CN105506082A - Method for amplifying nucleic acid and fusing probe by utilizing chain transfer primer - Google Patents
Method for amplifying nucleic acid and fusing probe by utilizing chain transfer primer Download PDFInfo
- Publication number
- CN105506082A CN105506082A CN201510989564.7A CN201510989564A CN105506082A CN 105506082 A CN105506082 A CN 105506082A CN 201510989564 A CN201510989564 A CN 201510989564A CN 105506082 A CN105506082 A CN 105506082A
- Authority
- CN
- China
- Prior art keywords
- primer
- tra nsfer
- region
- nucleic acid
- chain tra
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method adopting multiple synthesis starting sites, having strong sensitivity and specificity and used for amplifying nucleic acid by utilizing a chain transfer primer comprises the steps that (a) the chain transfer primer is designed; (b) the nuclease activity of DNA polymerase is utilized to cut the chain transfer primer, and the primer produces chain transfer for amplification of the target nucleic acid after cutting; an F2 area, an F1 area and an R1 area are sequentially defined by the target nucleic acid from the 5' terminal to the 3' terminal, an F2c area, an F1c area and an R1c area are sequentially defined from the 3' terminal to the 5' terminal, and the F2 area and the F2c area, the F1 area and the F1c area and the R1 area and the R1c area refer to reverse complementation between every two fragments; the chain transfer primer is formed by an R1 fragment and an F1 fragment; chain transfer refers to the fact that the exonuclease activity of DNA polymerase is utilized to cut the chain transfer primer when the fragment mediated by an upstream F3 primer extends to the F2 area to enable the R1 fragment inside the chain transfer primer to transfer and serve as a reverse primer by combining with a downstream R1c area. The method is suitable for nucleic acid amplification.
Description
Technical field
The present invention relates to nucleic acid amplification, particularly utilize chain tra nsfer (StrandTransfer) principle amplification of nucleic acid, effectively to be applied to the method for biomedical sector amplification target nucleic acid and corresponding detection method, specifically comprise chain tra nsfer type primer (StrandTransferPrimer, STP), chain tra nsfer primed probe (StrandTransferPrimer & Probe, STPP) method of design, target nucleic acid molecules increases and detects accordingly.
Background technology
The synthesis application of DNA is in each field of biomedicine.The typical method of this synthesis is just like polymerase chain reaction (PCR).PCR uses upstream and downstream two Oligonucleolide primers and archaeal dna polymerase to produce double-stranded products.Wherein, the target sequence Complementary hybridization of primer and template upstream and downstream, and archaeal dna polymerase extends annealing primer by adding deoxynucleoside triphosphate (dNTPs).During for RNA template, add reverse transcription step and reverse transcription PCR (RT-PCR).The end product of nucleic acid amplification can be used for extracorporeal biology operation.For realizing specific application surface, there is the solution of quantitative fluorescent PCR in the needs detected in real time if carry out.If carry out the sudden change of nucleic acid molecule, connection etc., there is the design of recombinant PCR.Integrate the qualification etc. of molecule or outside sequence if carry out, occur the form such as Alu-PCR or inverse PCR.
For avoiding thermal cycling, develop several isothermal target amplification method according to polymerization enzyme viability and design of primers etc.Such as strand displacement amplification, transcript mediated amplification, self-sustained sequence replication, rolling circle amplification, ring mediated isothermal nucleic acid amplification etc.These amplification techniques have certain limitation.As low in strand displacement amplification efficiency when increasing long target sequence, the parent material of transcript mediated amplification and self-sustained sequence replication is only limitted to RNA molecule, and ring mediated isothermal nucleic acid product is concatermer structure etc. different in size.
Classical pcr amplification etc. is subject to the impact of target molecule template target sequence structure, polymorphism and length.Increase complex sequence structure, polymorphism comparatively template complex or longer sequence template time, the indefinite factor of amplification efficiency is a lot.Especially the upstream and downstream coupling primer being applicable to amplification is not easily found.The present invention chain tra nsfer formula design of primers is proposed in view of the above fact and with chain tra nsfer primer amplification target nucleic acid to make detection of nucleic acids probe, its object is to provide a kind of novel nucleic acid amplification and the detection technique of supplementing and improve prior art.
Summary of the invention
The present invention will solve above-mentioned prior art amplifying nucleic acid and to increase the defect and problem that face, and object is to provide a kind of design of chain tra nsfer type primer and utilize chain tra nsfer type primer amplification target nucleic acid and make nucleic acid probe.
The present invention utilizes the technical scheme of the method for chain tra nsfer type primer amplification target nucleic acid, and its special character is:
(a) design chain tra nsfer type primer;
B () utilizes the nuclease of archaeal dna polymerase to cut described chain tra nsfer type primer, after cutting, primer forms chain tra nsfer, carries out the amplification of target nucleic acid;
Described target nucleic acid, from 5 ' end regulation F2 region, F1 region and R1 region successively to 3 ' end, from 3 ' end regulation F2c region, F1c region and R1c region successively to 5 ' end, described region refers to oligonucleotide fragment, described F2 and F2c region, F1 and F1c region, or R1 and R1c region, refer to that two panels is intersegmental in reverse complemental;
By R1, described chain tra nsfer type primer adds that F1 fragment forms; Described chain tra nsfer refers to that the 5 prime excision enzyme activity cutting chain transfevent primer of archaeal dna polymerase, makes the R1 fragment of chain tra nsfer type primer inside shift, serve as reverse primer in conjunction with R1c region, downstream when the fragment of upstream F3 primer mediation extends to F2 region.
Described target nucleic acid comes host in biological sample or pathogen nucleic acid.
The present invention utilizes chain tra nsfer type primer integrative nucleic acid probe (STPP) its special character to be that 3 ' side F1 of described chain tra nsfer type primer is designed to fluorescent probe, uses the method for STPP to can be used for real-time nucleic acid and detects.
Chain tra nsfer type primer of the present invention or probe can design forward or backwards, chain tra nsfer type primer and or probe interior add exogenous array, artificial sequence or base modification, and multiple chain tra nsfer type primer and or probe.
The method of amplification of nucleic acid of the present invention is: (a) using nucleic acid, deoxyribonucleotide triphosphoric acid, the archaeal dna polymerase with excision enzyme reactive behavior, at least one chain tra nsfer primer as template, preparation feedback mixed solution; B described reaction mixture is carried out temperature cycle by (), extend to make the complementary strand under archaeal dna polymerase effect with formation reaction product.
Application chain tra nsfer primer provides than conventional PCR primer and more synthesizes initiation site, and sensitivity is strengthened; Can sequence variations be differentiated, specificity is strengthened; Can be applicable to sequence information fail to understand or the target nucleic acid of more difficult extension increasing sequence structure.
Technical essential of the present invention is the 5 prime excision enzyme activity combining common dna polysaccharase, and the design of chain tra nsfer formula primer and probe, substitutes the mediated process of traditional nucleic acid process middle and upper reaches forward, reverse downstream primer.
Chain tra nsfer type primer of the present invention, comprise any one 3 ' end of primer or 3 '-end side be configured with template complementary region, 5 ' end or 5 '-end side be configured with relative to 3 ' Side Template downstream complementary region, can extend for nucleic acid chains in the method for the invention, can be cut by exonuclease and or strand displacement effect carry out the Oligonucleolide primers of replacing.Wherein, 3 '-end side refers to the part from primer central authorities to 3 ' end, and 5 '-end side guides the part of central authorities to 5 '-end of thing.That is, chain tra nsfer primer is a kind of splicing Oligonucleolide primers.3 '-district of chain tra nsfer primer is F1, with template F1c regional complementarity; 5 '-district is R1, with downstream template R1 fragment complementation chain complementation (Fig. 1).
R1 and F1 forms the basic structure of chain tra nsfer primer.Exonuclease in archaeal dna polymerase or the identification of strand displacement enzymic activity, cut or replace the DNA chain (primer extension chain) that this primer place extends, the ribonucleotide of its action site is positioned at the junction of R1 and F2.As when the F1 fragment in chain tra nsfer primer and template annealing extend, archaeal dna polymerase acts on the F1 fragment 5 ' of annealing with template nucleic acid and holds, and produces free R1 fragment through cutting.R1 becomes downstream primer (Fig. 2) after chain tra nsfer, proceeds polyreaction.
Chain tra nsfer primer used by the present invention has the universal architecture of R1F1, in this structural further expansion, such as chain tra nsfer primer be 5' → 3' forward or 3 ' → 5 ' oppositely, chain tra nsfer primer inside adds exogenous array (promoter sequence, joint subsequence, adaptor sequence), artificial sequence (sequence label) or base modification, nucleic acid analog etc., all within the scope of the present invention.Described chain tra nsfer primer can be applicable to PCR reaction or isothermal amplification etc., all within the scope of the present invention.
Wood invention has no particular limits the length of chain tra nsfer prime nucleotide used, as long as all have template complementary sequence at 3 ' end or 3 ' end side and 5 ' end or 5 ' end side, can be applicable to chain transfer reaction.The length of R1 or F1 recommends about 12 Nucleotide ~ about 40 Nucleotide.
Above-mentioned chain tra nsfer primer is basic structure of the present invention, and this structure has been the necessary and sufficient condition of amplified reaction the primer.For improving amplification efficiency, multiple chain tra nsfer primer can be added, as introduced 2 chain tra nsfer primers (Fig. 3) until n chain tra nsfer primer (Fig. 4).The primer construction that this foundation structure increases all within the scope of the present invention.
As long as the exonuclease that the present invention uses can be applied in method of the present invention, be not restricted to concrete a certain.Any can identify described in chain tra nsfer primer carry out cutting and the exonuclease that forms chain tra nsfer all can be used for the present invention, such as lambda particles phage exonuclease (λ exo) and T7 phage gene 6 exonuclease etc.Common archaeal dna polymerase has 5' → 3' exonuclease activity exonuclease activity.
Archaeal dna polymerase used by the present invention refers to the enzyme utilizing DNA chain as the new DNA chain of templated synthesis.The archaeal dna polymerase with 5-3' exonuclease activity may be used for the present invention, also can use the archaeal dna polymerase simultaneously possessing 5-3' exonuclease activity and strand-displacement activity.
The result of described strand-displacement activity application is in the process of the DNA replication dna based on template nucleic acid sequence, and displacement DNA chain is to discharge the complementary strand of having annealed with template strand.
Any archaeal dna polymerase with above-mentioned activity can be applicable to the present invention.Its example comprise derive from e. coli dna polymerase-I large fragment, thermus aquaticus yT1 strain Taq DNA polymerase; TthDNA polysaccharase etc. in ThermusthermophilusHB8.
The increase method of target nucleic acid of the present invention comprises and uses the archaeal dna polymerase with 5 prime excision enzyme activity to go to carry out primer strand shift reaction.In this shift reaction, form reverse primer through excision enzyme cutting, be transferred to template double-strandednucleic acid respective complementary fragment, through archaeal dna polymerase catalysis, the primer extension chain (Fig. 2) of synthesis and this template complementation.Namely chain transfer reaction also refers to: chain tra nsfer primer, through archaeal dna polymerase process described in tool, generates the oligonucleotide fragment with this template extended chain complementation.In the process of extended chain synthesis, above-mentioned oligonucleotide fragment is constantly transferred to template downstream, serves as the circulation of primer mediated amplification.
Amplification of nucleic acid method of the present invention can be used for detection, the mark and restructuring etc. of nucleic acid.
Nucleic acid amplification method of the present invention can use fluorescent probe technique to carry out the Real_time quantitative detection of nucleic acid.Existing multiple fluorescent probe can adopt at present.Such as be hydrolyzed (Taqman) probe.The DNA oligonucleotide that this kind of probe is marked respectively by donor and acceptor forms.Probe is designed to be attached to the specific region on a chain of amplified production.When probe is complete, the fluorescent signal that reporter group is launched is quenched group absorptions.When increasing, after probe cleavage (hydrolytic action), reporter fluorescence group is separated with quenching fluorescence group, can monitor fluorescent signal.The amplification that Fig. 4 specifically illustrates chain tra nsfer primer to mediate combines hydrolysis probe techniques.
The present invention also molecular beacon, Fluorescence Resonance Energy probe, scorpion probes capable of being combined etc. carries out detection of nucleic acids.Also non-specific dyestuff can be adopted as fluorescent mark.Not as limitation of the present invention.
The inspection policies that the present invention provides a kind of chain tra nsfer type primer and probe to merge simultaneously.When F1 is defined as fluorescent probe, form new real-time fluorescence detection system (Fig. 5).This structure called after STPP.
The fluorescent mark of STPP of the present invention, namely covalently bound fluorescence dye.Particularly, fluorescent mark can be selected from following dyestuff: FAM, VIC, NED, fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPYTMR, texas Red, AlexaFluor and PET etc.Fluorescent quenching group can select DABCYL, BHQ1, BHQ2 etc.
The present invention directly can implement in DNA or RNA target molecule template.
The present invention also provides by way of example for the rapid and correct method detecting pathogenic agent molecule and host molecule.
Beneficial effect of the present invention is mainly that application chain tra nsfer primer provides than conventional PCR primer and more synthesizes initiation site, sensitivity is strengthened, can differentiate sequence variations, specificity is strengthened.The each method of beneficial effect of the present invention also by especially hereinafter pointing out realizes with combination and obtains.
Accompanying drawing explanation
Fig. 1 shows the schematic diagram of the inventive method chain tra nsfer primer.
Fig. 2 shows the amplified reaction schematic diagram of the inventive method chain tra nsfer primer mediation.
Fig. 3 shows the schematic diagram of the multiple chain tra nsfer primer of the inventive method.
Fig. 4 shows the amplified reaction combined with fluorescent probe in detecting schematic diagram of the inventive method chain tra nsfer primer mediation.
Fig. 5 shows the design of the inventive method chain tra nsfer primed probe.
Fig. 6 shows the detection schematic diagram of the inventive method chain tra nsfer primed probe.
Embodiment
In present embodiment, be nucleic acid-templatedly called target molecule by be detected, its base sequence is target sequence.What may contain target molecule is sample by test product.
Sample as object of the present invention is not particularly limited, such as can use come from experimenter whole blood, serum, blood plasma, white corpuscle, urine, ight soil, seminal fluid, saliva, tissue adherence, culturing cell, sputum or tissue etc.Described experimenter can be the microorganisms such as people, animals and plants and virus, bacterium, fungi, chlamydozoan, spirochete, rickettsia and mycoplasma.Extract nucleic acid component by sample, extracting method is not particularly limited.
The schematic diagram of chain tra nsfer primer as shown in Figure 1; In the inventive method, described target molecule from 5 ' end regulation F2 region, F1 region and R1 region successively to 3 ' end, from 3 ' end regulation F2c region, F1c region and R1c region successively to 5 ' end, described region general reference oligonucleotide fragment.Described F2 and F2c region, F1 and F1c region, or R1 and R1c region etc., refer to that two panels is intersegmental in reverse complemental.
In the inventive method, described chain tra nsfer type primer refers to the basic structure that 5 ' F1 and 3 ' side, side R1 is formed.R1 length recommends 18 ~ 25 bases, and F1 length recommends 15 ~ 27 bases, and F2 length recommends 18 ~ 25 bases.Can there be 0 ~ 2 overlapping base at the junction surface of R1 and F1, and preferred G base is overlapping.F2 to R1 region can specify to be more than or equal to a kind of chain tra nsfer type primer.
In the inventive method, the melting temperature(Tm) (Tm) of each primer is described as: the Tm coupling of F2 and R1.In chain tra nsfer primer, the melting temperature(Tm) of F1 fragment is preferably a bit larger tham F2; Be no more than between Tm both coupling herein refers to ± 5 DEG C, be preferably ± 2 DEG C.The proportional range of F2 primer and chain tra nsfer primer concentration: 1:1 ~ 1:5.The archaeal dna polymerase used in present method can be hot resistant DNA polymerase Taq, Tth enzyme etc.
Following Examples is further to explanation of the present invention, should not make limitation of the present invention.
The nucleic acid amplification of embodiment 1HIV-1Gag Partial Fragment
Be detected as example with HIV-1, the application that the present invention relates to chain tra nsfer primer is described.The sample adopted is the H9 cell strain that HIV-1 viral persistence copies, and is intended to illustrate to the application of the inventive method.The capsomere of Gag genes encoding HIV-1 virus, normally the detection target of HIV-1.Gag sequence is obtained, concrete primer information from Genbank:
Gag-F2:ACATAGCAGGAACTACTA(SEQIDNO:1)
Gag-STP:TAAGAATGTATAGCCCTACCAGCAGGAACAAATAGGATGGAT(SEQIDNO:2)
Reaction template is from the H9 Cell extraction DNA calibrated.PCR reaction comprises 1 × PCRbuffer (Takara), 0.1U/ μ LHotStarTaqpluspolymerase (Qiagen), 200 μm of ol/LdNTP, 0.3umol/LGag-F2,0.2umol/LGag-STP, 10ng templates.Response procedures: after 95 DEG C of 5min sex change, 95 DEG C of 15s, 60 DEG C of 45s amount to 45 circulations.After reaction, reaction mixture gets 5uL, and the sepharose with 1.5% carries out electrophoretic analysis, obtains positive amplification band.
The amplification of embodiment 2STAT1 molecule
For the amplification of STAT1 molecule, the application of the present invention to host molecule is described.From 293T cell extraction DNA.The positive control adopted is pcDNA-STAT1 plasmid.
The nucleotide sequence of STAT1 obtains (searching number NM_007315) from GenBank, concrete primer information:
STAT1-F2-1:AAGGACAAGGTTATGTGTATAG(SEQIDNO:3)
STAT1-STP:GAGAACACGAGACCAATGTCAAGAGCCTGGAAGATT(SEQIDNO:4)
PCR reaction comprises 1 × PCRbuffer (Takara), 0.1U/ μ LHotStarTaqpluspolymerase (Qiagen), 200 μm of ol/LdNTP, 0.3umol/LSTAT1-F2-1,0.2umol/LSTAT1-STP, 10ng templates.Response procedures: after 95 DEG C of 5min sex change, 95 DEG C of 15s, 60 DEG C of 45s amount to 45 circulations.After reaction, reaction mixture gets 5uL, and the sepharose with 1.5% carries out electrophoretic analysis, obtains positive amplification band.
The Combination application of embodiment 3 chain tra nsfer primed probe method detects
In the present embodiment, end user STAT1 gene is as nucleic acid similarly to Example 2, carries out the detection citing that chain tra nsfer primer merges probe method.The synthesizing ribonucleotide primer used in the present embodiment is as follows.
STAT1-F2-2:GCTGTTACTCAAGAAGATG(SEQIDNO:5)
STAT1-STPP:
TAATGATGAACTAGTGGAGTA(FAM)ATAGAGTTGCTGAATGTCACTGAAC(BHQ-1)(SEQIDNO:6)
In above-mentioned probe, FAM represents that this probe black matrix A base uses FAM fluorescent reporter group mark, and BHQ1 represents 3 ' end BHQ1 quenching group mark.As previously mentioned, fluorescent emission group and quenching group can change as required.
PCR reaction comprises 1 × PCRbuffer (Takara), 0.1U/ μ LHotStarTaqpluspolymerase (Qiagen), 200 μm of ol/LdNTP, 0.3umol/LSTAT1-F2-2,0.2umol/LSTAT1-STPP, 10ng templates.Response procedures: after 95 DEG C of 5min sex change, 95 DEG C of 15s, 60 DEG C of 45s amount to 45 circulations.
Use the DNA of 293T Cell extraction as template, set up the positive, feminine gender and blank simultaneously.Use ABI-7500 quantitative fluorescent PCR instrument, latter stage is read fluorescent signal in each extension.The inventive method can detect the expression of STAT1 molecule in real time.Detection sensitivity can reach 25 copies/ml, and has good specificity.
Claims (4)
1. utilize the method for chain tra nsfer type primer amplification nucleic acid, it is characterized in that:
(a) design chain tra nsfer type primer;
B () utilizes the nuclease of archaeal dna polymerase to cut described chain tra nsfer type primer, after cutting, primer forms chain tra nsfer, carries out the amplification of target nucleic acid;
Described target nucleic acid, from 5 ' end regulation F2 region, F1 region and R1 region successively to 3 ' end, from 3 ' end regulation F2c region, F1c region and R1c region successively to 5 ' end, described region refers to oligonucleotide fragment, described F2 and F2c region, F1 and F1c region, or R1 and R1c region, refer to that two panels is intersegmental in reverse complemental;
By R1, described chain tra nsfer type primer adds that F1 fragment forms; Described chain tra nsfer refers to that the 5 prime excision enzyme activity cutting chain transfevent primer of archaeal dna polymerase, makes the R1 fragment of chain tra nsfer type primer inside shift, serve as reverse primer in conjunction with R1c region, downstream when the fragment of upstream F3 primer mediation extends to F2 region.
2. the method for claim 1, is characterized in that described target nucleic acid comes host in biological sample or pathogen nucleic acid.
3. utilize chain tra nsfer type primer to merge the method for probe, it is characterized in that 3 ' side F1 of described chain tra nsfer type primer is designed to fluorescent probe.
4. the method as described in claim 1 or 3, it is characterized in that described chain tra nsfer type primer and probe are for design forward or backwards,, chain tra nsfer type primer inside adds exogenous array, artificial sequence or base modification, and uses multiple chain tra nsfer type primer and or probe.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989564.7A CN105506082B (en) | 2015-12-24 | 2015-12-24 | Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510989564.7A CN105506082B (en) | 2015-12-24 | 2015-12-24 | Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105506082A true CN105506082A (en) | 2016-04-20 |
| CN105506082B CN105506082B (en) | 2019-04-09 |
Family
ID=55714372
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510989564.7A Expired - Fee Related CN105506082B (en) | 2015-12-24 | 2015-12-24 | Utilize chain tra nsfer type primer amplification nucleic acid and the method for merging probe |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105506082B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636071A (en) * | 2017-01-17 | 2017-05-10 | 中国科学院过程工程研究所 | Method for synthesizing nucleic acid under constant-temperature condition |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999061661A1 (en) * | 1998-05-27 | 1999-12-02 | Bio Merieux | Method for amplifying at least a particular nucleotide sequence and primers used |
| CN101680029A (en) * | 2007-03-01 | 2010-03-24 | 奥西泰克有限公司 | Nucleic acid detection |
-
2015
- 2015-12-24 CN CN201510989564.7A patent/CN105506082B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999061661A1 (en) * | 1998-05-27 | 1999-12-02 | Bio Merieux | Method for amplifying at least a particular nucleotide sequence and primers used |
| CN101680029A (en) * | 2007-03-01 | 2010-03-24 | 奥西泰克有限公司 | Nucleic acid detection |
Non-Patent Citations (2)
| Title |
|---|
| QUAN HE ET AL.: "Exonuclease of human DNA polymerase gamma disengages its strand", 《MITOCHONDRION》 * |
| 鲍艳艳: "核酸分子探针结合信号放大技术用于核酸的检测", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636071A (en) * | 2017-01-17 | 2017-05-10 | 中国科学院过程工程研究所 | Method for synthesizing nucleic acid under constant-temperature condition |
| CN106636071B (en) * | 2017-01-17 | 2020-07-17 | 中国科学院过程工程研究所 | Method for synthesizing nucleic acid under constant temperature condition |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105506082B (en) | 2019-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102246600B1 (en) | Probes for improved melt discrimination and multiplexing in nucleic acid assays | |
| MX2014012214A (en) | Compositions and methods for quantifying a nucleic acid sequence in a sample. | |
| CN102099488B (en) | Method for amplifying oligonucleotide and small RNA by using polymerase-endonuclease chain reaction | |
| CN105803074A (en) | Primer-type nucleic acid fluorescent probe subjected to two-way strand displacement | |
| KR102488559B1 (en) | Strand-invasion based dna amplification method | |
| JP6707072B2 (en) | Nucleic acid for nucleic acid amplification | |
| CN102643910B (en) | Application of asymmetric multicolor fluorescence hairpin probe chain reaction in pathogenic bacterium detection | |
| KR20190137718A (en) | Method for Detecting Target Nucleic Acid Using Rolling Circle Amplification and Composition for Detecting Target Nucleic Acid | |
| CN100577816C (en) | Fluorescence labeling oligonucleotide probe and uses thereof | |
| US7919244B2 (en) | Nucleic acid detection method involving the direct generation of a measurable signal | |
| CN105018593A (en) | Methods for detecting pathogen in coldwater fish | |
| CN113736858B (en) | Real-time monitoring method for nucleic acid amplicon mediated by cyclic oligonucleotide probe | |
| US11926870B2 (en) | Restriction mediated quantitative polymerase chain reactions | |
| CN110023507B (en) | Method for detecting small RNAs or proteins associated with small RNAs | |
| CN108642165A (en) | A kind of probe and its application method for real-time fluorescence PCR | |
| CN105734117A (en) | Method for detecting nucleic acid target to-be-detected sites by virtue of universal primers | |
| CN104404162A (en) | Real-time fluorescence PCR method for detecting multiple genes or different targets with primer associated universal probe | |
| CN105506082A (en) | Method for amplifying nucleic acid and fusing probe by utilizing chain transfer primer | |
| CN106868111A (en) | Using the method and kit of universal TaqMan probe detection SNP | |
| WO2023203206A1 (en) | Multiplexable crispr-cas9-based virus detection method | |
| CN105734116A (en) | Detection method of multiplex nucleic acid sites | |
| Whitman et al. | Real-time polymerase chain reaction detection methods | |
| CN114621996A (en) | Method for detecting activity of one or more polymerases | |
| CN112608913B (en) | Gene expression regulation and control system based on C2C2 and application thereof | |
| US20230043703A1 (en) | Detection of genetic variants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190409 Termination date: 20211224 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |