CN105506082B - Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe - Google Patents
Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe Download PDFInfo
- Publication number
- CN105506082B CN105506082B CN201510989564.7A CN201510989564A CN105506082B CN 105506082 B CN105506082 B CN 105506082B CN 201510989564 A CN201510989564 A CN 201510989564A CN 105506082 B CN105506082 B CN 105506082B
- Authority
- CN
- China
- Prior art keywords
- region
- primer
- tra nsfer
- chain tra
- chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Synthesize initiation site it is more, sensitivity by force with the method using chain tra nsfer type primer amplification nucleic acid of high specificity: (a) design chain tra nsfer type primer；(b) the chain tra nsfer type primer is cut using the nuclease of archaeal dna polymerase, primer forms chain tra nsfer after cutting, and makees the amplification of target nucleic acid；The target nucleic acid successively region regulation F2, the region F1 and the region R1 since 5 ' ends are to 3 ' ends, the successively region regulation F2c, the region F1c and the region R1c since 3 ' ends are to 5 ' ends, the F2 and F2c, F1 and F1c or the region R1 and R1c refer between two segments to be in reverse complemental；The chain tra nsfer type primer is formed by R1 plus F1 segment；When the chain tra nsfer refers to that the segment mediated through upstream F3 primer extends to the region F2, the 5 prime excision enzyme activity cutting chain transfevent primer of archaeal dna polymerase shifts the R1 segment inside chain tra nsfer type primer, serves as reverse primer in conjunction with the downstream region R1c.The present invention is suitable for nucleic acid amplification.
Description
Technical field
The present invention relates to nucleic acid amplifications, and in particular with chain tra nsfer (Strand Transfer) principle amplification of nucleic acid, being can
It is efficiently applied to the method and corresponding detection method of field of biomedicine amplification target nucleic acid, specifically includes chain tra nsfer type primer
(Strand Transfer Primer, STP), chain tra nsfer primed probe (Strand Transfer Primer&Probe,
STPP design method), target nucleic acid molecules amplification and corresponding detection.
Background technique
The synthesis application of DNA is in biomedical each field.The typical method of the synthesis is just like polymerase chain reaction (PCR).
PCR generates double-stranded products using two Oligonucleolide primers of upstream and downstream and archaeal dna polymerase.Wherein, primer and template upstream and downstream
Target sequence Complementary hybridization, and archaeal dna polymerase by addition deoxynucleoside triphosphate (dNTPs) Lai Yanshen annealing primer.With
When RNA template, in addition reverse transcription step, that is, reverse transcription PCR (RT-PCR).The final product of nucleic acid amplification can be used for external biological
Learn operation.To realize that specific application surface the solution of quantitative fluorescent PCR has occurred if the needs being measured in real time.If
, have there is the design scheme of recombinant PCR in mutation, the connection etc. for carrying out nucleic acid molecules.If integrate molecule or outside sequence
, has there are the forms such as Alu-PCR or inverse PCR in identification etc..
To avoid thermal cycle, several isothermal target amplification side is developed according to polymerization enzyme viability and design of primers etc.
Method.Such as strand displacement amplification, transcript mediated amplification, self-sustained sequence replication, rolling circle amplification, ring mediated isothermal nucleic acid amplification etc..This
A little amplification techniques have certain limitation.As strand displacement amplification when expanding long target sequence low efficiency, transcript mediated amplification
It is only limitted to RNA molecule with the starting material of self-sustained sequence replication, ring mediated isothermal nucleic acid product is in concatermer knot different in size
Structure etc..
Classical PCR amplification etc. is influenced by target molecule template target sequence structure, polymorphism and length.It is complicated in amplification
When the complex template of sequential structure, polymorphism or longer sequence template, there are many indefinite factor of amplification efficiency.Especially not
Easily find the upstream and downstream matching primer for being suitble to amplification.The present invention proposes chain tra nsfer formula design of primers and use in view of the above fact
Chain tra nsfer primer amplification target nucleic acid detection of nucleic acids probe is made, its purpose is to provide supplement and improve the prior art one
Kind novel nucleic acid amplification and detection technique.
Summary of the invention
The defect and problem faced the invention solves above-mentioned nucleic acid amplification in the prior art is, and it is an object of the present invention to provide a kind of chain
The design and utilization chain tra nsfer type primer amplification target nucleic acid and production nucleic acid probe of transfevent primer.
The present invention is characterized in that using the technical solution of the method for chain tra nsfer type primer amplification target nucleic acid
(a) chain tra nsfer type primer is designed；
(b) the chain tra nsfer type primer is cut using the nuclease of archaeal dna polymerase, primer forms chain and turns after cutting
It moves, carries out the amplification of target nucleic acid；
The target nucleic acid, the successively region regulation F2, the region F1 and the region R1 since 5 ' ends are to 3 ' ends, from 3 ' ends
It holds to 5 ' ends and starts the successively region regulation F2c, the region F1c and the region R1c, the region refers to oligonucleotide fragment, the F2
With the region F2c, F1 and the region F1c or R1 and the region R1c refer between two segments in reverse complemental；
The chain tra nsfer type primer is formed by R1 plus F1 segment；The chain tra nsfer refers to the segment mediated through upstream F3 primer
When extending to the region F2, the 5 prime excision enzyme activity cutting chain transfevent primer of archaeal dna polymerase makes the R1 piece inside chain tra nsfer type primer
Section transfer, serves as reverse primer in conjunction with the downstream region R1c.
The target nucleic acid comes host or pathogen nucleic acid in biological sample.
Using chain tra nsfer type primer integrative nucleic acid probe (STPP), it is characterized in that the chain tra nsfer type draws to the present invention
3 ' side F1 of object are designed to fluorescence probe, can be used for real-time nucleic acid using the method for STPP and detect.
Chain tra nsfer type primer or probe of the present invention can design forward or backwards, chain tra nsfer type primer and or probe in
Exogenous array, artificial sequence or base modification and multiple chain tra nsfer type primer and or probe is added in portion.
The method of amplification of nucleic acid of the present invention is: (a) will be as the nucleic acid of template, deoxyribonucleotide triphosphoric acid, tool
There are archaeal dna polymerase, at least one chain tra nsfer primer of circumscribed activity of enzyme reaction, prepares reaction mixture；(b) reaction is mixed
It closes liquid and carries out temperature cycles, so that the complementary chain extension under archaeal dna polymerase effect is to generate reaction product.
More synthesis initiation sites are provided than conventional PCR primer using chain tra nsfer primer, enhance sensitivity；It can mirror
Other sequence variations, make specific enhancing；It can be applied to that sequence information is unknown or the target nucleic acid of more difficult extension increasing sequence structure.
Technical key point of the present invention is to combine the 5 prime excision enzyme activity of common dna polymerase and chain tra nsfer formula primer and visit
The design of needle, substitutes that upstream during traditional nucleic acid is positive, mediated process of reverse downstream primer.
Chain tra nsfer type primer of the present invention is configured with mould in 3 ' ends of primer or 3 '-end sides including any one
Plate complementary region, 5 ' ends or 5 '-end sides be configured with relative to 3 ' Side Template downstreams complementary region, can be in side of the invention
In method for nucleic acid chain extension, can be cut by exonuclease and or the Oligonucleolide primers replaced of strand displacement effect.Its
In, 3 '-end sides refer to the part from primer center to 3 ' ends, and 5 '-end sides guide the center of object to the portion of 5 '-ends
Point.That is, chain tra nsfer primer is a kind of splicing Oligonucleolide primers.3 '-areas of chain tra nsfer primer are F1, mutual with the region template F1c
It mends；5 '-areas are R1, complementary with downstream template R1 fragment complementation chain (Fig. 1).
R1 and F1 constitutes the basic structure of chain tra nsfer primer.Exonuclease or strand displacement enzymatic activity in archaeal dna polymerase
Identification, cut or replace at the primer extend DNA chain (primer extension chain), the ribonucleotide of action site be located at R1 and
The junction of F2.Such as when the F1 segment and template annealing extension in chain tra nsfer primer, archaeal dna polymerase acts on and template nucleic acid
The F1 segment 5 ' of annealing is held, and generates free R1 segment through cutting.R1 becomes downstream primer (Fig. 2) after chain tra nsfer, continues
Polymerization reaction.
Chain tra nsfer primer used in the present invention has the universal architecture of R1F1, the further expansion in this structure, such as
In 5' → 3' forward direction or 3 ' → 5 ' reversely, exogenous array (promoter sequence, connector is added in chain tra nsfer primer inside chain tra nsfer primer
Subsequence, adaptor sequence), artificial sequence (sequence label) or base modification, nucleic acid analog etc., in the scope of the invention
It is interior.The chain tra nsfer primer can be applied to PCR reaction or isothermal amplification etc., within the scope of the present invention.
The wooden invention is not particularly limited the length of the chain tra nsfer prime nucleotide used, as long as at 3 ' ends or 3 ' ends
End side and 5 ' ends or 5 ' end sides have template complementary series, can be applied to chain transfer reaction.The length of R1 or F1 is recommended about
12 nucleotide~about 40 nucleotide.
Above-mentioned chain tra nsfer primer is basic structure of the invention, this structure has been that filling for amplified reaction the primer wants item
Part.To improve amplification efficiency, multiple chain tra nsfer primer can be added, such as introduce 2 chain tra nsfer primers (Fig. 3) until n chain turns
It moves primer (Fig. 4).Increased primer construction is within the scope of the present invention in this foundation structure.
As long as the exonuclease that the present invention uses can apply in method of the invention, it is not limited to specific a certain
Kind.Any exonuclease that can identify that the chain tra nsfer primer is cut and forms chain tra nsfer is used equally for the present invention,
Such as λ bacteriophage exonuclease (λ exo) and 6 exonuclease of T7 phage gene etc..Common archaeal dna polymerase has
5' → 3' exonuclease activity exonuclease activity.
Archaeal dna polymerase used in the present invention refers to using DNA chain as the enzyme of the new DNA chain of templated synthesis.With 5-3'
The archaeal dna polymerase of exonuclease activity can be used for the present invention, it is possible to use be provided simultaneously with 5-3' exonuclease activity with
The archaeal dna polymerase of strand-displacement activity.
Strand-displacement activity application as a result, being the displacement during DNA replication dna based on template nucleic acid sequence
DNA chain is to discharge the complementary strand with template strand annealing.
It is any that there is above-mentioned active archaeal dna polymerase can be applied to the present invention.Its example includes deriving from e. coli dna
The large fragment of polymerase-I, yT1 plants of thermus aquaticus of Taq archaeal dna polymerase；In Thermus thermophilus HB8
Tth archaeal dna polymerase etc..
The method that the present invention expands target nucleic acid includes going to carry out primer strand using the archaeal dna polymerase with 5 prime excision enzyme activity
Transfer reaction.It in the transfer reaction, cuts to form reverse primer through excision enzyme, is transferred to template double-strandednucleic acid respective complementary piece
Section, is catalyzed through archaeal dna polymerase, synthesizes the primer extension chain (Fig. 2) complementary with the template.Chain transfer reaction namely refer to: chain tra nsfer
Primer is handled through having the archaeal dna polymerase, generates the oligonucleotide fragment complementary with the template extended chain.In extended chain synthesis
In the process, above-mentioned oligonucleotide fragment is constantly transferred to template downstream, serves as the circulation of primer mediated amplification.
Amplification of nucleic acid method of the present invention can be used for detection, label and recombination of nucleic acid etc..
The Real_time quantitative detection of fluorescent probe technique progress nucleic acid can be used in nucleic acid amplification method of the present invention.It is existing at present more
Kind fluorescence probe can be used.Such as hydrolysis (Taqman) probe.The DNA oligomerization core that this kind of probe is marked respectively by donor and receptor
Thuja acid composition.Probe is designed to combine the specific region on a chain of amplified production.When probe is complete, reporter group hair
The fluorescence signal penetrated is quenched group absorptions.When amplification, after probe cleavage (hydrolysis), reporter fluorescence group and it is quenched glimmering
The separation of light group, can monitor fluorescence signal.The amplification combination hydrolysis probes detection skill that Fig. 4 specifically illustrates chain tra nsfer primer to mediate
Art.
The present invention can also combination molecule beacon, Fluorescence Resonance Energy probe, scorpion probes etc. carry out detection of nucleic acids.It can also adopt
Use non-specific dyestuff as fluorescent marker.Not as limitation of the present invention.
Present invention simultaneously provides a kind of inspection policies that chain tra nsfer type primer is merged with probe.When F1 is defined as fluorescence probe
When, constitute new real-time fluorescence detection architecture (Fig. 5).This structure is named as STPP.
The fluorescent marker of STPP of the present invention, that is, the fluorescent dye being covalently attached.Specifically, fluorescent marker can be selected from
Following dyestuff: FAM, VIC, NED, fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET,
TAMRA, JOE, ROX, BODIPY TMR, texas Red, Alexa Fluor and PET etc..Fluorescent quenching group can be selected
DABCYL, BHQ1, BHQ2 etc..
The present invention can directly be implemented on DNA or RNA target molecular template.
The present invention also provides the method for rapid and correct detection pathogen molecule and host molecule by way of example.
Beneficial effects of the present invention essentially consist in that more being synthesized using chain tra nsfer primer than conventional PCR primer offer
Beginning site, enhances sensitivity, can identify sequence variations, makes specific enhancing.Beneficial effects of the present invention can also be by especially
It is each method that will be specified below and combination to be achieved and obtained.
Detailed description of the invention
Fig. 1 shows the schematic diagram of the method for the present invention chain tra nsfer primer.
Fig. 2 shows the amplified reaction schematic diagram that the method for the present invention chain tra nsfer primer mediates.
Fig. 3 shows the schematic diagram of the multiple chain tra nsfer primers of the method for the present invention.
Fig. 4 shows the amplified reaction combination fluorescence probe detection schematic diagram that the method for the present invention chain tra nsfer primer mediates.
Fig. 5 shows the design of the method for the present invention chain tra nsfer primed probe.
Fig. 6 shows the detection schematic diagram of the method for the present invention chain tra nsfer primed probe.
Specific embodiment
In present embodiment, by nucleic acid-templated referred to as target molecule to be detected, base sequence is target sequence.It may contain
Target molecule is sample by test product.
Sample as object of the present invention is not particularly limited, such as whole blood, serum, the blood derived from subject can be used
Slurry, leucocyte, urine, excrement, sperm, saliva, tissue adherence, culture cell, sputum or tissue etc..The subject can be
The microorganisms such as people, animals and plants and virus, bacterium, fungi, Chlamydia, conveyor screw, Richettsia and mycoplasma.By being mentioned in sample
Nucleic acid compositions are taken out, extracting method is not particularly limited.
It is the schematic diagram of chain tra nsfer primer as shown in Figure 1；In the method for the present invention, the target molecule is from 5 ' ends to 3 ' ends
Start successively to provide the region F2, the region F1 and the region R1, the successively region regulation F2c, the region F1c since 3 ' ends are to 5 ' ends
With the region R1c, the region refers to oligonucleotide fragment.The F2 and the region F2c, F1 and the region F1c or R1 and the region R1c
Deng referring between two segments in reverse complemental.
In the method for the present invention, the chain tra nsfer type primer refers to the basic structure that the 5 ' side side F1 and 3 ' R1 are constituted.R1 length
Recommend 18~25 bases, F1 length recommends 15~27 bases, and F2 length recommends 18~25 bases.The joint portion of R1 and F1 can have 0
The overlapping of~2 overlapping bases, preferably G base.F2 could dictate that the region R1 is more than or equal to a kind of chain tra nsfer type primer.
In the method for the present invention, the melting temperature (Tm) of each primer is described are as follows: F2 is matched with the Tm of R1.F1 in chain tra nsfer primer
The melting temperature of segment is preferable slightly larger than F2；Matching herein, which refers to, is no more than ± 5 DEG C, preferably ± 2 DEG C between the two Tm.F2
The proportional region of primer and chain tra nsfer primer concentration: 1:1~1:5.Archaeal dna polymerase used in this method can be heat-resistant dna
Polymerase Taq, Tth enzyme etc..
Following Examples are the further description of the invention, should not make limitation of the present invention.
The nucleic acid amplification of 1 HIV-1Gag Partial Fragment of embodiment
By taking the detection of HIV-1 as an example, illustrate that the present invention relates to the applications of chain tra nsfer primer.Used sample is HIV-1
The H9 cell strain of viral persistence duplication, it is intended to illustrate to the application of the method for the present invention.Gag gene encodes HIV-1 virus
Capsomere, the detection target of usually HIV-1.Gag sequence is obtained from Genbank, specific primer information:
Gag-F2:ACATAGCAGGAACTACTA(SEQ ID NO:1)
Gag-STP:TAAGAATGTATAGCCCTACCAG CAGGAACAAATAGGATGGAT(SEQ ID NO:2)
Reaction template is from the H9 Cell extraction DNA calibrated.PCR reaction includes 1 × PCR buffer (Takara),
0.1U/ μ L HotStarTaq plus polymerase (Qiagen), 200 μm of ol/L dNTP, 0.3umol/L Gag-F2,
0.2umol/L Gag-STP, 10ng template.Response procedures: after 95 DEG C of 5min denaturation, total 45 circulation of 95 DEG C of 15s, 60 DEG C of 45s.
After reaction, reaction mixture takes 5uL, carries out electrophoretic analysis with 1.5% Ago-Gel, obtains positive amplification band.
The amplification of 2 STAT1 molecule of embodiment
By taking the amplification of STAT1 molecule as an example, illustrate application of the present invention to host molecule.From 293T cell extraction DNA.Institute
The positive control used is pcDNA-STAT1 plasmid.
The nucleotide sequence of STAT1 obtains (searching number NM_007315) from GenBank, specific primer information:
STAT1-F2-1:AAGGACAAGGTTATGTGTATAG(SEQ ID NO:3)
STAT1-STP:GAGAACACGAGACCAATGTCAAGAGCCTGGAAGATT(SEQ ID NO:4)
PCR reaction includes 1 × PCR buffer (Takara), 0.1U/ μ L HotStarTaq plus polymerase
(Qiagen), 200 μm of ol/L dNTP, 0.3umol/L STAT1-F2-1,0.2umol/L STAT1-STP, 10ng templates.Instead
Answer program: after 95 DEG C of 5min denaturation, total 45 circulation of 95 DEG C of 15s, 60 DEG C of 45s.After reaction, reaction mixture takes 5uL, uses
1.5% Ago-Gel carries out electrophoretic analysis, obtains positive amplification band.
The combined application of 3 chain tra nsfer primed probe method of embodiment detects
In the present embodiment, user STAT1 gene carries out chain tra nsfer primer as nucleic acid similarly to Example 2
Merge the detection citing of sonde method.Synthesizing ribonucleotide primer used in the present embodiment is as follows.
STAT1-F2-2:GCTGTTACTCAAGAAGATG(SEQ ID NO:5)
STAT1-STPP:
TAATGATGAACTAGTGGAGTA(FAM)ATAGAGTTGCTGAATGTCACTGAAC(BHQ-1)(SEQ ID NO:
6)
FAM indicates that the probe black matrix A base is marked using FAM fluorescent reporter group in above-mentioned probe, and BHQ1 indicates 3 ' ends
It is marked with BHQ1 quenching group.As previously mentioned, fluorescent emission group can according to need with quenching group and be changed.
PCR reaction includes 1 × PCR buffer (Takara), 0.1U/ μ L HotStarTaq plus polymerase
(Qiagen), 200 μm of ol/L dNTP, 0.3umol/L STAT1-F2-2,0.2umol/L STAT1-STPP, 10ng templates.Instead
Answer program: after 95 DEG C of 5min denaturation, total 45 circulation of 95 DEG C of 15s, 60 DEG C of 45s.
Use the DNA of 293T Cell extraction as template, while setting up positive, negative and blank control.Use ABI-
7500 quantitative fluorescent PCR instruments, each extension latter stage read fluorescence signal.The method of the present invention can real-time detection go out STAT1 point
The expression of son.Detection sensitivity has good specificity up to 25 copies/ml.
Claims (7)
1. utilizing the method for chain tra nsfer type primer amplification nucleic acid, it is characterised in that:
(a) chain tra nsfer type primer is designed；
(b) the chain tra nsfer type primer, the primer shape after cutting are cut using 5 ' → 3 ' exonuclease activities of archaeal dna polymerase
At chain tra nsfer, the amplification of target nucleic acid is carried out；
The target nucleic acid, the successively region regulation F2, the region F1 and the region R1 since 5 ' ends are to 3 ' ends, from 3 ' ends to
5 ' ends start the successively region regulation F2c, the region F1c and the region R1c, and the region refers to oligonucleotide fragment, the F2 and F2c
Region, F1 and the region F1c or R1 and the region R1c refer between two segments in reverse complemental；
The chain tra nsfer type primer is formed by R1 plus F1 segment；The chain tra nsfer refers to that the segment mediated through upstream F2 primer extends
When to the region F2, the exonuclease activity cutting chain transfevent primer of archaeal dna polymerase generates free R1 segment through cutting, makes
R1 segment transfer inside chain tra nsfer type primer, serves as reverse primer in conjunction with the downstream region R1c.
2. the method as described in claim 1, which is characterized in that the engagement of the R1 segment and F1 segment of the chain tra nsfer type primer
There is 0~2 overlapping base in portion.
3. method according to claim 2, which is characterized in that the overlapping base is the overlapping of G base.
4. the method as described in one of claims 1 to 3, which is characterized in that exogenous array, people are added inside chain tra nsfer type primer
Process column or base modification.
5. method as claimed in claim 4, which is characterized in that use multiple chain tra nsfer type primer.
6. utilizing the method for chain tra nsfer type primer fusion probe, it is characterised in that:
Target nucleic acid, the successively region regulation F2, the region F1 and the region R1 since 5 ' ends are to 3 ' ends, from 3 ' ends to 5 ' ends
End starts successively to provide the region F2c, the region F1c and the region R1c, and the region refers to oligonucleotide fragment, the F2 and the area F2c
Domain, F1 and the region F1c or R1 and the region R1c refer between two segments in reverse complemental；
The chain tra nsfer type primer is formed by R1 plus F1 segment；The chain tra nsfer refers to that the segment mediated through upstream F2 primer extends
When to the region F2, the exonuclease activity cutting chain transfevent primer of archaeal dna polymerase generates free R1 segment through cutting, makes
R1 segment transfer inside chain tra nsfer type primer, serves as reverse primer in conjunction with the downstream region R1c；
F1 is defined as fluorescence probe in the chain tra nsfer type primer fusion probe.
7. method as claimed in claim 5, which is characterized in that exogenous array, artificial is added inside the chain tra nsfer type primer
Sequence or base modification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989564.7A CN105506082B (en) | 2015-12-24 | 2015-12-24 | Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989564.7A CN105506082B (en) | 2015-12-24 | 2015-12-24 | Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105506082A CN105506082A (en) | 2016-04-20 |
| CN105506082B true CN105506082B (en) | 2019-04-09 |
Family
ID=55714372
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510989564.7A Expired - Fee Related CN105506082B (en) | 2015-12-24 | 2015-12-24 | Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105506082B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636071B (en) * | 2017-01-17 | 2020-07-17 | 中国科学院过程工程研究所 | Method for synthesizing nucleic acid under constant temperature condition |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999061661A1 (en) * | 1998-05-27 | 1999-12-02 | Bio Merieux | Method for amplifying at least a particular nucleotide sequence and primers used |
| CN101680029A (en) * | 2007-03-01 | 2010-03-24 | 奥西泰克有限公司 | Nucleic acid detection |
-
2015
- 2015-12-24 CN CN201510989564.7A patent/CN105506082B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999061661A1 (en) * | 1998-05-27 | 1999-12-02 | Bio Merieux | Method for amplifying at least a particular nucleotide sequence and primers used |
| CN101680029A (en) * | 2007-03-01 | 2010-03-24 | 奥西泰克有限公司 | Nucleic acid detection |
Non-Patent Citations (2)
| Title |
|---|
| Exonuclease of human DNA polymerase gamma disengages its strand;Quan He et al.;《Mitochondrion》;20130830;第13卷(第6期);第592-601页 * |
| 核酸分子探针结合信号放大技术用于核酸的检测;鲍艳艳;《中国优秀硕士学位论文全文数据库医药卫生科技辑》;20120815(第8期);E060-20 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105506082A (en) | 2016-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2494922T3 (en) | Methods for amplification, quantification and identification of nucleic acids | |
| JP5680078B2 (en) | Nucleic acid normalized quantification method based on ligation | |
| US20070003955A1 (en) | Normalization of samples for amplification reactions | |
| CN102099488B (en) | Method for amplifying oligonucleotide and small RNA by using polymerase-endonuclease chain reaction | |
| JP7175326B2 (en) | Target nucleic acid amplification method and target nucleic acid amplification composition | |
| KR102293402B1 (en) | Method for Detecting Target Nucleic Acid Using Rolling Circle Amplification and Composition for Detecting Target Nucleic Acid | |
| JP2017521056A (en) | DNA amplification method based on strand invasion | |
| CN104404142A (en) | Fluorescent probe for fluorescent quantitative PCR reactions | |
| HRP20150190T1 (en) | A method for detection of human papillomavirus (hpv) type | |
| JP2018064587A (en) | Nucleic acids for nucleic acid amplification | |
| CN105018593B (en) | Cold water fish detection of pathogens method | |
| JP2007125011A (en) | Method of detecting specific fragment of dna or rna with aid of polymerase chain reaction | |
| US11926870B2 (en) | Restriction mediated quantitative polymerase chain reactions | |
| JP2008136451A (en) | Method for amplifying nucleic acid | |
| KR101756875B1 (en) | A dual-functional oligonucleotide including complementary sequences, mis-matched sequences, reporter dye, and quencher dye linked with primer for nucleic acid amplification and measurement methods using the same | |
| JP6074036B2 (en) | Novel DNA polymerase with expanded substrate range | |
| CN105506082B (en) | Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe | |
| WO2023202303A1 (en) | Micro-rna detection method and kit | |
| CN114277108B (en) | Primer probe combination, kit and method for SNP locus detection | |
| CN106868111A (en) | Using the method and kit of universal TaqMan probe detection SNP | |
| CN114621996A (en) | Method for detecting activity of one or more polymerases | |
| US9074248B1 (en) | Primers for helicase dependent amplification and their methods of use | |
| KR20170092216A (en) | Kit and Method of identifying Mycobacterium abscessus strains based on amplification of hsp65 gene | |
| KR20240058019A (en) | Primer sets for rapid detection of Escherichia coli O127, O128ac or O86 serotype and a method of detecting a serotype of Escherichia coli using the same | |
| KR20240058024A (en) | Primer sets for rapid detection of Escherichia coli O115 serotype and a method of detecting a serotype of Escherichia coli using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190409 Termination date: 20211224 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |