CN102643910B - Application of asymmetric multicolor fluorescence hairpin probe chain reaction in pathogenic bacterium detection - Google Patents

Abstract

The invention relates to application of an asymmetric multicolor fluorescence hairpin probe chain reaction in pathogenic bacterium DNA (deoxyribonucleic acid) detection, belonging to the field of biotechnological detection. In the invention, in combination with the asymmetric hairpin probe chain reaction technology and the FRET (fluorescence resonance energy transfer) technology, a pathogenic bacterium detection technology based on the asymmetric multicolor fluorescence hairpin probe chain reaction technology is established. If no target sequence exists in the system, the hairpin probe is in a sub-stable state, two groups form an FRET pair, and no fluorescence signal is generated; when the target sequence is added to the reaction system to trigger the chain polymerization reaction, the hairpin structure is opened, and a fluorescence signal is generated; and due to linear amplification, the strength of the fluorescence signal is directly proportional to the copy number of the target sequence. In the method provided by the invention, by introducing the high-sensitivity multicolor FRET technology into the chain reaction, a simple, quick and sensitive pathogenic bacterium DNA direct detection method is established, and the shortcoming of lower sensitivity of the agarose gel electrophoresis observation detection result in the chain reaction of the traditional asymmetric hairpin probe is overcome.

Description

The application of asymmetric multicolor fluorescence hairpin probe chain reaction in detection of pathogens

Technical field

The present invention relates to a kind of bioreaction technology, particularly relate to based on asymmetric multicolor fluorescence hairpin probe chain reaction and applying in detection of pathogens.

Background technology

Molecular diagnostics method detects according to bacterial nucleic acid feature, for clinical disease pathogenic microorganism rapid detection has been brought new opportunity.The priority of the detection methods such as nucleic acid molecule solid-phase hybridization method, DNA sequencing method, capillary electrophoresis analysis, biochip technology is set up, bacteria molecule detection method is brought up to a brand-new stage, but these molecular diagnostics methods need special large-scale instrument mostly, technical difficulty is large, is difficult in clinical middle popularization and application.Therefore, for the problems referred to above, if develop a kind ofly based on novel probe technology, quick, special, the easy molecular diagnostics method of multiple pathogenic bacteria gene group being carried out to parallel detection, to advancing the practical obvious tool that molecular diagnosis learns a skill to be of great significance.

The patent name of Applied Gene Technologies company is " hair clip shape Nucleic Acid Probe Technique " (Nucleic Acid Hairpin Probes), the patent No. is 6380377 to relate to a kind of stem annular DNA probe technique, more stable with the single stranded nucleic acid probe structure compared of standard, enzyme reaction is more efficient, more responsive to mispairing, produced non-specific target position combination still less.These advantages have all improved the specificity of genetic analysis.Compare with the technology such as traditional PCR, solid-phase nucleic acid hybridization, this technology has advantages of more outstanding: detection efficiency is high, and detection speed is fast, and this technology is carried out molecular recognition simultaneously and cascade signal amplifies, and can in 10 minutes, complete detection of nucleic acids; Reaction system is simple, without enzyme and other complicated molecular biology reagent; Single tube reaction, all detections are carried out in single stopped pipe, and operation steps is simple, and has effectively avoided conventional art problem, the problem includes: laboratory pollution problem; The method is also applicable to integrating with other detection methods.

FRET (fluorescence resonance energy transfer) (Fluorescence resonance Energy Transfer, FRET) technology refers to when the fluorescence spectrum of a fluorescence molecule (be called not only donor molecule) and the excitation spectrum overlaid of another fluorescence molecule (but also being called acceptor molecule), and when close for, acceptor space length (being generally 7～10nm), the excitation energy of donor fluorescence molecule is brought out acceptor molecule and is sent fluorescence, the fluorescence intensity of donor fluorescence molecule self decay simultaneously, this phenomenon is called as FRET (fluorescence resonance energy transfer).The features such as that FRET technology has is highly sensitive, specificity strong, favorable reproducibility, and can avoid the impact of scattered light, than conventional fluorescent method and Resonance Light Scattering Method, there is stronger immunity from interference.FRET technology has been widely used in the aspects such as biology and medical research.FRET probe is confession-acceptor pair that resonance energy shifts, and is mainly divided into following a few class: fluorescin, organic fluorescent dye, group of the lanthanides dyestuff and quantum dot, wherein organic fluorescent dye is of a great variety, is widely used, can select as required applicable dyestuff, and can use with other class probe pairing.

Summary of the invention

The present invention has designed a kind of asymmetric hairpin probe chain reaction technology, combine dexterously the high efficiency of high specific and the chain polymerization of molecular hybridization, the free energy discharging by DNA polymerization drives molecule cascade to amplify, and high-sensitive multicolor fluorescence resonance energy transfer techniques is incorporated in chain reaction, thereby set up a kind of simple, quick, sensitive pathogenic bacteria DNA detection method.

The application of asymmetric multicolor fluorescence hairpin probe chain reaction in pathogenic bacteria DNA detection, comprise solution hybridization chain reaction system, in described reaction system, add simultaneously and have asymmetric hairpin probe 1 and asymmetric hairpin probe 2 and target sequence to be measured, asymmetric hairpin probe 1 wherein, comprise palindromic sequence, article two, stem arm and be connected in a sticky end on stem arm, described two stem arms are connected in the two ends of palindromic sequence and have complementary nucleotide sequence, described palindromic sequence is the sequence irrelevant with target sequence to be measured, the connected sticky end of described stem arm has the complementary nucleic acid sequence of target sequence, asymmetric hairpin probe 2 wherein, comprise palindromic sequence, article two, stem arm and be connected in a sticky end on stem arm, described two stem arms are connected in the two ends of palindromic sequence and have complementary nucleotide sequence, a coupled stem arm of described palindromic sequence has target sequence, on described another stem arm connected sticky end have with asymmetric hairpin probe 1 in the complementary nucleic acid sequence of palindromic sequence, 5 ' end of 5 ' end of described asymmetric hairpin probe 1 and 3 ' end difference mark fluorescent acceptor molecule and fluorescence donor molecule or asymmetric hairpin probe 2 and 3 ' end be mark fluorescent donor molecule and fluorescent receptor molecule respectively.

Described fluorescence donor molecule and fluorescent receptor molecule mark respectively in the two ends of asymmetric hairpin probe 2.

Described fluorescence donor molecule is organic fluorescent dye FAM and HEX, and fluorescent receptor molecule is BHQ1.

The sticky end of described asymmetric hairpin probe 1 is positioned at 5 ' end, and the sticky end of described asymmetric hairpin probe 2 is positioned at 3 ' end; Or the sticky end of described asymmetric hairpin probe 1 is positioned at 3 ' end, the sticky end 5 ' end of described asymmetric hairpin probe 2.

Preferred: the sticky end of described asymmetric hairpin probe 1 is positioned at 5 ' end, the sticky end of described asymmetric hairpin probe 2 is positioned at 3 ' end.

Described sticky end is 6-8 base.

The 16S rDNA sequence that described target sequence to be measured is bacterium.

Described bacterium is Pseudomonas aeruginosa, and described asymmetric hairpin probe 1, asymmetric hairpin probe 2 and target sequence to be measured are respectively:

PA-H1：CGTCCTGAGGGAGAAAGTGGGGGTCAAAGTACCCCCACTTTCTCCCTC，

PA-H2：ACCCCCACTTTCTCCCTCAGGACGGAGGGAGAAAGTGGGGGTACTTTG，

Tpa：ACCCCCACTTTCTCCCTCAGGACG。

Described bacterium is Klebsiella Pneumoniae, and described asymmetric hairpin probe 1, asymmetric hairpin probe 2 and target sequence to be measured are respectively:

KP-H1：

GGTGACGAGTGGCGGACGGGTGAGTTCAAAGTCTAACTCACCCGTCCGCCAC，

KP-H2：

AACTCACCCGTCCGCCACTCGTCACCGTGGCGGACGGGTGAGTTAGACTTTG，

Tkp：AACTCACCCGTCCGCCACTCGTCACC。

Its ultimate principle of asymmetric hair clip is: two specificity self-assembly probes are comprised of target nucleic acid distinguished sequence and a palindromic sequence, in the situation that existing without target sequence, in metastable hairpin structure, once and add target sequence to be measured, trigger the chain polymerization reaction participating in without enzyme, target nucleic acid distinguished sequence part and the site combination of corresponding target nucleic acid of now specificity self-assembly probe, all the other probes between two renaturation become two sections of partially double stranded probes that are palindromic sequence, in molecular recognition hybridization, strengthen significantly detection signal, thereby realized the rapid detection of target sequence to be measured.

This research combine asymmetric hairpin probe chain reaction technology and FRET technology, set up a kind of detection of pathogens technology based on asymmetric multicolor fluorescence hairpin probe chain reaction technology.In this preferred method, using organic fluorescent dye (FAM and HEX) as fluorescence donor, BHQ1 is marked on respectively hairpin probe two ends as fluorescent receptor, while existing without target sequence in system, hairpin probe is in metastable condition, and two groups form FRET couple, without fluorescent signal, produce; And when target sequence adds reaction system to trigger chain polymerization reaction, hairpin structure is opened, produce fluorescent signal, and owing to being linear amplification, fluorescence signal intensity is directly proportional (as shown in Figure 1) to target sequence copy number.In inventive method, high-sensitive multicolor fluorescence resonance energy transfer techniques is incorporated in chain reaction, thereby set up a kind of simple, quick, sensitive pathogenic bacteria DNA direct detecting method, when having overcome former asymmetric hairpin probe and carrying out chain reaction, agarose gel electrophoresis is observed the lower defect of detected result sensitivity.

In an embodiment of the present invention, the specific nucleic acid target sequence of directed toward bacteria, the asymmetric hairpin probe of design multiple specific, in conjunction with FRET technology, provides a kind of efficient, sensitive signal detecting method, can realize the object of fast parallel bacterial detection.

Accompanying drawing explanation

Fig. 1. asymmetric hairpin probe chain reaction technical schematic diagram

H1, H2L, I in figure: hairpin probe 1, hairpin probe 2, target sequence to be measured; A and a, B and b, C and c are complementary nucleic acid sequence,

● be fluorescent receptor, ★ is gleaming light donor,

Fig. 2: pcr amplification product,

M:DL2,000DNA maker, K:Kpn PCR product, P:P.aer PCR product ,-: blank

Fig. 3: PCR expansion product enzyme is cut,

M:DL2,000DNA maker, K*:Kpn enzyme is cut product, and P*:P.aer enzyme is cut product, K:Kpn PCR product, P:P.aer PCR product,

Fig. 4: PA group different concns target sequence fluorescence HCR,

Wherein, A: exist without target sequence; B: target sequence concentration is 1 μ M; C: target sequence concentration is 0.5 μ M; D: target sequence concentration is 0.1 μ M; E: target sequence concentration is 0.05 μ M; F: target sequence concentration is 0.01 μ M,

Fig. 5: KP group different concns target sequence fluorescence HCR,

Wherein, A: exist without target sequence; B: target sequence concentration is 1 μ M; C: target sequence concentration is 0.5 μ M; D: target sequence concentration is 0.1 μ M; E: target sequence concentration is 0.05 μ M; F: target sequence concentration is 0.01 μ M,

The fluorescence HCR of Fig. 6: PA group different concns asymmetric PCR product,

A:1 μ l single stranded DNA wherein; B:2 μ l single stranded DNA; C:3 μ l single stranded DNA; D:4 μ l single stranded DNA; E:5 μ l single stranded DNA; F:6 μ l single stranded DNA; G: exist without single stranded DNA; H: exist without probe

The fluorescence HCR of Fig. 7: KP group different concns asymmetric PCR product,

A:1 μ l single stranded DNA wherein; B:2 μ l single stranded DNA; C:3 μ l single stranded DNA; D:4 μ l single stranded DNA; E:5 μ l single stranded DNA; F:6 μ l single stranded DNA; G: exist without single stranded DNA; H: exist without probe.

Embodiment

Principle of the present invention as shown in Figure 1.

(A) thus the strand replacement reaction that target sequence I to be measured starts to occur strict base pairing from the sticky end of probe H1 is opened the hairpin structure of probe, produce new sticky end;

(B) sticky end of H1 and the sticky end of H2L react and continue to open the hairpin structure of probe, quencher group and reporter group spacing increase, produce fluorescent signal, alternately hybridization occurs between probe H1 and H2L then, form significantly amplifying signal of chain polymerization body.

Specific embodiments of the invention are mainly in two kinds of pathogenic bacterias, and those skilled in the art can be applied to the detection of any micro-raw body according to principle of the present invention, as long as find suitable target sequence specific to be measured.

1, the design of the asymmetric HCR hairpin probe of specificity

Adopt Array Designer4.0 and the asymmetric hairpin-type probe of Primer Premier5.0 software design, with Omiga2.0 software carry out between probe, the complementarity analysis of probe and target sequence, in the time of designing probe, base corresponding on the position of sequence intermediate demand mark quencher group need be designed to T, to quencher group can be connected on probe.The alternative probe sequence of design submits to Genbank database to carry out specificity analyses, and the probe designing is submitted to http:// mfold.rna.albany.edu/

The prediction of secondary structure is carried out in website, has further verified specificity and the validity of designing probe.

Table 1: probe and target sequence design

Pseudomonas aeruginosa HCR probe	?
		PA-H1	CGTCCTGAGGGAGAAAGTGGGGGTCAAAGTACCCCCACTTTCTCCCTC
PA-H2L	ACCCCCACTTTCTCCCTCAGGACGGAGGGAGAAAGTGGGGGTACTTTg
		Tpa	ACCCCCACTTTCTCCCTCAGGACG
Klebsiella Pneumoniae HCR probe	?
		KP-H1	GGTGACGAGTGGCGGACGGGTGAGTTCAAAGTCTAACTCACCCGTCCGCCAC

KP-H2L	AACTCACCCGTCCGCCACTCGTCACCGTGGCGGACGGGTGAGTTAGACTTTG
		Tkp	AACTCACCCGTCCGCCACTCGTCACC

2, the genomic dna of extraction is carried out to PCR experiment, prepare strand PCR product.

Primer 16S-a5 ' end mark PO ₄group, is beneficial to downstream and carries out endonuclease reaction.

Reaction system is as follows:

Table 2:PCR amplification reaction system

Reaction conditions is as follows:

94 ℃ of denaturations, 5min; 94 ℃ of sex change, 60s; Anneal 53 ℃, 45s; Extend 72 ℃, 45s; 30 circulations; Extend 72 ℃, 10min, 4 ℃ of preservations.

PCR reaction product is carried out 1.0% agarose gel electrophoresis, every hole 5.0 μ l loadings.

Experimental result as shown in Figure 2, is carried out pcr amplification with designed universal primer, the visible obviously object band of electrophoresis, and amplified production can be used for enzyme and conscientiously tests.

3, exonuclease λ digestion PCR product

PCR product is digested with exonuclease λ, prepare single stranded DNA (ssDNA).

Reaction system is: get 45 μ l PCR reaction product, add 5 μ l10 * Reacton Buffer, then add 10U exonuclease λ.

Reaction conditions: reaction system is placed in to 37 ℃ of water-bath 5min.Termination reaction in 80 ℃ of water-baths.

As shown in Figure 3, PCR product is after exonuclease λ digestion for its result, and double-stranded DNA reduces in a large number, and it is higher that enzyme is cut efficiency, and gained single stranded DNA can be used for carrying out downstream experiment.

4, different concns target sequence fluorescence HCR experiment:

3.0 μ l fluorescence HCR reaction systems comprise: the probe H10.1 μ l of 40uM; The probe H2L0.1 μ l of 40uM; 3 * HBV buffer1 μ l; Sterilized water 0.8 μ l; The target sequence I1.0 μ l of different concns.Reaction conditions is as follows: 99 ℃, and 8min; 50 ℃, 1h; 4 ℃ of preservations.HCR reaction product is transferred in kapillary to the centrifugal 2min. of 3,000rpm.By kapillary as for causing fluorescence microscopy Microscopic observation fluorescence and taking a picture.

As shown in Figure 4, Figure 5, designed HCR specific probe all can successfully start cross chain reaction to experimental result, and the chain reaction without enzyme effect occurs, and hairpin probe structure is opened, and fluorescence donor molecule sends fluorescence under the exciting light of the light of certain wavelength.When initial target sequence concentration is more than or equal to 0.1 μ M, can be observed obvious fluorescence, when target sequence reaches 0.4pmol in 12 μ l reaction systems, fluorescence can be detected, illustrate that designed probe has good specificity and susceptibility.

5, the fluorescence HCR of strand PCR product experiment

With single stranded DNA prepared by above asymmetric PCR method, be template, carry out fluorescence HCR experiment.

Reaction system is as follows:

Table 3: the fluorescence HCR reaction system of strand PCR product

HCR reaction product is transferred in kapillary to the centrifugal 2min. of 3,000rpm.Kapillary is also taken a picture as for observing fluorescence under inverted fluorescence microscope.

As shown in Figure 6,7, PCR product enzyme is cut product can trigger cross chain reaction to experimental result, produces fluorescence, and fluorescence intensity increases and raises with the asymmetric PCR product amount adding.We constructed fluorescent hybridization chain reaction method can be used for actual the pathogenic microorganism examination this results suggest.

Claims (2)

1. the application of asymmetric multicolor fluorescence hairpin probe chain reaction in the pathogenic bacteria DNA detection of non-diagnosis or non-therapeutic purpose, comprise solution hybridization chain reaction system, in described reaction system, add simultaneously and have asymmetric hairpin probe 1 and asymmetric hairpin probe 2 and target sequence to be measured, asymmetric hairpin probe 1 wherein, comprise palindromic sequence, article two, stem arm and be connected in a sticky end on stem arm, described two stem arms are connected in the two ends of palindromic sequence and have complementary nucleotide sequence, described palindromic sequence is the sequence irrelevant with target sequence to be measured, the connected sticky end of described stem arm has the complementary nucleic acid sequence of target sequence, asymmetric hairpin probe 2 wherein, comprise palindromic sequence, article two, stem arm and be connected in a sticky end on stem arm, described two stem arms are connected in the two ends of palindromic sequence and have complementary nucleotide sequence, a coupled stem arm of described palindromic sequence has target sequence, on another stem arm connected sticky end have with asymmetric hairpin probe 1 in the complementary nucleic acid sequence of palindromic sequence, 5 ' end of described asymmetric hairpin probe 2 and 3 ' end be mark fluorescent donor molecule and fluorescent receptor molecule respectively, the sticky end of described asymmetric hairpin probe 1 is positioned at 5 ' end, the sticky end of described asymmetric hairpin probe 2 is positioned at 3 ' end, described sticky end is 6 bases, the 16S rDNA sequence that described target sequence to be measured is bacterium,

Described bacterium is Pseudomonas aeruginosa, and described asymmetric hairpin probe 1, asymmetric hairpin probe 2 and target sequence to be measured are respectively:

PA-H1：CGTCCTGAGGGAGAAAGTGGGGGTCAAAGTACCCCCACTTTCTCCCTC，

PA-H2L：ACCCCCACTTTCTCCCTCAGGACGGAGGGAGAAAGTGGGGGTACTTTG，

Tpa：ACCCCCACTTTCTCCCTCAGGACG。

2. application according to claim 1, described fluorescence donor molecule is organic fluorescent dye FAM and HEX, fluorescent receptor molecule is BHQ1.