CN105506130B - It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application - Google Patents
It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application Download PDFInfo
- Publication number
- CN105506130B CN105506130B CN201610025560.1A CN201610025560A CN105506130B CN 105506130 B CN105506130 B CN 105506130B CN 201610025560 A CN201610025560 A CN 201610025560A CN 105506130 B CN105506130 B CN 105506130B
- Authority
- CN
- China
- Prior art keywords
- chinese cabbage
- genotype
- sequence
- chromosome
- tumv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SNP markers and its application identifying Chinese cabbage virosis TuMV-C4 microspecies resistance, being positioned at A09 chromosome.Single strand dna shown in single strand dna shown in the SNP marker of the invention single strand dna shown in sequence 2, sequence 3 and sequence 4 forms.Shown by the BC1 group formed to 92 single plants to the verification result of molecular labeling: the selection accuracy rate of the SNP marker can be used for molecular mark, and have laid a good foundation 85% or more for further positioning and clone gene.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of viral diseases QTL-identified on Chinese cabbage A09 chromosome
The molecular labeling of BrTuA09 and its application can be used for the Resistance Identification of virosis TuMV-C4 microspecies.
Background technique
Chinese cabbage (Brassica rapa L.ssp.Pekinensis) is important one of the industrial crops in China, virosis
The yield and quality of Chinese cabbage is seriously threatened, 5%~10% production loss can be caused every year on average, popular time disease incidence can
Up to 80%, or even total crop failure.It there is no effective agent and control technology at present, cultivating disease-resistant variety becomes most effective control measure.
With the continuous development of molecular biology and bioinformatics, excavate with the resistance main effect QTL that separates separate sources, and by point
Sub- design and context carries out high-efficiency polymerization, and breeding stabilization, permanent disease-resistant kind become and guarantee having for Chinese cabbage safety non-pollution production
One of effect approach.
Virosis endangers seriously a variety of Brassica Crops, excavates the molecular labeling chain with resistant gene or QTL and is adding
It is particularly important in terms of fast molecular mark.Two QTL are navigated to by material of DH group in external Rusholme, are located at
The TuRB01b of A6 linkage group and retr01 positioned at R4 linkage group；Rnt1 is located in A6 linkage group by Fujiwara (2011)；
Recent Jin (2014) located the QTL-TuRB07 of an anti-TuMV-C4 in A6 linkage group, and obtain candidate gene.It is domestic
Qu Shuping (2008) detects the QTL site of 4 anti-TuMV-C3 on Chinese cabbage；Korea Spro peace (2004) have found one with
The relevant dominant marker of TuMV-C5 resistance；Zhang Junhua etc. (2008) reports the QTL of 4 anti-TuMV-C3；Zhang Xiaowei etc.
(2009) QTL site of 3 anti-TuMV-C4 is found；Zhang (2008) includes 376 molecular labelings at one by research
On genetic map, it was found that 4 QTLs relevant to the anti-TuMV-C4 of Chinese cabbage.
Research shows that molecular labeling is screened in target resource, positioning regulate and control the gene of specific economical character, gene pyramiding and
Cultivar identification etc. using more and more extensive.SNP belongs to molecular labeling of new generation, and, detection high with abundance is easily realized certainly
The features such as dynamicization.SNPline Genotyping detection based on KASP (competitive ApoE gene) is Britain LGC
The high-throughput SNP typing method of (Laboratory of the Government Chemist) Co., Ltd exploitation, has
Accurately, feature flexibly, inexpensive, high-throughput.The core of the program is KASP technology, i.e. Competitive Allele-
Specific PCR.This technology is the special matching based on prime end base come to SNP parting and detection InDels
(Insertions and Deletions, insertion and missing), have become at present snp analysis in the world main stream approach it
One.
Summary of the invention
The first purpose of the invention is to provide a kind of identifications or auxiliary to identify breeds of Chinese cabbage to be measured to virosis TuMV-
The method of C4 microspecies resistance.
Identification provided by the invention or auxiliary identify that breeds of Chinese cabbage to be measured is to the method for virosis TuMV-C4 microspecies resistance
The genotype for detecting Chinese cabbage to be measured is CC genotype or TT genotype or TC genotype, and the genotype according to the Chinese cabbage is true
Resistance of the fixed breeds of Chinese cabbage to virosis TuMV-C4 microspecies: the breeds of Chinese cabbage of TT genotype is to virosis TuMV-C4 microspecies
Resistance be susceptible, the resistance of the breeds of Chinese cabbage of the breeds of Chinese cabbage of TC genotype and CC genotype to virosis TuMV-C4 microspecies
It is disease-resistant；
The CC genotype is the homozygote that the 9805885th on Chinese cabbage A09 chromosome nucleotide is C；
The TT genotype is the homozygote that the 9805885th on Chinese cabbage A09 chromosome nucleotide is T；
The TC genotype is that the 9805885th on Chinese cabbage A09 chromosome nucleotide is C and the heterozygote of T.
In the above method, the genotype of detection Chinese cabbage to be measured is that the method for CC genotype or TC genotype is as follows
A) or B):
A) the genomic DNA of direct Sequencing Chinese cabbage；
B the pcr amplification product containing the 9805885th deoxyribonucleotide on Chinese cabbage A09 chromosome) is sequenced；
Primer used in the pcr amplification product be it is following 1) or 2):
1) single strand dna as shown in sequence 2 in sequence table, single strand dna shown in sequence 3 and sequence in sequence table
The primer set A that single strand dna shown in sequence 4 forms in list；
2) single strand dna as shown in sequence A, single stranded DNA shown in single strand dna and sequence C shown in sequence B
The primer set B of molecular composition；
The sequence A is sequence 2 to be deleted to or increase or change one or several nucleotide, and have with sequence 2 identical
The nucleotide of function；
The sequence B is sequence 3 to be deleted to or increase or change one or several nucleotide, and have with sequence 3 identical
The nucleotide of function；
The sequence C is sequence 4 to be deleted to or increase or change one or several nucleotide, and have with sequence 4 identical
The nucleotide of function.
In the above method, resistance of breeds of Chinese cabbage of the disease index within the scope of 0-33.33 to virosis TuMV-C4 microspecies
It is disease-resistant；Breeds of Chinese cabbage of the disease index within the scope of 33.34-100 is susceptible to the resistance of virosis TuMV-C4 microspecies.
A second object of the present invention is to provide the 9805885th on detection Chinese cabbage A09 chromosome dezyribonucleosides
The new application of the substance of acid.
The present invention provides the substances of the 9805885th deoxyribonucleotide on detection Chinese cabbage A09 chromosome to reflect
Fixed or auxiliary identifies breeds of Chinese cabbage to be measured to the application in virosis TuMV-C4 microspecies resistance.
The present invention also provides the substances of the 9805885th deoxyribonucleotide on detection Chinese cabbage A09 chromosome to exist
Preparation identification or auxiliary identify breeds of Chinese cabbage to be measured to the application in the product of virosis TuMV-C4 microspecies resistance.
The present invention also provides the substances of the 9805885th deoxyribonucleotide on detection Chinese cabbage A09 chromosome to exist
Application in Chinese cabbage breeding.
The present invention also provides the substances of the 9805885th deoxyribonucleotide on detection Chinese cabbage A09 chromosome to exist
Prepare the application in the product of Chinese cabbage breeding.
The present invention also provides the substances of the 9805885th deoxyribonucleotide on detection Chinese cabbage A09 chromosome to exist
Application in the Chinese cabbage of breeding viral diseases TuMV-C4 microspecies.
The present invention also provides the substances of the 9805885th deoxyribonucleotide on detection Chinese cabbage A09 chromosome to exist
Prepare the application in the product of the Chinese cabbage of breeding viral diseases TuMV-C4 microspecies.
Third object of the present invention is to provide a kind of identifications or auxiliary to identify breeds of Chinese cabbage to be measured to virosis TuMV-C4
The product of microspecies resistance.
It is provided by the invention to identify or assist to identify that breeds of Chinese cabbage to be measured is to the product of virosis TuMV-C4 microspecies resistance
Detect the substance of the 9805885th deoxyribonucleotide on Chinese cabbage A09 chromosome.
In above-mentioned application or the said goods,
On the detection Chinese cabbage A09 chromosome substance of the 9805885th deoxyribonucleotide be it is following 1) or 2)
Or 3) or 4):
1) single strand dna as shown in sequence 2 in sequence table, single strand dna shown in sequence 3 and sequence in sequence table
The primer set A that single strand dna shown in sequence 4 forms in list；
2) single strand dna as shown in sequence A, single stranded DNA shown in single strand dna and sequence C shown in sequence B
The primer set B of molecular composition；
The sequence A is sequence 2 to be deleted to or increase or change one or several nucleotide, and have with sequence 2 identical
The nucleotide of function；
The sequence B is sequence 3 to be deleted to or increase or change one or several nucleotide, and have with sequence 3 identical
The nucleotide of function；
The sequence C is sequence 4 to be deleted to or increase or change one or several nucleotide, and have with sequence 4 identical
The nucleotide of function；
3) contain 1) described in primer set A or 2) described in primer set B PCR reagent；
4) contain 1) described in primer set A or 2) described in primer set B or 3) described in PCR reagent kit.
Fourth object of the present invention is to provide a kind of method of the breeds of Chinese cabbage of breeding viral diseases TuMV-C4 microspecies.
The method of the breeds of Chinese cabbage of breeding viral diseases TuMV-C4 microspecies provided by the invention includes selection TC genotype
The breeds of Chinese cabbage of breeds of Chinese cabbage or CC genotype carries out breeding；
The TT genotype is the homozygote that the 9805885th on Chinese cabbage A09 chromosome nucleotide is T；
The TC genotype is that the 9805885th on Chinese cabbage A09 chromosome nucleotide is C and the heterozygote of T.
In the above method or above-mentioned application or the said goods, the Chinese cabbage is with the white of viral diseases QTL-BrTuA09
Dish；The Chinese cabbage with viral diseases QTL-BrTuA09 is the Chinese cabbage with viral diseases QTL-BrTuA09.
For the present invention according to parents' genome weight sequencing information, the section where target QTL-BrTuA09 further develops 1
A SNP marker with virosis resistance close linkage, the molecular labeling can be used for the virosis TuMV-C4 microspecies to breeds of Chinese cabbage
Resistance Identification.Shown by the verifying of BC1 group that 92 single plants form: the selection accuracy rate of the label 93% with
On, it can be used for molecular mark, and have laid a good foundation for further positioning and clone gene.
Detailed description of the invention
Fig. 1 is that the BC1 group verifying parting effect that Tu-A099805885 T/C forms 92 single plants is as shown in Figure 1.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
0.05M (PH=7.0) phosphoric acid buffer liquid in following embodiments: measure 61.0mL's respectively
0.2mol/L Na2HPO4The 0.2mol/L NaH of mother liquor and 39.0mL2PO4Mother liquor is settled to 200mL, as 0.05M after mixing
(PH=7.0) phosphate buffer.Wherein, 0.2mol/L Na2HPO4The preparation method of mother liquor: Na2HPO4·2H2O 35.61g、
Na2HPO4·7H2O 53.65g or Na2HPO4·12H2O 71.64g, is dissolved with distilled water and is settled to 1000mL；0.2mol/L
NaH2PO4The preparation method of mother liquor: NaH2PO4·H2O 27.6g or NaH2PO4·2H2O 31.2g, with distilled water dissolution and constant volume
To 1000mL.
Male parent 91-112 in following embodiments is the Chinese cabbage height in 9 generations of continuous selfing for self-mating system, highly resistance TuMV-C4；
Maternal T12-19 is dihaploid strain, height sense TuMV-C4.Male parent 91-112 and female parent T12-19 are in document " Genetic
mapping and localization of a major QTL for seedling resistance to downy
Mildew in Chinese cabbage (Brassica rapa ssp.pekinensis, Mol Breeding (2009) 23:
573-590 " it is disclosed in, the public can obtain from Beijing agricultural and forest science institute Vegetable Research center.
Virosis TuMV-C4 microspecies in following embodiments are in document " Tian Xihui etc., a new Chinese Cabbage Seedling TuMV-
The positioning of C4 resistance main effect QTL and linkage molecule marker development, " North China Agricultural Journal ", 2014 (06): being disclosed in 1-5 ", Gong Zhongke
It is obtained from Beijing agricultural and forest science institute Vegetable Research center.
The acquisition of embodiment 1, molecular labeling
The DH group formed using 100 strains from T12-19 × 91-112 has carried out molecule something lost as mapping population
The building research of blit spectrum.A QTL site QTL-BrTuA09, LOD value 18.6, additive effect are finally detected on A09
It is 16.2%, for interpretable phenotypic variation up to 62.0%, which is a newfound main effect QTL site.The studies above knot
Fruit is referring to document " Tian Xihui etc., a new Chinese Cabbage Seedling TuMV-C4 resistance main effect QTL positioning and linkage molecule marker development
" North China Agricultural Journal ", 2014 (06): 1-5 ".
QTL site QTL-BrTuA09 is located between flag F ito518 and label MR172, using weight sequencing information in the area
Between further screen and design SNP marker, be finally obtained 1 polymorphism SNP marker, be named as Tu-A099805885 T/C.
Tu-A099805885 T/C is marked by upstream primer A099805885-FF, upstream primer A099805885-FV and downstream primer
A099805885-R composition.A099805885-FF, A099805885-FV and A099805885-R primer entrust Britain LGC
(Laboratory of the Government Chemist, government chemist laboratory) Co., Ltd obtains, primer sequence
It is as follows:
Upstream primer A099805885-FF:GAAGGTGACCAAGTTCATGCTTCTCTGGTGAACTACAGTTCC CTTCc
(sequence 2)；
Upstream primer A099805885-FV:GAAGGTCGGAGTCAACGGATTTCTCTGGTGAACTACAGTTCC CTTCt
(sequence 3)；
Downstream primer A099805885-R:CAAACCACTCCCGAATAGATACAGG (sequence 4).
The 300th namely Chinese cabbage (Brassica of above-mentioned upstream primer last bit base c/t corresponding sequence 1
Rapa pekinensis) the 9805885th SNP site on A09 chromosome.Chinese cabbage Brassica rapa
The version number of the reference whole genome sequence of pekinensis is V1.5 (download address http://brassicadb.org/
brad)。
Embodiment 2, molecular labeling answering in the viral diseases TuMV-C4 microspecies resistance on identification Chinese cabbage A09 chromosome
With
One, the Resistance Identification of TuMV-C4 microspecies
1、BC1The acquisition of group
It is that female parent hybridizes by male parent, Susceptible parent T12-19 of disease-resistant parent 91-112, obtains first-filial generation (F1
Generation), then by F1In generation, is once returned with maternal T12-19, obtains the BC of 92 single plants composition1Group.
2, inoculation and Disease investigation and grade scale
To step 1 obtain 92 BC1 single plants, disease-resistant parent 91-112, Susceptible parent T12-19 and first-filial generation F1 into
Row virus inoculation disease TuMV-C4 microspecies identify the virosis TuMV-C4 microspecies resistance of 92 BC1 single plants.Specific step is as follows:
By 92 BC1 single plants, the seed of disease-resistant parent 91-112, Susceptible parent T12-19 and first-filial generation F1, after vernalization
It is seeded in 8cm nutritive cube, soil and turf used are to be mixed to get after autoclave sterilization in 1:1 ratio.Wait test
The seedling third piece true leaf of material carries out artificial infection after being sufficiently spread out.When inoculation, 300~400 first are sprayed on identified material
Then purpose quartz sand dips the sick juice of virosis TuMV-C4 microspecies respectively to two panels true leaf frictional inoculation, inoculation with finger
Blade is rinsed well with distilled water immediately afterwards, shading culture 24 hours.Third day after first time is inoculated with repeats inoculation
Once, day temperature control is at 25 DEG C~28 DEG C, 20 DEG C~22 DEG C of nocturnal temperature, after cultivating 25~28 days in the greenhouse, carries out
TuMV Resistance Identification.28 days after inoculation, the degree of disease of each young plant is investigated, records sick grade, then be converted into disease index,
Finally carry out Analysis of Resistance.The grade scale of sick grade is to be divided into 0,1,3,5,7,9 grade by the weight of Disease symptoms.Disease index=
∑ (typical value of sick grade × disease morbidity strain number)/investigation total strain number × 9 (the other highest typical value of partition level) × 100.Disease
BC1 single plant of the feelings index within the scope of 0-33.33 is disease-resistant to the resistance of virosis TuMV-C4 microspecies；Disease index exists
BC1 single plant within the scope of 33.34-100 is susceptible to the resistance of virosis TuMV-C4 microspecies.
The grade scale of sick grade is as follows:
0 grade: without any symptom；
1 grade: a small number of blades have chlorisis spot, or the slight floral leaf of a small number of blades；
3 grades: most blades to complete stool show light floral leaf, or a small number of blades have erosion line spot；
5 grades: complete stool weight floral leaf, the obvious short and small or petiole local necrosis of plant type, a small number of leaf malformations；
7 grades: the serious floral leaf of complete stool, with withered spot, partial blade is withered: or complete stool leaf-shrinkage deformity, plant are downgraded；
9 grades: most of blade is withered so that whole strain is dead.
Disease resistance evaluation standard is as follows:
Immune I: disease index=0；
Highly resistance HR: disease index 0.01~11.11；
Disease-resistant R: disease index 11.12~33.33；
Resistance to disease T: disease index 33.34~55.55；
Susceptible S: disease index 55.56~77.77；
Height sense HS: disease index 77.78~100.
Phenotypic examination the result shows that: in 92 BC1 single plants, 44 BC1 single plants, parent 91-112 and first-filial generation F1 reflect
It is set to disease-resistant, 48 BC1 single plants and parent T12-19 are accredited as susceptible.
Two, the association analysis of genotype and viral diseases TuMV-C4 microspecies resistance
1, the extraction of genomic DNA
The base of the 92 BC1 single plants, disease-resistant parent 91-112 and Susceptible parent T12-19 that are obtained in extraction step one respectively
Because of a group DNA, the method that conventional CTAB method or fast high-flux extract plant genome DNA is can be used in extracting method.The present invention adopts
Genomic DNA is extracted with conventional CTAB method.Specific step is as follows:
The leaf sample of each sample is fitted into 2mL centrifuge tube, number is write clearly after the steel ball of 1 0.4mm is added, is put into
5-10min is freezed in liquid nitrogen, is reused tissue grinder and is smashed.The CTAB buffer of 65 DEG C of 800 μ L preheatings is added in every pipe, fast
Speed oscillation mixes, and is put into 65 DEG C of water-bath water-bath 30min, is during which at least mixed by inversion primary.800 μ L are added into centrifuge tube again
Chloroform/isoamyl alcohol (chloroform: isoamyl alcohol 24:1), oscillation mix, and after static 5min, 12000r/min is centrifuged 10min.Inhale 600 μ
L supernatant is transferred in another 2mL centrifuge tube, and the isopropanol of isometric -20 DEG C of pre-coolings is added, and gentle inversion mixes, and is put in -20
The cooling 20min of DEG C refrigerator, then 10000r/min is centrifuged 5min, abandons supernatant.With 800 μ L, 75% ethyl alcohol rinse 2 times, every time
10000r/min is centrifuged 5min, abandons supernatant collection precipitating, and finally drying precipitates at room temperature, and 50 μ L ddH are added2O dissolving DNA.
It is examined by the quality of 1% agarose electrophoresis and the Nanodrop2100 genomic DNA obtained respectively to extraction
It surveys, qualified DNA requirement: agarose electrophoresis shows that DNA band is single, without obvious disperse；Nanodrop2100 detects A260/
280 between 1.8-2.0 (DNA sample does not have protein contamination)；A260/230 (DNA sample salt ion between 1.8-2.0
Concentration is low)；270nm does not have apparent light absorption (DNA sample does not have phenol pollution).Skill is detected according to the KASP of LGC company, Britain
It is the every sample of 4~10ng/ that art and Chinese cabbage Genome Size, which converse DNA dosage, and dilution DNA concentration becomes 4~10ng/ μ l, standby
With.
2, the preparation of primer premixed liquid
By upstream primer A099805885-FF, upstream primer A099805885-FV and the downstream primer in embodiment 1
A099805885-R is diluted to 10 μm of ol, and mixes according to the ratio that volume ratio is 6:6:15, obtains primer premixed liquid.
3, Genotyping
Based on the SNP site (on A09 chromosome the 9805885th) in embodiment 1 using KASP technology in step 1
92 BC1 single plants, male parent 91-112 and female parent T12-19 carry out SNP Genotyping, and SNP genotyping process is according to LGC company
The experiment flow of the KASP technology of offer carries out, and reagent used below, consumptive material and instrument do not have the public by LGC of specified otherwise
Department provides, including reagent dosage, usage and entire experimental procedure according to the operating guidance KASP user guide of LGC company
And manual (www.lgcgenomics.com) is carried out, and is reacted in 384 orifice plates (Part No.KBS-0750-001) or 1536
It is carried out in microwell plate (Part No.KBS-0751-001), reaction system is 3ul or 1ul.Specific step is as follows:
DNA profiling to be measured (4~10ng/ μ l) 1.5ul for having diluted step 1 first with K-pette liquid separation work station
It is separately added into 384 holes or 1536 hole reaction plates with blank control (No template control, NTC), 60 DEG C of drying
30min (drying box, LGC company), it is spare that DNA becomes dry powder.Then it is loaded under Kraken operating system using Meridian
Work station respectively into each reacting hole be added 1 × Master mix (384 orifice plate article No. Part No.KBS-1016-002 or
1536 microwell plate article No. Part No.KBS-1016-011) and primer mixed liquor, Mix packing, which finishes, immediately successively puts microwell plate
Instrument and Fusion laser sealer instrument upper sealing film are sealed in Kube, carries out high-throughput water-bath PCR amplification using Hydrocyler.Reaction
System is as shown in table 1.
The reaction system of table 1,384 orifice plates or 1536 orifice plates
Note: Meridian often adds the reaction solution that 230 μ l need to be lost when 1 pair of primer, i.e. 2x during liquid separation for exhaust bubble
Master mix and ddH2Each 115 μ l of O.
PCR reaction is carried out in high-throughput water-bath system Hydrocycler, specific procedure be 94 DEG C of initial denaturations, 15 minutes；
94 DEG C, 20 seconds -55 DEG C of (denaturation) -61 DEG C, (renaturation & extends: expanding 10 circulations with touch down program, often follows within 1 minute
Ring reduces by 0.6 DEG C)；94 DEG C, 20 seconds (denaturation) -55 DEG C continue 26 circulations of amplification for 60 seconds.After amplification, BMG is utilized
PHERAstar instrument detection fluorescence signal simultaneously checks parting situation.If parting is insufficient, continue to expand, every 3 circulations are checked
Parting situation exports experimental result from Kraken software until parting is complete.
Tu-A099805885 T/C is to the parting effect picture of 92 parts of BC1 single plants as shown in Figure 1, each dot represents in figure
A detected materials, wherein red spots indicate that the site is homozygous genotype " TT "；Blue dot indicates that the site is homozygous
Genotype " CC "；Green dot indicates that the site is heterozygous genotypes " TC "；Black dot indicates that NTC, as water are compareed.Wherein
Genotype of the resistance parent 91-112 in the site is CC genotype, and genotype of the Susceptible parent T12-19 in the site is TT base
Because of type.In 92 BC1 single plants, 41 BC1 single plants are accredited as TC genotype, and 50 BC1 single plants are accredited as TT genotype, 1 BC1
Single plant fails parting.Parting success rate is 99%, illustrates that Tu-A099805885 T/C parting works well, Tu-A099805885
It is homozygosis CC genotype, homozygosis TT genotype or heterozygosis TC genotype that T/C label, which can specifically distinguish the site,.
4, the association analysis of genotype and induction reactance disease
The results are shown in Table 2 for the association analysis of 92 BC1 single plant genotype and induction reactance disease: phenotype is 44 disease-resistant single plants
In, identify that genotype there are 41 plants for TC, genotype there are 3 plants for CC's, so selecting accuracy rate for 93%；Phenotype is susceptible
In 48 single plants, identify that genotype there are 46 plants for TT, genotype has 1 plant for TC's, and do not obtain genotype has 1 plant, so
Select accuracy rate for 95.8%；Therefore the synthesis accuracy rate that the label selects is 94.6%.
The association analysis result of table 2, genotype and induction reactance disease
In conclusion can determine Chinese cabbage to be measured by determining the 9805885th on Chinese cabbage A09 chromosome nucleotide
For CC genotype or TT genotype or TC genotype, to assist identifying that breeds of Chinese cabbage to be measured is small to virosis TuMV-C4
Kind of resistance: the breeds of Chinese cabbage of TT genotype be to the resistance of virosis TuMV-C4 microspecies it is susceptible, the breeds of Chinese cabbage of TC genotype and
The breeds of Chinese cabbage of CC genotype is disease-resistant to the resistance of virosis TuMV-C4 microspecies；
CC genotype is the homozygote that the 9805885th on Chinese cabbage A09 chromosome nucleotide is C；
TT genotype is the homozygote that the 9805885th on Chinese cabbage A09 chromosome nucleotide is T；
TC genotype is that the 9805885th on Chinese cabbage A09 chromosome nucleotide is T and the heterozygote of C.
Claims (5)
1. a kind of identification or auxiliary identify that Chinese cabbage cultivar to be measured is that detection is to be measured to the method for TuMV-C4 virus microspecies resistance
The genotype of Chinese cabbage is CC genotype or TT genotype or TC genotype, determines institute according to the genotype of the Chinese cabbage
Chinese cabbage cultivar is stated to the resistance of TuMV-C4 virus microspecies: the Chinese cabbage cultivar of TT genotype resists TuMV-C4 virus microspecies
Property to be susceptible, the Chinese cabbage cultivar of TC genotype and the Chinese cabbage cultivar of CC genotype are to the resistance of TuMV-C4 virus microspecies
It is disease-resistant；
The CC genotype is the homozygote that the 9805886th on Chinese cabbage A09 chromosome nucleotide is C；
The TT genotype is the homozygote that the 9805886th on Chinese cabbage A09 chromosome nucleotide is T；
The TC genotype is that the 9805886th on Chinese cabbage A09 chromosome nucleotide is C and the heterozygote of T；
On the A09 chromosome the 9805886th nucleotidyl in Chinese cabbage Brassica rapa pekinensis
Version number with reference to whole genome sequence is V1.5, and download address is http://brassicadb.org/brad.
2. according to the method described in claim 1, it is characterized by: the genotype of the detection Chinese cabbage to be measured is CC genotype
Or the method for TT genotype or TC genotype is following A) or B):
A) the genomic DNA of direct Sequencing Chinese cabbage；
B the pcr amplification product containing the 9805886th deoxyribonucleotide on Chinese cabbage A09 chromosome) is sequenced；
Primer used in the pcr amplification product is the single strand dna as shown in sequence 2 in sequence table, sequence 3 in sequence table
Shown in single strand dna and sequence table single strand dna composition shown in sequence 4 primer set A.
3. detecting the application of the substance of the 9805886th deoxyribonucleotide on Chinese cabbage A09 chromosome, feature exists
In:
On the A09 chromosome the 9805886th deoxyribonucleotide based on Chinese cabbage Brassica rapa
The version number of the reference whole genome sequence of pekinensis is V1.5, and download address ishttp://brassicadb.org/ brad；
The substance be it is following 1) or 2) or 3):
1) single strand dna as shown in sequence 2 in sequence table, single strand dna shown in sequence 3 and sequence table in sequence table
The primer set A of the composition of single strand dna shown in middle sequence 4；
2) contain 1) described in primer set A PCR reagent；
3) contain 1) described in primer set A or 2) described in PCR reagent kit；
The application is any one in following a)-f):
A) it is identifying or is assisting to identify Chinese cabbage cultivar to be measured to the application in TuMV-C4 virus microspecies resistance；
B) application in product of the Chinese cabbage cultivar to be measured to TuMV-C4 virus microspecies resistance is identified in preparation identification or auxiliary；
C) application in Chinese cabbage breeding；
D) application in the product of preparation auxiliary Chinese cabbage breeding；
E) application in the Chinese cabbage of the anti-TuMV-C4 virus microspecies of breeding；
F) application in the product of the Chinese cabbage of the preparation anti-TuMV-C4 virus microspecies of breeding.
4. a kind of identification or auxiliary identify Chinese cabbage cultivar to be measured to the product of TuMV-C4 virus microspecies resistance, to detect great Bai
The substance of 9805886th deoxyribonucleotide on dish A09 chromosome；
On the A09 chromosome the 9805886th deoxyribonucleotide based on Chinese cabbage Brassica rapa
The version number of the reference whole genome sequence of pekinensis is V1.5, and download address is http://brassicadb.org/
brad；
On the detection Chinese cabbage A09 chromosome substance of the 9805886th deoxyribonucleotide be it is following 1) or 2) or
3):
1) single strand dna as shown in sequence 2 in sequence table, single strand dna shown in sequence 3 and sequence table in sequence table
The primer set A of the composition of single strand dna shown in middle sequence 4；
2) contain 1) described in primer set A PCR reagent；
3) contain 1) described in primer set A or 2) described in PCR reagent kit.
5. a kind of method of the Chinese cabbage cultivar of the anti-TuMV-C4 virus microspecies of breeding, the Chinese cabbage product including selecting TC genotype
The Chinese cabbage cultivar of kind or CC genotype carries out breeding；
The CC genotype is the homozygote that the 9805886th on Chinese cabbage A09 chromosome nucleotide is C；
The TC genotype is that the 9805886th on Chinese cabbage A09 chromosome nucleotide is C and the heterozygote of T；
On the A09 chromosome the 9805886th deoxyribonucleotide based on Chinese cabbage Brassica rapa
The version number of the reference whole genome sequence of pekinensis is V1.5, and download address is http://brassicadb.org/
brad。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025560.1A CN105506130B (en) | 2016-01-15 | 2016-01-15 | It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025560.1A CN105506130B (en) | 2016-01-15 | 2016-01-15 | It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105506130A CN105506130A (en) | 2016-04-20 |
| CN105506130B true CN105506130B (en) | 2019-03-08 |
Family
ID=55714420
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610025560.1A Active CN105506130B (en) | 2016-01-15 | 2016-01-15 | It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105506130B (en) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070055889A (en) * | 2005-11-28 | 2007-05-31 | 주식회사 바이오브리딩연구소 | Scar marker related with tumv-c4 resistance |
| CN101392293A (en) * | 2008-09-25 | 2009-03-25 | 上海交通大学 | Molecular marker method of turnip mosaic virus resistance gene in non-heading Chinese cabbage |
| CN101838645A (en) * | 2010-05-24 | 2010-09-22 | 山东省农业科学院蔬菜研究所 | A pair of cabbage turnip mosaic virus EST-SSR markers and application thereof |
| KR101235862B1 (en) * | 2010-11-04 | 2013-02-20 | 주식회사 바이오브리딩연구소 | Ssr markers and primers related with tumv-c4 resistance gene in brassica rapa |
| CN103060338A (en) * | 2012-12-27 | 2013-04-24 | 中国农业科学院蔬菜花卉研究所 | TuMV resistance gene retr02 of Chinese cabbage and allele retr02 Retr02, and encoded protein and application thereof |
| CN103571832B (en) * | 2013-10-17 | 2015-04-22 | 山东省农业科学院蔬菜花卉研究所 | Molecular marker tightly interlocked with resistance gene TuRBCS01 of brassica rapa pekinensis TuMV |
-
2016
- 2016-01-15 CN CN201610025560.1A patent/CN105506130B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105506130A (en) | 2016-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105525024B (en) | A kind of special SNP marker and application identifying No. 4 biological strain resistances of celery cabbage clubroot | |
| CN106591457B (en) | A kind of identification is located at the SNP marker exploitation and its application of the clubroot Resistance QTL on Chinese cabbage A03 chromosome | |
| CN109468409A (en) | A kind of powdery mildew resistance gene in wheat Pm2b high throughput detection label and its application | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| CN112289384B (en) | Construction method and application of citrus whole genome KASP marker library | |
| CN114427007A (en) | KASP molecular marker related to bitter gourd whole female and application thereof | |
| CN105525000A (en) | QTL-seq-based method for discovering cold-tolerant gene of Dongxiang wild rice | |
| CN107794308A (en) | Identify special SNP and its application of wheat seed character | |
| WO2015143867A1 (en) | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof | |
| CN106434944A (en) | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica | |
| CN104789648B (en) | Identify molecular labeling and its application of the section haplotypes of rice CMS restoring genes Rf 1 | |
| CN107794307A (en) | A kind of special SNP for identifying wheat seed character and its application | |
| CN108103239A (en) | Identify SNP marker A045736268C/T and its application of cabbage turnip mosaic virus resistance | |
| CN105603088B (en) | SNP molecular site for identifying downy mildew resistance QTL on Chinese cabbage A08 chromosome and application thereof | |
| CN106460063A (en) | SNP combination for Chinese cabbage germplasm resource diversity analysis and molecular breeding and application thereof | |
| CN112391489A (en) | SNP molecular marker related to watermelon flesh color and application thereof | |
| CN104928299B (en) | Leaf Spot Caused by Corynespora cassiicola on Cucumber disease-resistant gene Cca and its encoding proteins and application | |
| CN105506130B (en) | It is a kind of identification Chinese cabbage A09 chromosome on viral diseases QTL-BrTuA09 molecular labeling and its application | |
| CN110283929A (en) | The relevant SNP marker 5-160 of capsicum epidemic disease resistant gene and its specific primer and application | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN105713983B (en) | A kind of molecular labeling and its application with rice Jiangnan evening neck blast resistance gene close linkage | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| Lan et al. | Application of molecular marker assisted selection in gene pyramiding and selection of new cultivars | |
| CN107365873A (en) | Molecular labeling and its application with the millet leaf sheath color linkage of characters |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |