CN105505963A - BSMV-VIGS recombinant vector and application thereof to wheat yield trait gene research - Google Patents

BSMV-VIGS recombinant vector and application thereof to wheat yield trait gene research Download PDF

Info

Publication number
CN105505963A
CN105505963A CN201510970347.3A CN201510970347A CN105505963A CN 105505963 A CN105505963 A CN 105505963A CN 201510970347 A CN201510970347 A CN 201510970347A CN 105505963 A CN105505963 A CN 105505963A
Authority
CN
China
Prior art keywords
bsmv
tarsr1
wheat
plasmid
recombinant vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510970347.3A
Other languages
Chinese (zh)
Inventor
康国章
刘国玉
郭天财
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Agricultural University
Original Assignee
Henan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Agricultural University filed Critical Henan Agricultural University
Priority to CN201510970347.3A priority Critical patent/CN105505963A/en
Publication of CN105505963A publication Critical patent/CN105505963A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/00021—Viruses as such, e.g. new isolates, mutants or their genomic sequences

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a BSMV-VIGS recombinant vector. The recombinant vector is virus RNA containing a target gene segment, a phage f1 ori, an inhibiting factor laci, an escherichia coli E1 factor ori, a beta-lactamase gene bla and a T7 promoter, wherein the target gene segment is a partial cDNA sequence of mRNA of a transcription factor TaRSR1 shown in the SEQ ID NO.1. A preparation method of the recombinant vector comprises the steps of cloning of the partial cDNA sequence of the mRNA of the transcription factor TaRSR1 and construction and transformation of a BSMV-gamma: TaRSR1 recombinant vector. The invention also discloses virus inoculation mixed liquid containing BSMV-alpha, BSMV-beta and the BSMV-gamma: TaRSR1 recombinant vector described in claim 2 in equal volume and application of the recombinant vector to wheat yield increase or breeding. By utilizing the BSMV-VIGS recombinant vector, an effective method for research on wheat yield trait gene functions can be created on natural field conditions, and it is beneficial to deep revelation of the molecular mechanism of the wheat yield trait gene functions to guide breeding of wheat.

Description

BSMV-VIGS recombinant vectors and the application in Yield Traits of Wheat gene studies thereof
Technical field
The invention belongs to agricultural application biological technical field, particularly relate to a kind of BSMV-VIGS recombinant vectors and the application in Yield Traits of Wheat gene studies thereof.
Background technology
Virus induced gene silencing (virus-inducedgenesilencing, VIGS) system is the novel method that development in recent years gets up to study gene function, its principle is mainly: after the virus vector carrying target gene cDNA contaminates vegetable cell, the intermediate (dsRNA) of double-stranded RNA form can be formed in replication and expression process in vegetable cell, dsRNA is as the exciton of gene silencing, first in cell, the RNA(siRNA of small segment is cut into by specific nucleic acid restriction endonuclease), then siRNA is increased further by RNA polymerase in vegetable cell, and combine with single stranded form and some differential proteins (AGO1) etc. the silencing complex forming RNA and induce, this silencing complex is special again to be done mutually with cognate rna in kytoplasm, cause cognate rna to degrade and cause the gene silencing of generation post-transcriptional level.
Wheat is one of three large important food crop in the world, wherein common wheat ( triticumaestivuml.) output accounts for whole world wheat and always produces more than 90%.Common wheat is allohexaploid, overlap genome containing A, B and D tri-, there are 3 or more copies in the gene of more than 95%, the very huge (17000Mb of its genome, 40 times and 7 times of paddy rice and Maize genome respectively), and complex structure (more than 85% sequence is tumor-necrosis factor glycoproteins); Meanwhile, the regenerative power significant difference because the dependency of wheat genotypes is very strong, between kind, causes stable regeneration system not yet to be set up, becomes one of crop of the most difficult conversion in the world now.The research that these principal elements result in wheat molecule mechanism now far lag behind genome less, transform other staple crops such as relatively easy paddy rice.Although more existing wheat adversity genes transform in Arabidopis thaliana, tobacco and paddy rice etc. and are comparatively easy to plant has carried out functional verification, but for control Wheat Starch, protein equal yield line character gene, due to the otherness of yield traits between species and growing environment, (paddy rice etc. belong to the autumn grain crop of happiness temperature, grow in temperature higher summer; And wheat belongs to the cool winter crop of happiness, most of the time growth is in temperature lower winter and spring), the function of Yield Traits of Wheat gene be not suitable for simple at genomes such as paddy rice, transform and be easy to crop carries out.Therefore, find out a kind of research method of applicable research Yield Traits of Wheat gene function, contribute to the molecule mechanism that deep announcement Yield Traits of Wheat is formed.
VIGS method overcomes the limitation of genetic transformation difficulty plant gene function research method, mainly contain following advantage: the phenotype of the direct identified gene afunction in individuality of (1) VIGS energy, without the need to screening a large amount of regeneration plant individuality identify transfer-gen plant by expending the longer time, can Rapid identification gene function; (2) it is a kind of transient gene silencing methods, does not need complicated genetic conversion system; (3) silence is carried out to overcome gene function redundancy phenomena by the sequence conservative to gene family camber; (4) function of same gene in different plant species can be compared fast, to compare genomics research.Above-mentioned advantage is for genetic transformation difficulty and the huge and common wheat of complexity of genome, and very applicable, therefore, VIGS has started application in wheat cdna functional study.
But use both at home and abroad now the function of VIGS technique study wheat cdna all in laboratory culture case or in greenhouse etc. under easy control condition (growth conditions that the temperature that manually can set, humidity, illumination etc. are controlled) carry out the functional study of wheat adversity gene.But there is different with the upgrowth situation of the wheat plant under the changeable condition in field under incubator or greenhouse controlled condition.As wheat vine growth and development in incubator or greenhouse show that tillering capacity is poor, reduction in the life period, the early ageing of late growth stage plant, thousand seed weight are lower, output significantly lower than the phenomenon such as wheat plant of field growing, causes under incubator or greenhouse, utilize VIGS technique study wheat cdna function, the particularly function of yield traits gene to have certain limitation.
Summary of the invention
The object of the present invention is to provide a kind of BSMV-VIGS recombinant vectors, utilize this carrier can under the natural condition of field, set up a kind of effective ways studying Yield Traits of Wheat gene function, be conducive to the molecular mechanism of deep announcement Yield Traits of Wheat gene function, to instruct the breeding work of wheat.
Research Thinking of the present invention is: utilize barly strip mosaic virus (barleystripemosaicvirus, BSMV) recombination to construct to contain the BSMV carrier system (as shown in Figure 1) of the different single stranded RNA of α, β and γ tri-.Respectively by after the RNA reverse transcription of above-mentioned three chains synthesis cDNA, be cloned on corresponding pBSMV carrier.This carrier includes T 7promotor and transcribe initial point, by T 7rNA polymerase for transcribing outside template body, obtains viral RNA with linearizing BSMV carrier, and after this equivalent of rna transcription frictional inoculation plant of transcribing 3 chains obtained, viral RNA can form the activated genome of tool in plant materials, carries out propagation propagation.One is had after γ b nhei restriction enzyme site, can be building up on BSMV-γ carrier by molecular cloning by target gene fragment, target gene fragment can be copied along with viral copying of autogene group, and by the reticent target gene of post-transcriptional level.
For completing above-mentioned purpose, the present invention realizes by the following technical solutions:
Construct a kind of BSMV-γ: TaRSR1 recombinant vectors, it is for containing target gene fragment, phage f1ori, supressor laci, intestinal bacteria E1 factor ori, β-lactamase gene bla, T 7the viral RNA of promotor, described target gene fragment is for shown in SEQIDNO.1 taRSR1transcription factor mRNA Partial cDNA Sequence.
The preparation method of above-mentioned recombinant vectors, comprises the following steps:
(1) clone of TaRSR1 transcription factor mRNA partial cDNA fragment
Extract the total serum IgE of wheat grain, and by the reverse transcription acquisition cDNA corresponding with wheat total serum IgE, get gained cDNA as template, pass through pcr amplification taRSR1transcription factor fragment sequence, carries out electrophoresis detection with gained amplified production, cuts glue recovery, recovery gained amplified production is connected to pMD18-Tsimple carrier, then transformation of E. coli DH5 α, and then, the positive monoclonal that picking is authenticated, carries out order-checking qualification;
(2) BSMV-γ: TaRSR1 recombinant vectors structure, transform with screen
Get order-checking correct TaRSR1-pMD18-Tsimple plasmid and BSMV-γ: GFP plasmid use restriction enzyme respectively nhei single endonuclease digestion, then carry out electrophoresis detection, cut glue reclaim, obtain TaRSR1 gene fragment and the BSMV-γ plasmid of purifying respectively;
Use T 4taRSR1 gene fragment after purifying is connected to the BSMV-γ plasmid after purifying by-DNA ligase, obtain BSMV-γ: TaRSR1 recombinant vectors, be converted into competence e. coli jm109 again, be coated on LB plate culture medium, LB plate culture medium grows single bacterium colony through 37 DEG C of incubated overnight, gained list bacterium colony is carried out successively PCR checking, recombinant plasmid digestion verification and order-checking qualification, select positive bacterium colony, obtain BSMV-γ: TaRSR1 recombinant vectors.
By isopyknic BSMV-α, BSMV-β and above-mentioned BSMV-γ: TaRSR1, add after DEPCwater and 2 × GKPbuffer etc. mix, make the virus inoculation mixed solution that each carrier concn is 500 μ g/ml, the research of available Yield Traits of Wheat gene function, be used to guide wheat breeding work, also directly can use it for wheat increase yield.
The preparation method of above-mentioned virus inoculation mixed solution, comprises the following steps:
(1) BSMV vector linearization
Use restriction enzyme mlui is single endonuclease digestion BSMV-α plasmid and claim 2 gained BSMV-γ: TaRSR1 recombinant plasmid respectively, makes its linearizing; Use restriction enzyme spei single endonuclease digestion BSMV-β plasmid, makes its linearizing;
(2) in-vitro transcription produces virus
Get gained linearizing BSMV-α, BSMV-β and BSMV-γ: TaRSR1 carrier DNA carries out in-vitro transcription, detection and preservation respectively;
(3) preparation of virus inoculation mixed solution
Get isopyknic BSMV-α, BSMV-β, BSMV-γ: TaRSR1, mix to 2 × GKPbuffer of BSMV-α volume with 9 times of DEPCwater and 12 to BSMV-α volume times.
Study the method for Yield Traits of Wheat gene function under the natural condition of field, comprise the following steps:
In wheat heading stage, create in field a high humidity (humidity more than 85%), dusk the low light level, 18 ~ 22 DEG C of low temperature environment, with the friction of above-mentioned BSMV-VIGS silent carrier virus inoculation mixed solution, wheatear portion inoculates; After inoculation, keep high humidity environment (wheat plant film shed covers, and be in the space of relative closure, humidity reaches more than 85%) in flowering stage of wheat and filling stage; Meanwhile, inoculate and within 7 days, dock the transcriptional level detection that plant carries out Phenotypic Observation, target gene afterwards, time ripe, carry out yield traits mensuration.
the present invention has following positive Advantageous Effects:
1. recombinant vectors of the present invention achieves the silence of Yield Traits of Wheat gene under field condition, changes the situation of current Yield Traits of Wheat gene functional research comparatively difficulty, has broken traditional VIGS method mainly in the present situation of experiment indoor application; This recombinant vectors can carry out crop gene functional analysis fast, simple to operate and Be very effective (success ratio of inoculation reaches more than 50%), and the field VIGS reticent effectively time length (about 35d) covers the filling stage of seed, effectively last longer than VIGS effective time length (about 28d) in greenhouse now.
2. the present invention carries out the test of Yield Traits of Wheat gene function in field, and result more truly can reflect the function of gene in yield traits.
3. according to the experimental skill that the experimental technique in the present invention and agriculture field researchist possess; method of the present invention can be applied on the higher species of wheat homology by this area researchist; such as barley, millet, paddy rice, Chinese sorghum, corn etc., these ranges of application are all within the spirit and scope of the claims of the present invention.
Accompanying drawing explanation
Fig. 1 is the primary structure schematic diagram of BSMV carrier;
Fig. 2 is the expression amount of TaRSR1 transcription factor and the dependency comparison diagram of Starch-synthesizing genes expression amount;
Note: in figure, TaAGPS1-a, TaAGPL1, TaGBSSI, TaSSI, TaSSIIa, TaSSIV, TaBEI, TaBEIIb, TaPUL, TaPHOL and TaDPE1 are Enzymes involving in starch synthesis gene;
Fig. 3 is the structural representation of recombinant plasmid BSMV-γ: TaRSR1 built;
Note: in figure, ori is the intestinal bacteria E1 factor, and laci is supressor, and f1ori is phage, bla is β-lactamase gene, and T7 is promotor, nhei is restriction enzyme site, and TaRSR1 is goal gene;
Fig. 4 is recombinant plasmid BSMV-γ: TaRSR1 restriction enzyme digestion and electrophoresis collection of illustrative plates;
Note: M.DL2000marker; Swimming lane 1,3 and 5 is BSMV-γ: TaRSR1 recombinant plasmid; Swimming lane 2,4 and 6 cuts out object fragment for BSMV-γ: TaRSR1 recombinant plasmid enzyme;
Fig. 5 is the electrophoretogram that in-vitro transcription produces BSMV viral product;
Note: M.DL10,000marker; Swimming lane 1-4 is BSMV-α, BSMV-β, BSMV-γ: TaRSR1, BSMV-γ: GFP respectively;
Fig. 6 is wheat growing environment figure;
Fig. 7 is the reticent wheat plant of 22d after inoculation and GFP adjoining tree phenotypic map;
Fig. 8 is in reticent wheat plant and GFP adjoining tree seed taRSR1the comparison diagram of transcriptional level;
Note: dpi is postvaccinal number of days; * represent difference reach pole conspicuous level ( pbe less than 0.01), * represent difference reach conspicuous level ( pbe less than 0.05); A, with actin(Actin muscle) gene contrasts as internal reference; B, with gAPDH(glyceraldehyde 3-phosphate dehydro-genase) gene contrasts as internal reference;
Fig. 9 be reticent plant with adjoining tree ripening stage Wheat Starch content and thousand seed weight contrast figure;
Note: * represent difference reach conspicuous level ( pbe less than 0.05); A, Wheat Starch content; B, wheat grain thousand seed weight.
Embodiment
Below by embodiment, the present invention is specifically described; what be necessary to herein means out is that following examples are only applicable to be further described the present invention; can not be interpreted as limiting the scope of the invention, these those skilled in the art can make some nonessential improvement and adjustment according to the invention described above content to the present invention.
Carrier involved in the present invention or plasmid, as BSMV-α, BSMV-β, BSMV-γ: GFP, pMD18-Tsimple etc. are known carrier or plasmid, can build voluntarily or commercial acquisition, BSMV-α, BSMV-β involved in following examples, BSMV-γ: GFP, pMD18-Tsimple all originate Inst. of Genetics and Development Biology, CAS; Other test reagent involved by embodiment is then commercial, involved test method if no special instructions, detection method is then ordinary method if no special instructions.
The present invention's important gene AP2/EREBP class transcription factor- taRSR1(starchregulator1) for example is tested.Starch is the most important component of wheat grain (accounting for more than 70% of seed content), and contriver's early-stage Study finds taRSR1be remarkable negative correlation (see Fig. 2) with the expression of 11 wheat starch genes, show that this transcription factor has played critical function in Starch synthesis, if the expression of this transcription factor in wheat significantly can be suppressed, significantly can strengthen the expression of Starch synthesis gene, improve starch content and grain yield.
embodiment 1: a kind of preparation method of BSMV-VIGS recombinant vectors comprises the following steps:
(1) clone's (AP2/EREBP class transcription factor) of TaRSR1 transcription factor fragment
Extract the total serum IgE of wheat grain, and by the reverse transcription acquisition cDNA corresponding with wheat total serum IgE, the gained cDNA that takes a morsel as template,
Forward primer is: CTAGCTAGCGCCTGCAACTCCACCATG
Reverse primer is: CTAGCTAGCCGGACGATGACGACGAGA;
By pcr amplification target gene TaRSR1 transcription factor sequence, carry out electrophoresis detection with gained amplified production, cut glue recovery, amplify sequence length and be about 284bp, recovery gained amplified production is connected to pMD18-Tsimple carrier, then transformation of E. coli dH5 α, then, the positive monoclonal that picking is authenticated, carries out order-checking qualification;
(2) BSMV-γ: TaRSR1 recombinant vectors structure, transform with screen
The correct TaRSR1-pMD18-Tsimple plasmid of order-checking and BSMV-γ: GFP plasmid are used restriction enzyme respectively nhei single endonuclease digestion, then carry out electrophoresis detection, cut glue reclaim, obtain TaRSR1 transcription factor and the BSMV-γ plasmid of purifying; (Fig. 1 is shown in by the primary structure of BSMV plasmid);
Use T 4taRSR1 transcription factor after purifying is connected to the BSMV-γ plasmid after purifying by-DNA ligase, obtain BSMV-γ: TaRSR1 recombinant vectors (Fig. 3), be converted into competence e. coli jm109 again, be coated on the LB plate culture medium containing 50 μ g/mL penbritins, LB plate culture medium grows single bacterium colony through 37 DEG C of incubated overnight, gained list bacterium colony is carried out successively PCR checking, recombinant plasmid digestion verification (see figure 4) and order-checking qualification, obtain positive bacterium colony;
nhei single endonuclease digestion reaction system: 1 μ L10 × FDbuffer, 1 μ L nhei, 6 μ L plasmids, 2 μ LddH 2o; Reaction conditions: under 37 DEG C of conditions, enzyme cuts 5 ~ 15min;
T 4-DNA ligase ligation system: 0.5 μ L plasmid, 4.5 μ LTaRSR1 transcription factors, 1 μ LT 4dNAligase, 1 μ L10 × ligasebuffer, 3 μ LddH 2o; Reaction conditions: connect 2 ~ 3h under 16 DEG C of conditions;
(3) BSMV vector linearization
A: use restriction enzyme mlui is single endonuclease digestion BSMV-α and BSMV-γ: TaRSR1 recombinant plasmid respectively, makes its linearizing; Use restriction enzyme spei single endonuclease digestion BSMV-β plasmid, makes its linearizing;
mlui single endonuclease digestion reaction system: 1 μ L10 × FDbuffer, 1 μ L mlui, 6 μ LBSMV-α or BSMV-γ recombinant plasmid (500 μ g/mL) and 2 μ LddH 2o; Reaction conditions: 37 DEG C of enzymes cut 15 ~ 30min;
spei single endonuclease digestion reaction system: 1 μ L10 × FDbuffer, 1 μ L spei, 6 μ LBSMV-β plasmid (500 μ g/mL) and 2 μ LddH 2o; Reaction conditions: 37 DEG C of enzymes cut 15 ~ 30min.
Whether B: get 2.5 μ L digestion products respectively and carry out electrophoresis detection, cut abundant to detect enzyme.
C: enzyme is cut linearizing product thoroughly and reclaim;
Cut to enzyme and add isopyknic phenol in linearizing product thoroughly: chloroform: primary isoamyl alcohol (25:24:1), fully mixes; In 4 DEG C with the centrifugal 10min of 12500rpm; Supernatant is transferred to without in RNase1.5mL centrifuge tube, adds isopyknic pre-cold isopropanol, place 1h for 20 DEG C; In 4 DEG C with the centrifugal 10min of 12500rpm, abandon supernatant; Merge precipitated product, once with 70% alcohol (with the configuration of RNase-free water) washing, then with the centrifugal 30s of 7000rpm, reclaim precipitation, after alcohol is volatilized completely, add the abundant dissolution precipitation of 30 ~ 50 μ LRNase-free water, deposit for subsequent use for 20 DEG C.
(4) in-vitro transcription produces virus
Gained linearizing BSMV-α, BSMV-β and BSMV-γ: TaRSR1 carrier DNA are carried out in-vitro transcription, detection and preservation respectively; Use RibomaxRNA to produce test kit in a large number, produce BSMV virus (20 μ L system): 4 μ L5 × T 7transcriptionbuffer, 5 μ LNTPs(prepare system in table 1), 1.5 μ LRibom 7gCapAnalog(40mmol/L), 2 μ LT 7rNApolymeraseenzymemix, 1 μ LRNaseinhibitor, 6.5 μ LLinearDNAtemplate(1 ~ 2 μ g), 37 DEG C of reaction 2.5 ~ 4h.
table 1the reaction system of preparation rNTPs
After virus production terminates, get 2.5 μ L transcription products and carry out plain agar sugar gel (1%) electrophoresis detection, see Fig. 5, all the other 80 DEG C of conditions are preserved;
(5) preparation of virus inoculation mixed solution
20 μ LBSMV-α, 20 μ LBSMV-β, 20 μ LBSMV-γ: TaRSR1 transcription factors, 180 μ LDEPCwater and 240 μ L2 × GKPbuffer are mixed, obtains BSMV-VIGS silent carrier virus inoculation mixed solution.
embodiment 2: a kind of method utilizing Gene Silencing to study Yield Traits of Wheat gene function, comprises the following steps:
(1) in wheat heading stage, the high humidity environment of a wheat plant growth is created in field
Between wheat paddock after heading, 1d before inoculation, at field 6m 2build the high plastic canopy of 2.5m (built structure is shown in Fig. 6) above wheat plant in area, closely face portion surrounding soil is by plastic membrane sealing, to prevent moisture loss in plastic canopy, improves the humidity condition in shed.And wheat plant clear water in shed is squirted, sprinkling degree to flow down from fringe portion or leaf natural with clear water and is as the criterion, to ensure that when 2d inoculates in plastic canopy, atmospheric moisture is more than 85%;
(2) inoculate under low temperature and low light level field conditions
Start inoculation when 2d dusk, can make virus in All Through The Night is relatively long-time, contaminate wheatear portion, to improve inoculation efficiency in lower temperature and dark condition;
(3) frictional inoculation
Wear masks and without dust emgloves, clip the wheat head with thumb and forefinger, by BSMV-VIGS silent carrier virus inoculation mixed solution 20 μ L, from middle part, carry out 5 frictional inoculations back and forth to wheat head two ends, virus inoculation liquid repeats 1 time; After inoculation with the spray of little watering can a small amount of without RNA enzyme water, finally with the fringe portion that white clear preservative film parcel is inoculated; Take down preservative film after parcel 24h, be allowed to condition at normal growth in booth, temperature during inoculation is 21 DEG C; After inoculation 1d, daytime opens booth two ends because canopy temperature is high, and keep ventilating, night covers.
(4) after inoculation, the long period keeps the wheat growth environment of a high humidity
Inoculation after plastics film continue cover 7d, when noon, temperature was higher for fine day, bottom is opened carry out aeration-cooling, when night, temperature was lower continue cover, to keep higher humidity (field relative water content about 85%).
(5) qualification of viral reticent wheat plant
With green fluorescent protein (greenfluorescentprotein, GFP) the BSMV-VIGS reticent plant of virus (BSMV-VIGS-GFP inoculation) as a control group, using embodiment 1 silent carrier virus inoculation mixed solution inoculation plant as observation group, two kinds of recombinant plasmid virus production process are identical with seeded process.
After 7d, respectively observation group and control group wheat plant are carried out to the transcriptional level detection of Phenotypic Observation, target gene, time ripe, carry out yield traits mensuration.After Field inoculation, 15d observes and finds to turn to be yellow in wheatear portion of observation group, and outside fringe portion, black splotch appears in Yingshang; The rear 22d of inoculation observes wheat plant stem of observation group and starts gradually by green flavescence (Fig. 7), illustrates that virus infects wheat downwards from fringe portion.Statistics according to phenotype shows, inoculation efficiency reaches 52.5% (table 2).Inoculation rear 20d, 27d and 31d get observation group and control group plants ear part seed, carries out taRSR1the transcriptional level of transcription factor detects, and each value is at least three mean values repeated, and data application SPSS software, carries out the t test Analysis of paired samples, found that in observation group's wheat plant taRSR1expression amount significantly lower than control group plant (range of decrease average out to 52.3%) (Fig. 8).After harvesting wheat, detected result finds that observation group wheat plant seed thousand seed weight and starch content reach 19.5% and 30.0% respectively than control group plant amplification, and difference reaches conspicuous level (Fig. 9).Therefore, result demonstrates taRSR1transcription factor is a negative regulation factor, in wheat starch synthesis, played vital role.
table 2the Statistical Comparison of reticent plant
。
SEQUENCELISTING
<110> Agricultural University Of He'nan
<120>BSMV-VIGS recombinant vectors and the application in Yield Traits of Wheat gene studies thereof
<130>/
<160>3
<170>PatentInversion3.5
<210>1
<211>284
<212>DNA
<213> artificial sequence
<400>1
gcctgcaactccaccatggatcatatgaaggctctgaactaaagagaccaaaggtcgatg60
ctccccctgagatggtcgcaatccctcatcgatatccccttctgaccgagcatccaccaa120
tctggcatggccaatcatatcccctctttttaaataatgaggaagcagccagagatcata180
gcaggaggccagaggtggccacaggggctgttccaacctgggcatggagggtgagccacc240
ctcctccaacacaacccatgccactcttctcgtcgtcatcgtcc284
<210>2
<211>27
<212>DNA
<213> artificial sequence
<400>2
ctagctagcgcctgcaactccaccatg27
<210>3
<211>27
<212>DNA
<213> artificial sequence
<400>3
ctagctagccggacgatgacgacgaga27

Claims (8)

1. a BSMV-VIGS recombinant vectors, for containing target gene fragment, phage f1ori, supressor laci, intestinal bacteria E1 factor ori, β-lactamase gene bla, T 7the viral RNA of promotor, is characterized in that: described target gene fragment is for shown in SEQIDNO.1 taRSR1transcription factor mRNA Partial cDNA Sequence.
2. the preparation method of BSMV-VIGS recombinant vectors described in claim 1, comprises the following steps:
(1) clone of TaRSR1 transcription factor mRNA partial cDNA fragment
Extract the total serum IgE of wheat grain, and by the reverse transcription acquisition cDNA corresponding with wheat total serum IgE, get gained cDNA as template, pass through pcr amplification taRSR1transcription factor fragment sequence, is connected to pMD18-Tsimple carrier by recovery gained amplified production, then transformation of E. coli DH5 α, and then, the positive monoclonal that picking is authenticated, carries out order-checking qualification;
(2) structure of BSMV-γ: TaRSR1 recombinant vectors, conversion
Get order-checking correct TaRSR1-pMD18-Tsimple plasmid and BSMV-γ: GFP plasmid use restriction enzyme respectively nhei single endonuclease digestion, then carry out electrophoresis detection, cut glue reclaim, obtain TaRSR1 gene fragment and the BSMV-γ plasmid of purifying respectively;
Use T 4taRSR1 gene fragment after purifying is connected to the BSMV-γ plasmid after purifying by-DNA ligase, obtain BSMV-γ: TaRSR1 recombinant vectors, be converted into competence e. coli jm109 again, be coated on LB plate culture medium, LB plate culture medium grows single bacterium colony through 37 DEG C of incubated overnight, gained list bacterium colony is carried out successively PCR checking, recombinant plasmid digestion verification and order-checking qualification, select positive bacterium colony, obtain BSMV-γ: TaRSR1 recombinant vectors.
3. a virus inoculation mixed solution, containing BSMV-γ: TaRSR1 recombinant vectors described in isopyknic BSMV-α, BSMV-β, claim 2.
4. virus inoculation mixed solution according to claim 3, is characterized in that: in described virus inoculation mixed solution, the concentration of each carrier is 500 μ g/ml.
5. the preparation method of virus inoculation mixed solution described in claim 3, comprises the following steps:
(1) BSMV vector linearization
Use restriction enzyme mlui is single endonuclease digestion BSMV-α plasmid and claim 2 gained BSMV-γ: TaRSR1 recombinant plasmid respectively, makes its linearizing; Use restriction enzyme spei single endonuclease digestion BSMV-β plasmid, makes its linearizing;
(2) in-vitro transcription produces virus
Get gained linearizing BSMV-α, BSMV-β and BSMV-γ: TaRSR1 carrier DNA carries out in-vitro transcription, detection and preservation respectively;
(3) preparation of virus inoculation mixed solution
Get isopyknic BSMV-α, BSMV-β, BSMV-γ: TaRSR1, mix to 2 × GKPbuffer of BSMV-α volume with 9 times of DEPCwater and 12 to BSMV-α volume times.
6. study a method for Yield Traits of Wheat gene function, comprise the following steps:
(1) in wheat heading stage, create the environment of a high humidity, the low light level, low temperature in field, inoculate with virus inoculation mixed solution friction wheatear portion described in claim 3;
(2), after inoculation, high humidity environment is kept in flowering stage of wheat and filling stage; Meanwhile, inoculate and within 7 days, dock the transcriptional level detection that plant carries out Phenotypic Observation, target gene afterwards, time ripe, carry out yield traits mensuration.
7. method according to claim 6, is characterized in that: described high humidity environment is that humidity is not less than 85%; Described low light environment is divide 18 ~ 19 points high tea late April; Described low temperature environment is 18 ~ 22 DEG C.
8. the application of BSMV-VIGS recombinant vectors in wheat increase yield or breeding described in claim 1.
CN201510970347.3A 2015-12-22 2015-12-22 BSMV-VIGS recombinant vector and application thereof to wheat yield trait gene research Pending CN105505963A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510970347.3A CN105505963A (en) 2015-12-22 2015-12-22 BSMV-VIGS recombinant vector and application thereof to wheat yield trait gene research

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510970347.3A CN105505963A (en) 2015-12-22 2015-12-22 BSMV-VIGS recombinant vector and application thereof to wheat yield trait gene research

Publications (1)

Publication Number Publication Date
CN105505963A true CN105505963A (en) 2016-04-20

Family

ID=55714256

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510970347.3A Pending CN105505963A (en) 2015-12-22 2015-12-22 BSMV-VIGS recombinant vector and application thereof to wheat yield trait gene research

Country Status (1)

Country Link
CN (1) CN105505963A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106755066A (en) * 2016-11-30 2017-05-31 周口师范学院 A kind of wheat strain carrier mediated Gene Silencing methods of TRV and application
WO2020083339A1 (en) * 2018-10-24 2020-04-30 中国农业大学 Barley stripe mosaic virus-based gene editing vector system

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
FANG-FANG FU等: "Coexpression Analysis Identifies Rice Starch Regulator1, a Rice AP2/EREBP Family Transcription Factor, as a Novel Rice Starch Biosynthesis Regulator", 《PLANT PHYSIOLOGY》 *
GUO-ZHANG KANG等: "Comprehensive analysis of the transcription of starch synthesis genes and the transcription factor RSR1 in wheat (Triticum aestivum) endosperm", 《GENOME》 *
李淼淼: "BSMV诱导小麦SBEIIa和SSIIa基因沉默及其对直链淀粉和抗性淀粉合成的影响", 《中国优秀硕士学位论文全文数据库农业科技辑》 *
田波 等: "《植物病毒研究方法（上册）》", 31 August 1987 *
马红珍: "TaBTF3基因在小麦中的克隆及其功能研究", 《中国博士学位论文全文数据库农业科技辑》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106755066A (en) * 2016-11-30 2017-05-31 周口师范学院 A kind of wheat strain carrier mediated Gene Silencing methods of TRV and application
CN106755066B (en) * 2016-11-30 2020-05-05 周口师范学院 Whole wheat TRV vector mediated virus induced gene silencing method and application
WO2020083339A1 (en) * 2018-10-24 2020-04-30 中国农业大学 Barley stripe mosaic virus-based gene editing vector system

Similar Documents

Publication Publication Date Title
CN104829700A (en) Corn CCCH-type zinc finger protein, and encoding gene ZmC3H54 and application thereof
CN101487021B (en) Use of miR397 in drought resistance plant cultivation
CN103088027A (en) PDR transport protein gene promoter for controlling ginsenoside accumulation, and its application
CN107338266A (en) A kind of VIGS silencing systems for identifying mulberry tree MmPDS genes and its construction method and application
CN106520824A (en) Multi-target-point editing system and application thereof
CN104152473B (en) Tobacco Carotenoid isomerase gene and its application
CN105087640A (en) Gene for regulating seed development of plants and application of gene
CN110229222A (en) Tomato anti-Meloidogyne incognita related gene and its application
CN103468714B (en) Application of rice PS1 protein and rice PS1 protein coding gene in adjustment of plant senescence
CN104388433B (en) A kind of Plant Osmotic Stress inducible promoter and application thereof
CN105505963A (en) BSMV-VIGS recombinant vector and application thereof to wheat yield trait gene research
CN104357478B (en) Bacterial leaf blight resistant gene engineering application of rice zinc finger protein gene
CN109355297A (en) Dendrobium candidum DcWOX4 gene and its application in raising axis tiller
CN105779492A (en) Application of rice miR396c
CN108410883A (en) Corn anti contravariance related gene ZmDi19-9 and its application
CN110106171B (en) Long-chain non-coding RNA and application thereof in regulating and controlling low temperature resistance of plants
CN115927403A (en) King ZxPDS gene VIGS silencing system and construction method and application thereof
CN104120134B (en) The application in cultivating resistance of reverse transgenic plant of the GsHSFB2b albumen
CN114015716A (en) Method for verifying quinoa gene function mediated by virus-induced gene silencing
CN104152454B (en) Derive from drought-induced promoter GmMYB363P and the application thereof of soybean
CN104059938A (en) RNA interference vector of bactrocera dorsalis sodium ion channel genes and construction method and application thereof
CN104059931A (en) RNA interference vector of bactrocera dorsalis cytochrome P450 genes and construction method and application thereof
CN110144364A (en) The Cre-LoxP recombination system of capsaicinoid ointment infectious clone and its application
CN102533766B (en) Seed-specific promoter and application thereof
CN102676520A (en) Application of microRNA44a or encoding gene thereof to regulation and control of paddy rice stem length

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160420

RJ01 Rejection of invention patent application after publication