACCATTATC TATTCTAGGGA
GM19_44902890 primer pair sequence:
F1:TGGCAATCACTTGTTTTAAA
F2:TGGCAATCACTTGTTTTAAT
R:CGTTTGACACTTCAGATGTT
GM19_45000827 primer pair sequence:
F1:CGGTGTAGTTCGGGAAACAC
F2:CGGTGTAGTTCGGGAAACAA
R:ACATGCCTACCAACAAAAGA
GM19_45361938 primer pair sequence:
F1:AGATTCCCAGGCGCAACTTG
F2:AGATTCCCAGGCGCAACTTA
R:TTTGTAGCTTCTGTTTATAG
GM19_45422153 primer pair sequence:
F1:GTCTTGGTCCGCCTTCGTCC
F2:GTCTTGGTCCGCCTTCGTCT
R:CACAGGTAGCAGCTTAGCAA
GM19_45494716 primer pair sequence:
F1:ATTAGCCCTGGCTGAAGAAG
F2:ATTAGCCCTGGCTGAAGAAA
R:GCTCATGTTGGATGAGCTTT
(2) KASP SNP PCR amplification Parent, i.e. Jimidou 1 and public transport 9112, three repetitions of setting, by detection
Whether SNP has polymorphism in Jimidou 1 and public transport 9112, and to verify whether can be used as SNP marker.LightCycler
The Endpoint analysis module detection of 480 softwares (v1.5) finds, 8 SNP primers, i.e. GM19_44412186, GM19_
44546232, GM19_44595030, GM19_44779426, GM19_44902890, GM19_45000827, GM19_
45361938 and GM19_45494716 between Jimidou 1 and public transport 9112, and three are repeated fluorescence developing and are all as bluish-green difference
Different, that is, there is stable polymorphism (Fig. 3, wherein d represent green, and e represents blue, and c represents pink colour).Wherein, PCR reaction system
For 3ul：DNA 1.5ul (5-30ng/ul), 2 × KASP Master MIX buffer 1.5ul, KASP assay 0.05ul；
PCR reaction condition is：95 DEG C of denaturations 10 minutes；95 DEG C of degeneration 20 seconds, 65 DEG C of annealing extensions 1.00 (every cycle down 0.8 degree),
10 circulations；95 DEG C of degeneration 20 seconds, 65 DEG C of annealing extend 1 minute, 36 circulations；Finally cool to 10 DEG C.
(3) in 377 F of Jimidou 1 and public transport 9112 hybridization2In heredity individuality, SNP primer polymorphic to 8
(GM1944412186, GM1944546232, GM1944595030, GM1944779426, GM1944902890, GM19_
45000827th, GM19_45361938 and GM19_45494716) carry out KASP PCR amplification, obtain 377 F2Individuality is at 8
The genotype data of SNP site.
(4) 377 F are combined2:3Strain plant height phenotypic data, carries out linkage analysises with JoinMap 3.0 software, calculates weight
Group rate；And using Kosambi function, recombination fraction is changed into genetic distance, determine putting in order between labelling and gene, profit
Carry out the drafting (Fig. 4) of linkage map with MapChart 2.0.By Dwarfing gene navigate to SNP marker GM19_45000827 and
Between GM19_45361938 labelling, Dwarfing gene is respectively with the genetic distance of two close linkage labellings, between 2 SNP marker
Physical distance is about 361kb.
Apply example 3, using KASP SNP round pcr, genotype identification is carried out to Semen sojae atricolor short bar character
(1) extract the DNA of the soybean material for identification using CTAB method, aseptic water dissolution is simultaneously diluted to 5-30ng/ul,
React identification genotype for KASP PCR.
(2) KASP SNP PCR reaction system, reaction condition and Genotyping methods enter according to the condition in embodiment 2
OK.
(3) utilize the primer of 2 labellings (GM19_45000827 and GM19_45361938), to " Jimidou 1 " × " public affairs
272 filial generation F of friendship 9112 "4:5Strain identified, the Endpoint of LightCycler 480 software (v1.5) divides
Analysis module detection finds (Fig. 5, Fig. 6),
For labelling GM19_45000827, totally 115 green, 93 blue signals, 40 danger signals, 24
Pink colour signal or other；For GM19_45361938, totally 111 green, 92 blue signals, 48 danger signals, 21
Individual pink colour signal or other.Wherein, green signal, consistent with the high bar parent genotype of public transport 9112, it is high bar genotype (DWDW).
Blue signal, consistent with lucky close bean genotype, it is Dwarfing gene type (dwdw)；Red signal, heterozygous genotypes (DWdw)；Pink colour is believed
Number or other it is impossible to determine genotype or no signal (unknown or negtive).
(4) statistics short bar identification coincidence rate finds, for GM19_45000827,93 show the short of blue signals
Bar genotype (dwdw) individuality in 90 be short bar strain, short bar identifies that accuracy rate is 96.77%.For GM19_45361938
For, the Dwarfing gene type (d of 92 performance blue signalswdw) individuality in 86 be short bar strain, accuracy rate identified by short bar
93.48%.Therefore, by the Phenotype measurement result of plant height character and the statistical of KASP SNP genotyping result
Analysis is it was demonstrated that this 2 SNP marker can highly accurately to Semen sojae atricolor, short bar and high bar carry out good typing.
Described above illustrate and describes some preferred embodiments of invention, but as previously mentioned it should be understood that inventing not
It is confined to form disclosed herein, be not to be taken as the exclusion to other embodiment, and can be used for various other combinations, modification
And environment, and can be carried out by the technology or knowledge of above-mentioned teaching or association area in invention contemplated scope described herein
Change.And the change that those skilled in the art are carried out and change without departing from the spirit and scope of invention, then all should weighed appended by invention
In the protection domain that profit requires.
Claims (6)
1. a kind of SNP marker of the short bar character close linkage of Semen sojae atricolor is it is characterised in that described SNP marker comprises：First SNP
Labelling GM19_45000827 and the second SNP marker GM19_45361938, the first described SNP marker GM19_45000827 is
The base of No. 19 chromosome 45000827 position of soybean gene group v1.0 is C or A；The second described SNP marker GM19_
45361938 be soybean gene group v1.0 No. 19 chromosome 44902890 position base be G or A.
2. a kind of SNP marker of the short bar character close linkage of Semen sojae atricolor according to claim 1 is it is characterised in that described
At GM19_45000827 base be C Semen sojae atricolor be short bar, base be A Semen sojae atricolor be high bar；At described GM19_45361938
Base is the Semen sojae atricolor of G is short bar, and base is the Semen sojae atricolor of A is high bar.
3. a kind of require the KASP primer pair of SNP marker described in 1 it is characterised in that described KASP primer for test right
To inclusion：
The forward primer 1 of GM19_45000827：ACATGCCTACCAACAAAAG, forward primer 2：
CGGTGTAGTTCGGGAAACAA, reverse primer：CGGTGTAGTTCGGGAAACAC；
The forward primer 1 of GM19_45361938：AGATTCCCAGGCGCAACTTG, forward primer 2：
AGATTCCCAGGCGCAACTTA, reverse primer：TTTGTAGCTTCTGTTTATAG.
4. a kind of test kit for SNP marker described in test right requirement 1 is it is characterised in that described test kit comprises right
Require the primer pair described in 3.
5. the primer pair described in SNP marker, claim 3 described in claim 1 or test kit described in claim 4 are short in Semen sojae atricolor
Application in bar trait molecular marker assistant breeding.
6. a kind of screening has the method for the soybean material of short bar character it is characterised in that comprising the following steps：
1) extract Soybean genomic DNA to be detected；
2) detect：With Soybean genomic DNA to be detected as template, enter performing PCR amplification using KASP primer described in claim 3 anti-
Should；
3) the Endpoint analysis module utilizing LightCycler480 software (v1.5) detects pcr amplification product, according to fluorescence
Genotype is distinguished in signal performance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610810781.XA CN106399495B (en) | 2016-09-08 | 2016-09-08 | SNP marker closely linked with soybean short stalk character and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610810781.XA CN106399495B (en) | 2016-09-08 | 2016-09-08 | SNP marker closely linked with soybean short stalk character and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106399495A true CN106399495A (en) | 2017-02-15 |
| CN106399495B CN106399495B (en) | 2020-01-17 |
Family
ID=57998940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610810781.XA Expired - Fee Related CN106399495B (en) | 2016-09-08 | 2016-09-08 | SNP marker closely linked with soybean short stalk character and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399495B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439785A (en) * | 2018-11-07 | 2019-03-08 | 中国农业科学院油料作物研究所 | Molecular labeling ZMM5932 and its application with the short bar character major gene close linkage of sesame |
| CN117286287A (en) * | 2023-11-24 | 2023-12-26 | 南京农业大学三亚研究院 | KASP (KASP) marker of soybean shade-tolerance gene GmYUC2 and application thereof |
-
2016
- 2016-09-08 CN CN201610810781.XA patent/CN106399495B/en not_active Expired - Fee Related
Non-Patent Citations (7)
| Title |
|---|
| CHUNLIN HE: "《Methods in molecular biology》", 12 May 2014 * |
| JIAOPING ZHANG: "Genome-wide association study for flowering time, maturity dates and plant height in early maturing soybean (Glycine max) germplasm", 《BMC GENOMICS》 * |
| KASSA SEMAGN: "Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement", 《 MOL BREEDING 》 * |
| QIJIAN SONG: "Fingerprinting Soybean Germplasm and Its Utility in Genomic Research", 《GENES GENOMES GENETICS》 * |
| RODRIGO IVAÂN CONTRERAS-SOTO: "A Genome-Wide Association Study for Agronomic Traits in Soybean Using SNP Markers and SNP-Based Haplotype Analysis", 《PLOS ONE》 * |
| T. D. VUONG: "Genetic architecture of cyst nematode resistance revealed by genome-wide association study in soybean", 《BMC GENOMICS》 * |
| 赵勇: "大豆SNP分型方法的比较", 《分子植物育种》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439785A (en) * | 2018-11-07 | 2019-03-08 | 中国农业科学院油料作物研究所 | Molecular labeling ZMM5932 and its application with the short bar character major gene close linkage of sesame |
| CN109439785B (en) * | 2018-11-07 | 2021-07-13 | 中国农业科学院油料作物研究所 | Molecular marker ZMM5932 closely linked with main gene locus of sesame dwarf trait and application thereof |
| CN117286287A (en) * | 2023-11-24 | 2023-12-26 | 南京农业大学三亚研究院 | KASP (KASP) marker of soybean shade-tolerance gene GmYUC2 and application thereof |
| CN117286287B (en) * | 2023-11-24 | 2024-03-01 | 南京农业大学三亚研究院 | KASP (KASP) marker of soybean shade-tolerance gene GmYUC2 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106399495B (en) | 2020-01-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110106278B (en) | Molecular marker closely linked with corn hundred-grain weight and grain length characters and application | |
| CN113774161B (en) | KASP molecular marker of peanut pod and kernel size major QTL and application thereof | |
| CN106520762B (en) | Molecular labeling and application with the anti-anthrax-bacilus leaf blight gene loci close linkage of apple | |
| CN106480228A (en) | The SNP marker of paddy rice low cadmium-accumulation gene OsHMA3 and its application | |
| CN108588272A (en) | A kind of molecular labeling and its application with Plant Height in Wheat and spike length character main effect QTL compact linkage | |
| CN110684858A (en) | Molecular marker of rice long and thin grain type gene and application thereof | |
| CN109924121A (en) | A method of improvement Rice Resistance To Rice Blast | |
| CN109924120A (en) | A method of improvement Rice Resistance To Rice Blast and bacterial leaf spot resistance | |
| CN114540536B (en) | QTL (quantitative trait locus) related to low temperature resistance of soybean in sprout period, molecular marker, amplification primer and application | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| CN112961931B (en) | Rapid identification method for purity of Yongtian No.5 melon seeds | |
| CN107254535B (en) | SNP molecular marker related to salt tolerance of corn and application thereof | |
| CN106399495A (en) | Soybean dwarf trait closely linked SNP marker and application thereof | |
| CN109811077B (en) | KASP marker closely linked with wheat dwarf gene and application thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| Lan et al. | Application of molecular marker assisted selection in gene pyramiding and selection of new cultivars | |
| CN111118192B (en) | KASP molecular marker of wheat ear base small ear fruition main effect QTL and application thereof | |
| CN109576387B (en) | SNP molecular marker of fiber length major gene derived from Xinluzao 24 and Lumian 28 | |
| CN108060247B (en) | Haplotype related to upland cotton No. 8 chromosome fiber strength | |
| CN111549172A (en) | Watermelon leaf posterior green gene linkage site and CAPS marker | |
| CN112889664A (en) | Method for cultivating broad-spectrum and durable resistant rice breeding material by polymerizing complementary rice blast resistant genes | |
| CN111944920A (en) | InDel marker closely linked with melon epidemic disease resistance gene and application thereof | |
| CN109777885B (en) | Rice hard-stalk high-yield gene molecular marker and application thereof | |
| CN114410623B (en) | SNP molecular marker and application thereof in detection of brown planthopper resistant gene Bph44 (t) of rice | |
| CN114438242B (en) | SNP marker for identifying brown planthopper resistant gene Bph43 of rice and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200117 Termination date: 20210908 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |