CN105505961B - A kind of method and gene for improving Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously - Google Patents
A kind of method and gene for improving Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously Download PDFInfo
- Publication number
- CN105505961B CN105505961B CN201510960787.0A CN201510960787A CN105505961B CN 105505961 B CN105505961 B CN 105505961B CN 201510960787 A CN201510960787 A CN 201510960787A CN 105505961 B CN105505961 B CN 105505961B
- Authority
- CN
- China
- Prior art keywords
- plant
- pp2a
- gene
- salt
- sodium salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses methods and gene that a kind of raising Genes For Plant Tolerance sodium salt increases potassium and nitrogen Utilization ability simultaneously, by improving arabidopsis PP2A-C5 channel genes purpose plant Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously.The present invention can be excellently used for the improvement of plant variety, improve the resistance of plant sodium salt high for soil, and plant still has the Utilization ability of very strong potassium and nitrogen in high sodium salt soil, and plant can pass through the increment using raising plant to potassium and nitrogen.The present invention is significant to crops, expansion planting area, raising plant products are planted on soil with high salt (such as tidal land soil) and salinized soil (high sodium salt, high sylvite and other salt).
Description
Technical field
The present invention relates to genetic engineering field, in particular to a kind of raising Genes For Plant Tolerance sodium salt increases potassium and nitrogen simultaneously and utilizes energy
The method and gene of power.
Background technique
Soil salt is that crop and vegetation are able to the essential ingredient of normal growth.Plant growth is in addition to moderately good
Outside soil characteristic, a key for supporting it to grow is evenly to supply nutrient.But salinity excessive in soil, it is special
It is not the content of sodium chloride, is nocuousness to plant growth, direct harm is that extra sodium ion accumulates influence in cytoplasm
The activity of enzyme in endochylema, to influence various biochemical reactions.Since most plants are glycophyte on the earth
(glycophytes), they can not endure the high salinity of soil, cause on the earth a large amount of soil with high salt cannot by the mankind benefit
With, become influence land resources utilization a key factor.Simultaneously as the undesirable agricultural cultivating mode of the mankind, soil
It corrodes and salinization and alkalization is increasing, further affect the supply and output in soil.Therefore, it is to have become drop that soil is with high salt
The main environment pressure of low agricultural productivity.
In past 1000, people are utilizing always traditional breeding method to make great efforts to improve the yield of crops, and
Enough food, which is provided, for the mankind has made huge contribution.FAO's estimation, not with human population's quantity
The raising of disconnected growth and the requirement to food quality can only by the yield that traditional breeding way improves crops to the year two thousand fifty
Meet population to the 60% of grain increased requirement amount.
Growth has the (plant grown naturally on the soil of ocean, tidal land and height salinization of soil of a large amount of halophytes on the earth
Object), but these plant overwhelming majority are not the general food of the mankind.People can not also be incited somebody to action by the method for traditional crossbreeding
The salt resistance characteristic of these plants is transferred on crops.However, modern genetic engineering and molecular breeding can provide one for us
The method that kind improves plant anti-salt ability, the premise for improveing crops character with this method is to find and be improved
The functional gene of plant anti-salt ability, including the function directly related with salt metabolism (absorption, transhipment, assimilation, storage or discharge etc.)
Energy gene and the controlling gene for having regulating and controlling effect (regulation etc. after chaperone, protein transcription) to directly related gene.
Such as absorb, transport, assimilate, store or be discharged to salt metabolism the work of relevant identified for genes achieved it is more
Research achievement.SOS1 is the Na that cell membrane combines+/H+Antiport body, can be by Na extra in cytoplasm endochylema+Cross-film turns
Cell membrane is into intercellular gap out, to reduce salt damage.NHX1 is the Na that tonoplast combines+/H+Antiport body, can be with
By Na extra in cytoplasm endochylema+Cross-film is transferred in vacuole and stores, to reduce the harm to enzyme in endochylema.AVP1 is liquid
Vacuolar membrane H+Pump, by by the H in vacuole+It pumps out film and increases Na to the potential that cytoplasm changes tonoplast+The energy being pumped into vacuole
Power improves the saline-alkaline tolerance of plant to reduce salt damage.After obtaining salt resistant gene and proving its function, scientist utilizes function
2 genes of coupling are overexpressed jointly, can be further improved the anti-salt property of plant.Such as, a vacuole H+Pump AVP1 and liquid
The Na of bubble+/H+The two-way common overexpression plant of transporter gene, salt resistance effect are better than single antiport NHX1 and single
Vacuole H+Pump the effect of AVP1.This effect is applied same with plants, effects such as cottons after model plant arabidopsis is proven
Sample salt resistance is obvious.Moreover, there are also preferable drought resistances for dual-gene transformed plant, moreover it is possible to improve cotton fiber yield and matter
Amount.Although chloride ion is micronutrient necessary to plant, as sodium ion, the toxic work of the chloride ion of cytoplasm high concentration
With.When increasing NaCl concentration, the Na that plant cell faces in soil+The common toxicity of toxicity and chloride ion.Chloride ion is transported
It can prevent it from accumulating in cytoplasm and reducing toxicity into vacuole.In fact, this method seems by certain salt tolerant citruses
It is confirmed with grape.Tonoplast combination chloride ion channel CLC albumen can transport chloride ion in vacuole, bring simultaneously
For one proton to cytoplasm, it is functionally similar to the NHX reverse transport protein on tonoplast.Arabidopsis CLC gene mutation body,
Atclcc-1, it is very sensitive to NaCl, and atclcc homologous gene overexpression genetically modified plants can increase the tolerance of salt, card
The protein that CLC is illustrated plays important salt tolerant role really.
Potassium ion (K+) and nitrogen (NO-3,NH+4) it is all one of 3 big nutrients required for plant growth, the life to plant
Long and Relationship with Yield is great, however, the Na of high concentration under normal circumstances+Plant be will affect to K+Utilization, excessive sodium will affect
The absorption and utilization of potassium.
Summary of the invention
The purpose of the present invention is to provide a kind of methods that raising Genes For Plant Tolerance sodium salt increases potassium and nitrogen Utilization ability simultaneously, lead to
It crosses arabidopsis PP2A-C5 channel genes purpose plant, improves Genes For Plant Tolerance sodium salt and increase potassium and nitrogen Utilization ability simultaneously.
The present invention also provides a kind of genes and method for improving Genes For Plant Tolerance sodium salt ability, by by CLCc-A channel genes
Purpose plant improves Genes For Plant Tolerance sodium salt ability.
The technical solution adopted by the present invention to solve the technical problems is：
A method of it improving Genes For Plant Tolerance sodium salt and increases potassium and nitrogen Utilization ability simultaneously, by by arabidopsis PP2A-C5 base
Because importing purpose plant, improves Genes For Plant Tolerance sodium salt and increase potassium and nitrogen Utilization ability simultaneously.
It includes the most important of albumen after directly transcribing with salt resistance related gene that phosphorylation and dephosphorylation, which are in organism,
One of function controlling mode.Protein Phosphatase 2A (PP2A) is an important serine/threonine protein phosphoric acid in cell
Enzyme, cell growth, metabolism and signal transduction finely regulating in play an important role, by the serine with substrate/
Threonine combines, and executes cell protein post-transcriptional control, is typical biological cell controlling gene.Protein Phosphatase 2A is by three
Subunit composition：Binding subunit A-grade in the first class adjusts subunit B and catalytic subunit C.There is no the regulation of phosphorylation and dephosphorylation, it is large quantities of
Gene becomes non-functional albumen after synthetic proteins, will directly affect the growth of plant.Inventor is studied by long felt
It was found that：Arabidopsis PP2A catalytic subunit 5 (PP2A-C5) is directly related with the salt resistance function of plant, the plant of overexpression PP2A-C5
Strain significantly improves the saline-alkaline tolerance of plant, and the knockout mutations body of PP2A-C5, shows the sensibility to salt.To PP2A-C5
Genetic analysis with sos gene single mutant and double mutant shows that PP2A-C5 has phase with chloride channel (CLC) albumen
The relationship of interaction, and be proven in yeast two-hybrid system.Since in tonoplast to serve as ion/proton inverse for CLC albumen
To transhipment effect and it is directly related with the salt tolerance of plant, disclose the Mechanisms of Salt Resistance of PP2A-C5.
Present invention finds controlling gene relevant to an anti-plant salt damage-arabidopsis PP2A-C5 genes.In a reality
It applies in scheme, has cloned the gene, it was demonstrated that it not only has a saline-alkaline tolerance, is also improved the function that plant utilizes potassium and nitrogen.Make
To be preferred, by arabidopsis PP2A-C5 channel genes purpose plant, specific step is as follows：
(1) building of plant expression vector：Drawn according to gene cds sequence design DNA in arabidopsis Tair biological information library
Object, using arabidopsis cDNA library as template, with the method for PCR, the cDNA of amplification gene PP2A-C5, with plasmid pFGC5941 structure
Plant expression vector is built, the cDNA and Plasmid DNA of amplification carry out digestion with NcoI and Bam I, and the connection of T4 ligase utilizes
35S promoter on pFGC5941 starts PP2A-C5 gene, and the plant expression vector of acquisition is named as pFGC5941-35S-
PP2A-C5；
(2) acquisition of genetically modified plants：The plant expression vector pFGC5941-35S-PP2A-C5 that step (1) obtains is led
Enter Agrobacterium, plant expression vector is transferred to by purpose plant using agrobacterium-mediated transformation, obtains genetically modified plants.
Preferably, the DNA primer in step (1) includes OC5-F1 and OC5-R1, OC5-F1 sequence is shown in SEQ ID NO.1
Shown, OC5-R1 sequence is as shown in SEQ ID NO.2.
A kind of new application of arabidopsis PP2A-C5 gene utilizes energy for improving Genes For Plant Tolerance sodium salt while increasing potassium and nitrogen
The purposes of power.
A kind of gene improving Genes For Plant Tolerance sodium salt ability, the unnamed gene are CLCc-A, and CLCc-A sequence is shown in SEQ ID
Shown in NO.3.
Inventor has found that one is coerced the useful gene of ability to plant salt is adjusted：Arabidopsis PP2A-C5 gene, then
The molecular mechanism for proving its function is by regulating and controlling its substrate, and a tonoplast ion transport protein CLCc is realized, vacuole
The encoding gene of film ion transport protein CLCc is CLCc gene, is then obtained by the nucleic acid sequence of transformation CLCc gene
CLCc-A gene, discovery can be further improved the ability of the salt resistance of plant.
A method of Genes For Plant Tolerance sodium salt ability being improved, by improving Genes For Plant Tolerance for CLCc-A channel genes purpose plant
Sodium salt ability.
Preferably, by CLCc-A channel genes purpose plant, specific step is as follows：
(1) building of plant expression vector：Drawn according to gene cds sequence design DNA in arabidopsis Tair biological information library
Object, using arabidopsis cDNA library as template, with the method for PCR, the cDNA of amplification gene CLCc-A is constructed with plasmid pFGC5941
Plant expression vector, the cDNA and Plasmid DNA of amplification carry out digestion with NcoI and Bam I, and the connection of T4 ligase utilizes
35S promoter on pFGC5941 starts CLCc-A gene, and the plant expression vector of acquisition is named as pFGC5941-35S-
CLCc-A；
(2) acquisition of genetically modified plants：The plant expression vector pFGC5941-35S-CLCc-A that step (1) obtains is led
Enter Agrobacterium, plant expression vector is transferred to by purpose plant using agrobacterium-mediated transformation, obtains genetically modified plants.
Preferably, the DNA primer in step (1) includes CLCc-A-F1 and CLCc-A-R1, CLCc-A-F1 sequence is shown in
Shown in SEQ ID NO.4, CLCc-A-R1 sequence is as shown in SEQ ID NO.5.
A kind of plant expression vector containing CLCc-A gene and the Agrobacterium containing the plant expression vector.
The beneficial effects of the invention are as follows：The present invention can be excellently used for the improvement of plant variety, improve plant for soil
The resistance of the high sodium salt of earth, and plant still has the Utilization ability of very strong potassium and nitrogen in high sodium salt soil, plant can be by right
The increment using raising plant of potassium and nitrogen.The present invention to soil with high salt (such as tidal land soil) and salinized soil (high sodium salt,
High sylvite and other salt) on plant crops, expand planting area, improve plant products it is significant.
Detailed description of the invention
Fig. 1 is the Molecular of PP2A-C5-1 (SALK_139822) mutant.
A. genome structure.Black box and line show the exon and introne of PP2A-C5 respectively.T-DNA insertion point is
It is indicated by the triangle containing T-DNA left margin (LB) sequence.F1 (pp2a-c5-1-F1, sequence are shown in SEQ ID NO.32) and R1
(pp2a-c5-1-R1, sequence are shown in SEQ ID NO.33), the PCR primer for expanding PP2A-C5 segment verify mutant.
B.PCR proves that PP2A-C5-1 sports homozygous T-DNA insertion plant.F1, R1, and LB are used for from wild type
(WT) primer of plant and PP2A-C5-1 mutant pcr amplified DNA segment.
C.RT-PCR analyzes the PP2A-C5 transcription product in wild-type plant and PP2A-C5-1 mutant.Actin
ACTIN 2 is internal reference.
Fig. 2 is the salt resistance test result figure of PP2A-C5-1 mutation.
A. wild type (WT) and PP2A-C5-1 mutant plant are containing salt-free or 75mM's and 100mM's NaCl MS plate
The phenotype of upper vertical-growth.(processing shoots photo after a week).
B. scheme the relative growth yield of the root of plant in A.WT, wild type.
C. the mannitol (respectively 50mM, 100mM, 300mM and 400mM) for adding various concentration in culture medium simultaneously is wild afterwards
The relative growth yield of raw type and PP2A-C5-1 mutant plants root.
D. the growing state of wild type and PP2A-C5-1 mutant in the soil of salt treatment.
E. complementary assay.PBI21-PP2A-C5-1 is transferred to PP2A-C5-1 mutant (COM1 and COM2), plant roots
Growth is restored, even better than wild type.The saline-alkaline tolerance reduction for proving mutant is because PP2A-C5-1 function is by broken
Caused by bad.
Fig. 3 is the expression of PP2A-C5 by Salt treatment, and the PP2A activity of overexpressing plants cell improves result figure.
A.PP2A-C5-1 is overexpressed developed by molecule of the plant under NaCl treatment conditions.
A.8 age in days Arabidopsis thaliana Seedlings are transferred to in 200mM NaCl culture medium, processing different time (respectively 3,6,
9 and 12h) and various concentration NaCl (respectively 50mM, 100mM and 150mM) processing 6h.MRNA is extracted for RT-PCR points
Analysis.ACTIN2 protein transcription is used as internal reference.
B. it is set as value 1, the ratio for the treatment of region therewith with this PP2A-C5-1 transcript of (0h) sample before plant salt treatment
Value is relative expression quantity
C. it is set as value 1, the ratio of different PP2A-C5-1 overexpressing plants expression quantity therewith with wild-type plant transcript
Value is relative expression quantity.WT, wild type；C 5OE1 to C5-OE7, the plant that 7 independent PP2A-C5-1 are overexpressed.
D.Western engram analysis.Different PP2A-C5-1 overexpressing plants expressing quantities.GAPC is used as matter loading
Control
E.PP2A-C5-1 overexpressing plants PP2A activity.
*, t examines significant 1%.
Fig. 4 is that the salt tolerance of overexpression PP2A-C5-1 genetically modified plants improves result figure.
A, anti-salt property of D, C. overexpression PP2A-C5-1 plant in culture medium and soil significantly improves.75mM salt
Treated, and phenotype overexpression PP2A-C5-1 plant is better than the phenotype of wild type, while better than mutant.
B, the length of C. root and the quality of root are all shown as：Overexpression PP2A-C5-1 plant is better than the phenotype of wild type,
Better than mutant simultaneously.C5-OE1-3 is 3 PP2A-C5-1 overexpressing plants, and pp2a-c5-1 is mutant.
D and E:Scheming D is the photo before salt treatment, and E is the table after PP2A-C5-1 overexpression and WT lines salt treatment
Type.Wherein one group of plant (left side) uses water process, and another group is handled with 250 mMs of sodium chloride.Pouring in every 2 days 1 time, continuous 14
It, figure E is shot after being processing 14 days.
Fig. 5 is that yeast-two hybrid technique proves that AtCLCc and PP2AC have interaction result figure.Only AtCLCc and
PP2AC5 has interaction.TOM20 is negative control.
Fig. 6 is that overexpression PP2A-C5-1 transgenic plant increases tolerability results figure to sylvite.Arabidopsis on the 4th
Seedling is transferred to the KNO of the KCl containing 75mM and 75mM3MS culture medium on grow, shoot photo after 10 days.WT, wild type；
C5-OE1 and C5-OE2, two independent PP2A-C 5 are overexpressed plant.
Fig. 7 is phenotype of the overexpression AtCLCc plant under 100mM NaCL processing.
Fig. 8 is CLCc-A, phenotype of the CLCc overexpressing plants after 200mM NaCL salt treatment 15 days.CLCc-A-1,
CLCc-A-2 is 2 CLCc-A transgenic lines, and CLCc is CLCc transgenic plant, and WT is WT lines.
Specific embodiment
Below by specific embodiment, and in conjunction with attached drawing, technical scheme of the present invention will be further explained in detail.
In the present invention, if not refering in particular to, used raw material and equipment etc. are commercially available or commonly used in the art.
Method in following embodiments is unless otherwise instructed the conventional method of this field.
Embodiment 1：
A method of it improving Genes For Plant Tolerance sodium salt and increases potassium and nitrogen Utilization ability simultaneously, by by arabidopsis PP2A-C5 base
Because importing purpose plant, improves Genes For Plant Tolerance sodium salt and increase potassium and nitrogen Utilization ability simultaneously.By arabidopsis PP2A-C5 channel genes mesh
Plant specific step is as follows：
(1) building of plant expression vector：Drawn according to gene cds sequence design DNA in arabidopsis Tair biological information library
Object, DNA primer include OC5-F1 and OC5-R1,
OC5-F1：
GCCATGGATGTACCCATACGATGTTCCAGATTACGCTCCGCCGGCGACCGGAGATA(SEQ ID
NO.1),
OC5-R1：AGGGATCCGAGCTAGTGTGTGGAATTGCAG(SEQ ID NO.2).
Using arabidopsis cDNA library as template, with the method for PCR, the cDNA of amplification gene PP2A-C5 uses plasmid
(commercially available) the building plant expression vector of pFGC5941, the cDNA and plasmid of amplification carry out digestion, T4 ligase with NcoI and Bam I
Connection starts PP2A-C5 gene using 35S promoter, and the plant expression vector of acquisition is named as pFGC5941-35S-PP2A-
C5；
(2) acquisition of genetically modified plants：The plant expression vector pFGC5941-35S-PP2A-C5 that step (1) obtains is led
Enter Agrobacterium, plant expression vector is transferred to by purpose plant using agrobacterium-mediated transformation, obtains genetically modified plants.
Embodiment 2：
A kind of gene improving Genes For Plant Tolerance sodium salt ability, the unnamed gene are CLCc-A, and CLCc-A sequence is shown in SEQ ID
Shown in NO.3.
A method of Genes For Plant Tolerance sodium salt ability being improved, by improving Genes For Plant Tolerance for CLCc-A channel genes purpose plant
Sodium salt ability.By CLCc-A channel genes purpose plant, specific step is as follows：
(1) building of plant expression vector：Drawn according to gene cds sequence design DNA in arabidopsis Tair biological information library
Object, DNA primer include CLCc-A-F1 and CLCc-A-R1, and CLCc-A-F1 sequence is as shown in SEQ ID NO.4, CLCc-A-R1 sequence
Column are as shown in SEQ ID NO.5.
Using arabidopsis cDNA library as template, with the method for PCR, the cDNA of amplification gene CLCc-A uses plasmid
PFGC5941 constructs plant expression vector, and the cDNA and plasmid of amplification carry out digestion with NcoI and Bam I, and T4 ligase connects,
Start CLCc-A gene using 35S promoter, the plant expression vector of acquisition is named as pFGC5941-35S-CLCc-A；
(2) acquisition of genetically modified plants：The plant expression vector pFGC5941-35S-CLCc-A that step (1) obtains is led
Enter Agrobacterium, plant expression vector is transferred to by purpose plant using agrobacterium-mediated transformation, obtains genetically modified plants.
Test method of the invention is as follows：
(1), PP2A-C5-1 mutant pure lines are obtained, it was demonstrated that its saline-alkaline tolerance reduces.
1. obtaining PP2A-C5-1 mutant pure lines plant, and molecular engineering verifying is passed through.
2. demonstrating, PP2A-C5-1 mutation is very sensitive to salt, and reducing PP2A-C5-1 gene expression amount leads to the anti-of plant
The decline of salt ability.
3. the expression that salt can induce plant PP2A-C5.
4.PP2A-C5-1 mutant is equally very sensitive to other salt ions (potassium ion).
(2), PP2A-C5 overexpression transgenic plant has been formulated, it was demonstrated that its saline-alkaline tolerance is improved.
5. constructing PP2A-C5 gene expression recombinant plasmid：It is set according to gene cds sequence in arabidopsis Tair biological information library
Count DNA primer (OC5-F1 (SEQ ID NO.1)；OC5-R1 (SEQ ID NO.2)), using arabidopsis cDNA library as template, use
The method of PCR, the cDNA of amplification gene PP2A-C5.With (commercially available) the building gene plant expression vector of plasmid pFGC5941, amplification
CDNA and plasmid with NcoI and Bam I carry out digestion, the connection of T4 ligase.Start PP2A-C5 gene using 35S promoter,
Expression vector is named as pFGC5941-35S-PP2A-C5.With the accuracy of the method identification confirmation expression vector of PCR.
6. having formulated PP2A-C5-1 overexpression pure lines plant, and molecular engineering verifying is passed through.
The pFGC5941-35S-PP2A-C5 vector introduction Agrobacterium that will be built, strain are GV3101 (commercially available), vacuum
Suction method passes through pollen tube arabidopsis thaliana transformation (environmental Columbia, Col-0, commercially available).It is received after arabidopsis culture after conversion
Obtain seed.The seed of harvest is seeded into 50mg/L containing kanamycin, on the MS culture medium of 100 mg/L of rifampin, is placed in
3d is induced in 4 refrigerators, being then transferred into culture in growth cabinet, (22 DEG C, light application time is 16/8h d, intensity of illumination round the clock
For 6000lax), after 15d by resistance transplantation of seedlings into soil, positive plant is screened, continuing to screen 2 generations is sheerly, and molecule reflects
Fixed verifying.The strain for choosing PP2A-C5-1 gene high expression makes further research.
7.PP2A-C5 overexpression pure lines plant improves salt tolerance.
The activity of phosphoprotein phosphatase PP2A is improved in 8.PP2A-C5 overexpression pure lines plant.
(3), PP2A-C5 increases the saline-alkaline tolerance of cell by regulating cell tonoplast AtCLCc
9. constructing OCLCc gene expression recombinant plasmid：According to gene cds sequence design in arabidopsis Tair biological information library
DNA primer (OCLCc-F1 (SEQ ID NO.30)；OCLCc-R1 (SEQ ID NO.31)), using arabidopsis cDNA library as mould
Plate, with the method for PCR, the cDNA of amplification gene OCLCc.With (commercially available) the building gene plant expression vector of plasmid pFGC5941,
The cDNA and plasmid of amplification carry out digestion, the connection of T4 ligase with NcoI and Bam I.Start CLCc gene using 35S promoter,
Expression vector is named as pFGC5941-35S-CLCc.With the accuracy of the method identification confirmation expression vector of PCR.
OCLCc-F1：
AGCTCCATGGATGTACCCATACGATGTTCCAGATTACGCTGATGATCGGCACGAAGG(SEQ ID
NO.30),
OCLCc-R1：AGCTGGATCCTCACTTGAGGGGATCAATGTG(SEQ ID NO.31).
10. the saline-alkaline tolerance of overexpression AtCLCc raising plant
The pFGC5941-35S-CLCc vector introduction Agrobacterium that will be built, strain GV3101, vacuum filtration method pass through
Pollen tube arabidopsis thaliana transformation (environmental Columbia, Col-0).Seed is harvested after arabidopsis culture after conversion.By harvest
Seed is seeded into 50mg/L containing kanamycin, on the MS culture medium of rifampin 100mg/L, is placed in 4 refrigerators and induces 3d, so
After be transferred in growth cabinet culture (22 DEG C, light application time is 16/8h d, intensity of illumination 6000lax round the clock), after 15d
By resistance transplantation of seedlings into soil, screen positive plant, continue screen 2 generations be sheerly, Molecular Identification verify.Choose AtCLCc
The strain of gene high expression carries out salt resistance test.
11. proving that PP2A-C5 and AtCLCc kind albumen have interaction.Utilize yeast-two hybrid technique, it was demonstrated that PP2A-C5
With
AtCLCc has an interaction, and the relationship of PP2A-C5 and AtCLCc are a kind of regulation and the relationship being adjusted.
(4), the sequence (being named CLCc-A) of artificial reconstructed CLCc has cloned the gene of transformation, has formulated CLCc-A mistake
Amount expression plant, it was demonstrated that can be further improved the salt resistance evil ability of plant.
12. obtaining CLCc-A sequence：According to gene cds sequence in arabidopsis Tair biological information library, in design dna primer
When CLCc-A-F1 and CLCc-A-R1, with normal CLCc sequence ratio, 2 connected threonines are added before the terminator of sequence
Codon:ACA ACC encodes 2 threonine residues (primer CLCc-A-R1 dashed part).Utilize the side of primer PCR
Method expands the cDNA of improved CLCc-A, sequence verification from arabidopsis cDNA library.
2 primers and improved gene order are as follows:
Primer：
CLCc-A-F1:
AGCTCCATGGATGTACCCATACGATGTTCCAGATTACGCTGATGATCGGCACGAAGG(SEQ ID
NO.4)
CLCc-A-R1:AGCTGGATCCGGT TGTTCACTTGAGGGGATCAATGTG(SEQ ID NO.5)。
CLCc-A sequence is shown in SEQ ID NO.3.
13. constructing CLCc-A gene expression recombinant plasmid：CDNA the and pFGC5941 Plasmid DNA obtained in " 12 " is used
NcoI and Bam I carries out digestion, and the connection of T4 ligase constructs gene plant expression vector.Started using 35S promoter on carrier
CLCc-A gene, the expression plasmid of building are named as pFGC5941-35S-CLCc-A.
14. having formulated CLCc-A overexpression pure lines plant, it is sheerly.
The pFGC5941-35S-CLCc-A vector introduction Agrobacterium that will be built, strain are GV3101 (commercially available), and vacuum is taken out
Filter method passes through pollen tube arabidopsis thaliana transformation (environmental Columbia, Col-0).Seed is harvested after arabidopsis culture after conversion.
The seed of harvest is seeded into 50mg/L containing kanamycin, on the MS culture medium of rifampin 100mg/L, is placed in 4 refrigerators
3d is induced, is then transferred into growth cabinet and cultivates (22。C, light application time is 16/8h d round the clock, and intensity of illumination is
6000lax), after 15d by resistance transplantation of seedlings into soil, screen positive plant, continue screen 2 generations be sheerly, with the side of PCR
Method carries out Molecular Identification verifying, determines that improved DNA has been integrated into the genome of arabidopsis.Choose the high table of CLCc-A gene
The strain reached makes further research.
Material and method
The culture of all kinds of plants and the identification method of salt tolerance
(1) measurement is handled on culture medium
Arabidopsis seed carries out surface sterilization 10 minutes with 15% bleaching agent, is then washed with distilled water 3 times.Seed is placed in
In culture dish containing MS culture medium (MS culture medium is commercially available), the sucrose of 1% (weight/volume) and 0.7% (weight/volume)
Agar, pH value 5.8.Culture dish moves on to 22 DEG C, 16 hours illumination/8 hour dark photoperiods after 4 DEG C in the dark 3 days
It is cultivated in the culturing room of (intensity of illumination 6000lax).According to processing requirement, the sodium chloride of various concentration is added in the medium
(10mM, 20mM, 30mM, 40mM, 75mM or 100mM).The length of the root newly grown with plant measures test plants to salt
Sensibility.
For the osmosis for detecting plant, 4 day age seedling is transferred to the culture basal growth of the MS containing mannitol.After 1 week
Photograph taking.To root long and fresh weight data collection.Each experiment is at least repeated 3 times.
(2) processing measurement in the soil
Germination on MS plate, when growing into out 6 leaf.Seedling is transferred in soil, every 2 days dense with 50ml difference salt
The salting liquid of degree pours (10mM, 20mM, 30mM, 40mM, 75mM or 100mM), other processing are consistent with management method.Pour 2
Photo is shot after week.
The activity test method of phosphoprotein phosphatase PP2A
Protein Phosphatase 2A determination of activity using Promega company (serine of (Madison, Wisconsin, USA)/
Threonine protein phosphatases activity detection kit is carried out according to the step of its specification.It its principle and mainly comprises the following steps：With one
Kind of peptide substrate, RRA (pT) VA, concentration variation express the determination of activity of enzyme.With molybdic acid dyestuff/adjuvant mixture and dissociate
Phosphatase reaction generates color.Wavelength is finally read at absorbance density 600nm.According to PP2A enzymatic activity standard curve meter
It calculates.
One, PP2A-C5-1 mutant pure lines are obtained, it was demonstrated that its saline-alkaline tolerance reduces
In order to illustrate the function of PP2A, from (commercially available) purchase of Ohio State University arabidopsis Biological Resource Center (ABRC)
PP2A-C5 (At1g69960) Arabidopsis Mutants obtain PP2A-C5 by antibiotic resistance screening, PCR Molecular
Mutant is sheerly (Figure 1A), which is named as pp2a-c5-1.The T-DNA for demonstrating the mutant is inserted into PP2A-
Transcription and the normal function (Figure 1B) of PP2A-C5 are destroyed in the First Intron of C5.Reverse transcriptional PCR (RT-
PCR it) proves the full length sequence mRNA for thering is PP2A-C 5 to encode in mutant, but there is no PP2A-C5-1 transcription product (Fig. 1 C).
Mutant and WT lines MS plate do not contain or the growth of 75mM sodium chloride after a week, PP2A-C5-1 mutation
The root growth of body is worse than wild-type plant (Fig. 2A).The root long of mutant plant only has the 56% of wild type；100mM sodium chloride
The root long of mutant plant only has 30% (Fig. 2 B) of wild type after processing.Other than root growth is short, PP2A-5-1 mutant
There is albefaction simultaneously in plant, sallow, the few phenotype of lateral root (Fig. 2A).This sensibility to salt grows in the soil and is cultivating
The phenotype of basal growth is identical (Fig. 2 D).Mannitol can be used for the test of induced infiltration coercion, when wild type and
PP2A-C5-1 mutant plant is transferred to containing growing one on mannitol matrix (respectively 50mM, 100mM, 300mM and 400mM)
After a week, show that all plant growth rates are similar, the growing state under each concentration is identical (Fig. 2 C).From another point of view
Show that PP2A-C5-1 mutation is due to caused by the toxicity of ion to the phenotype of salt density value.
To further determine that whether toxicity or the osmotic stress of high salt concentration ion are because PP2A-C5-1's is prominent in cell
Produced by change, gene complementation expression test has been carried out.
PP2A-C5-1 overexpression obtains complementary plant, complementary plant is 75mM NaCl's to pp2a-c5-1 mutant
When medium treatment, the root of PP2A-C5-1 mutant is very short, and generates leaflet (Fig. 2 E), and PP2A-C5-1 mutation expression 35S-
The transgenic plant root growth of PP2A-C5 is normal, is similar to or is slightly longer than the root system system (Fig. 2 E) of those wild-type plants.Show
The mutation that T-DNA is inserted into PP2A-C5 gene is the main reason for causing PP2A-C5-1 mutant brine sensitivity.
Two, the gene expression amount of PP2A-C5 is induced by salt treatment, and PP2A-C5 overexpression improves cell PP2A activity
Since PP2A-C5-1 mutant is sensitive to salt stress, the expression of PP2A-C5 is possible to induction and tune by salt
Section.By on 8 day age Arabidopsis thaliana Seedlings transfer 200mM NaCl MS culture medium, at 0 hour, 3 hours, 6 hours after processing, 9 is small
When, 12 hours collection plant samples extract total serum IgE and analyze for RT-PCR.Statistics indicate that PP2A-C5 transcription produces at by salt
Reason up-regulation, the accumulation of PP2A-C5 transcription product highest (Fig. 3 A) after processing 3 hours.With the NaCl of difference, concentration
(500mM, 1000mM and 1500mM) processing, processing 6 hours after also collect sample, RT-PCR the result shows that, salt treatment concentration increase
Add, PP2A-C5 transcription product also increases Fig. 3 A).And highest PP2A-C5 transcript is not in 150mM after NaCl concentration induction
200mM (Fig. 3 B), it may be possible to due to 200mM NaCl excessive concentration and compromise the metabolism of cell.But apparent result is that
The expression quantity of PP2A-C5 is raised by salinity.
For the molecular mechanism for disclosing this salt stress-resistant, we determine PP2A-C5 overexpressing plants, mutant and open country
The enzymatic activity of raw type plant leaf PP2A, the results showed that, the enzymatic activity of the PP2A of overexpressing plants is significantly higher than wild type, and
The a little higher than mutant of wild type (Fig. 3 E).PP2A may be also improved after the enzymatic activity of PP2A to the regulating and controlling effect of CLCc by improving,
It is improved the ability of CLCc transport ions, to increase the salt stress-resistant ability of plant.
Three, overexpression PP2A-C5 improves the performance of the anti-sodium salt of plant
Since sensibility of the PP2A-C5-1 mutant to salt is high, implies a kind of possibility, that is, improve the expression of PP2A-C5
Its salt tolerance may be will increase.In order to test this possibility, we are constructed using 35S promoter is overexpressed PP2A-C5 plant
Strain.More than 30 independent transgenosis systems are obtained, 7 homozygous lines are analyzed by real-time quantitative PCR and western blot technology.
Show that PP2A-C5 transcription amount improves (Fig. 3 C) in 5 transgenic lines, western blot analysis shows on protein level
The expression quantity of PP2AC is also improved (Fig. 3 D).
Two transgenic strains C5-OE1 and C5-OE2, are selected as further studying.In root bend test, nothing is found
By being that C5-OE1 and C5-OE2 plant is transferred to containing after 75mM sodium chloride MS plate 10 days, no NaCl is handled, genetically modified plants table
Type is not different with wild-type plant, but the primary root of transgenic plant and root growth outperform wild type (Fig. 4 A).It is quantitative
Statistics indicate that the length of root stalk and root fresh weight of C5-OE1 and C5-OE2 are all remarkably higher than wild-type plant (Fig. 4 B & 4C).
Test shows identical as a result, there is no the plants that when salt, PP2A-C5 is overexpressed to plant than wild type in soil
Object is slightly good, but not significant (Fig. 4 D).However, being irrigated after two weeks with 250mM sodium chloride solution, it is significant that PP2A-C51 is overexpressed plant
(Fig. 4 E) better than wild-type plant.Show that PP2A-C5 plays a key role plant salt tolerance.
Four, overexpression PP2A-C51 transgenic plant improves utilization of the plant to sylvite and nitrate nitrogen
It whether is specific to sodium chloride, research to the reaction of salt to study PP2A-C5-1 overexpression and mutant
The reaction of transgenic plant and mutant to sylvite.By PP2A-C5-1 overexpression and mutant in 75mM KCL and 75mM
KNO3It is handled on culture medium.It was found that PP2A-C5-1 mutant is more quicker to this 2 kinds of salt than wild-type plant (Fig. 6)
Sense.And PP2A-C5 overexpression genetically modified plants are higher to the tolerance of this 2 kinds of salt (Fig. 6), plant growth is more preferable than wild type,
Performance on potassium nitrate is more prominent.Show that the overexpression plant of PP2A-C5 is not only resistant to sodium chloride and potassium chloride, is also resistant to
Nitrate.This plant can improve biological yield by absorbing more potassium and nitrogen.
Five, the plant saline-alkaline tolerance of overexpressing cells tonoplast AtCLCc gene is improved
CLCc is one H of plant cell tonoplast+/CL-Antiporter protein utilizes tonoplast combination proton pump such as H+-
The H that ATP enzyme and V- pyrophosphatase generate+Gradient plays its function.To test whether the overexpression of CLCc improves genetically modified plants
Salt tolerance, we create be overexpressed AtCLCc overexpression plant.Two AtCLCc overexpression strains, CLCc-OE1,
CLCc-OE2 is used for salt tolerance test, and in the presence of 100mM NaCl, AtCLCc overexpression plant significantly improves resistance to really
Salt performance (Fig. 7).
Six, there is interaction between PP2A-C5 and AtCLCc albumen, PP2A-C5 passes through regulating cell tonoplast AtCLCc
Gene increases PP2A activity to improve the saline-alkaline tolerance of cell
Using PEG202 as plasmid (commercially available), recombination " bait " (bait) matter of 6 subunits of PEG202-AtCLC is constructed respectively
Grain；Using PJG4-5 as plasmid (commercially available), recombination " prey " (prey) plasmid of 5 subunits of PJG4-PP2AC is constructed；It will
6 subunit DNA plasmids of PEG202-AtCLC are transferred to yeast respectively, and strain is EGY48 (commercially available), and competence is made in positive colony
Cell, then 5 subunits of PJG4-5PP2AC are transferred to respectively in above-mentioned competent cell.The clone of acquisition turns to be coated onto containing galactolipin
Yeast culture medium on.It is positive colony that transformant, which shows blue, illustrates that corresponding 2 kinds of albumen has interaction in saccharomycete
Relationship；Do not become blue, illustrate that corresponding 2 kinds of albumen does not have interaction in saccharomycete (see Fig. 5).Test is used to draw
Object is as follows：
CLCa-YF1 sequence is shown in SEQ ID NO.6.CLCa-YR1 sequence is shown in SEQ ID NO.7.CLCb-YF1 sequence is shown in SEQ
ID NO.8.CLCb-YR1 sequence is shown in SEQ ID NO.9.CLCc-YF1 sequence is shown in SEQ ID NO.10.CLCc-YR1 sequence is shown in
SEQ ID NO.11.CLCd-YF1 sequence is shown in SEQ ID NO.12.CLCd-YR1 sequence is shown in SEQ ID NO.13.CLCe-YF1 sequence
Column are shown in SEQ ID NO.14.CLCe-YR1 sequence is shown in SEQ ID NO.15.CLCf-YF1 sequence is shown in SEQ ID NO.16.CLCf-
YR1 sequence is shown in SEQ ID NO.17.C1-YF1 sequence is shown in SEQ ID NO.18.C1-YR1 sequence is shown in SEQ ID NO.19.C2-
YF1 sequence is shown in SEQ ID NO.20.C2-YR1 sequence is shown in SEQ ID NO.21.C3-YF1 sequence is shown in SEQ ID NO.22.C3-
YR1 sequence is shown in SEQ ID NO.23.C4-YF1 sequence is shown in SEQ ID NO.24.C4-YR1 sequence is shown in SEQ ID NO.25.C5-
YF1 sequence is shown in SEQ ID NO.26.C5-YR1 sequence is shown in SEQ ID NO.27.Tom20-YF1 sequence is shown in SEQ ID NO.28.
Tom20-YR1 sequence is shown in SEQ ID NO.29.
Seven, the plant saline-alkaline tolerance of overexpressing cells tonoplast CLCc-A is further enhanced
The CLCc-A overexpression obtained after artificial reconstructed obtains transgenic plant to arabidopsis, is used for salt tolerance
Test, the Arabidopsis plant of 7 days sizes are transplanted to regrowth 7 days in soil.It is irrigated 10 days with 200mM NaCl, CLCc-A crosses table
The ability that can be further improved plant salt resistance evil really up to plant shows as the growth of CLCc-A transgenosis plant better than CLCc
Transgenic plant, and the growth of this 2 plant is superior to wild type.(Fig. 8).The average dry amount of CLCc-A transgenic plant
0.095g/ plants, 0.079g/ plants of average dry amount of CLCc transgenic plant, the average dry amount 0.042g/ of WT lines
Strain.The average dry amount ratio CLCc of CLCc-A increases by 20.3%, increases by 195.8% than wild type.The leaf growth number of plant and
Dry amount has identical effect (table 1).
The increment of 1. transgenic line of table
Note：3 tests, 3 replicated plots, 18 plants of every replicated plot.
Above-mentioned embodiment is only a preferred solution of the present invention, not the present invention is made in any form
Limitation, there are also other variations and modifications on the premise of not exceeding the technical scheme recorded in the claims.
Claims (4)
1. a kind of method for improving Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously, it is characterised in that：By by arabidopsisPP2A-C5Channel genes purpose plant improves Genes For Plant Tolerance sodium salt and increases potassium and nitrogen Utilization ability simultaneously.
2. according to the method described in claim 1, it is characterized in that：By arabidopsisPP2A-C5The tool of channel genes purpose plant
Steps are as follows for body：
(1) building of plant expression vector：According to gene cds sequence design DNA primer in arabidopsis Tair biological information library, with
Arabidopsis cDNA library is template, with the method for PCR, amplification genePP2A-C5CDNA, with plasmid pFGC5941 construct plant
Expression vector, the cDNA and Plasmid DNA of amplification carry out digestion, T4 ligase connection, using on pFGC5941 with NcoI and Bam I
35S promoter startingPP2A-C5The plant expression vector of gene, acquisition is named as pFGC5941-35S-PP2A-C5；
(2) acquisition of genetically modified plants：The plant expression vector pFGC5941- that step (1) is obtained35S- PP2A-C5It imports
Plant expression vector is transferred to purpose plant using agrobacterium-mediated transformation, obtains genetically modified plants by Agrobacterium.
3. according to the method described in claim 2, it is characterized in that：DNA primer in step (1) includes OC5-F1 and OC5-
R1, OC5-F1 sequence are as shown in SEQ ID NO.1, and OC5-R1 sequence is as shown in SEQ ID NO.2.
4. a kind of arabidopsisPP2A-C5The purposes of gene, it is characterised in that：For improving Genes For Plant Tolerance sodium salt while increasing potassium and nitrogen
The purposes of Utilization ability.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510960787.0A CN105505961B (en) | 2015-12-18 | 2015-12-18 | A kind of method and gene for improving Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510960787.0A CN105505961B (en) | 2015-12-18 | 2015-12-18 | A kind of method and gene for improving Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105505961A CN105505961A (en) | 2016-04-20 |
| CN105505961B true CN105505961B (en) | 2018-11-27 |
Family
ID=55714254
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510960787.0A Active CN105505961B (en) | 2015-12-18 | 2015-12-18 | A kind of method and gene for improving Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105505961B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113136389B (en) * | 2021-04-16 | 2023-02-14 | 河南农业大学 | Genetic engineering application of gene GhCLcg-1A and/or GhCLcg-1D |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134574A (en) * | 2010-01-21 | 2011-07-27 | 湖南大学 | Arabidopsis thaliana atpp2ca2 gene and application thereof |
| CN102943084A (en) * | 2012-11-28 | 2013-02-27 | 上海市农业生物基因中心 | Rice stress resistance related gene OsPP2C44 and coded protein and application thereof |
-
2015
- 2015-12-18 CN CN201510960787.0A patent/CN105505961B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134574A (en) * | 2010-01-21 | 2011-07-27 | 湖南大学 | Arabidopsis thaliana atpp2ca2 gene and application thereof |
| CN102943084A (en) * | 2012-11-28 | 2013-02-27 | 上海市农业生物基因中心 | Rice stress resistance related gene OsPP2C44 and coded protein and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Accession ID:AY120754，Arabidopsis thaliana chloride channel (At5g49890)mRNA，complete cds;southwick ,A. et al.;《NCBI Genbank》;20020622;CDS,origin * |
| Arabidopsis Phosphotyrosyl phosphatase activator is essential for protein phosphatase 2A Holoenzyme assembly and plays important roles in hormone signaling，salt stress response，and plant development;Jian Chen et al.;《plant physiology》;20141130;第1519页左栏第1段，第1520页左栏第2段 * |
| southwick ,A. et al..Accession ID:AY120754，Arabidopsis thaliana chloride channel (At5g49890)mRNA，complete cds.《NCBI Genbank》.2002, * |
| The Arabidopsis vacuolar anion transporter，AtCLCc，is involved in the regulation of stomatal movements and contributes to salt tolerance;Mathieu Jossier et al.;《the plant journal》;20101005;第564页右栏第3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105505961A (en) | 2016-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shi et al. | Overexpression of a plasma membrane Na+/H+ antiporter gene improves salt tolerance in Arabidopsis thaliana | |
| Bouchabke-Coussa et al. | ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance | |
| Zhang et al. | A newly isolated Na+/H+ antiporter gene, DmNHX1, confers salt tolerance when expressed transiently in Nicotiana benthamiana or stably in Arabidopsis thaliana | |
| EA024524B1 (en) | Genes, proteins and vectors for increaseing tolerance of plants and microbes to abiotic stresses and the use thereof | |
| CN102732526B (en) | Application of OsSRO1c gene in controlling rice drought resistance | |
| CN113105534B (en) | Application of WRKY55 transcription factor in plant salt resistance | |
| MX2007013870A (en) | Plants containing a heterologous flavohemoglobin gene and methods of use thereof. | |
| CN104195150A (en) | Application of arabidopsis glycosyl transferase gene UGT79B2 in improving salt resistance and drought resistance of plants | |
| CN107828805A (en) | Rice epoxy carotenoid dioxygenase OsNCED3 gene coded sequences and its application | |
| CN108728449B (en) | Application of cotton gene GhDTX27 in aspects of salt tolerance, drought tolerance and cold stress of plants | |
| CN113322261B (en) | Application of soybean ABC transporter gene GmALS3 in breeding of low-phosphorus-resistant and aluminum-toxicity-resistant plants | |
| CN105505961B (en) | A kind of method and gene for improving Genes For Plant Tolerance sodium salt and increasing potassium and nitrogen Utilization ability simultaneously | |
| CN103060285A (en) | Application of OsPP18 gene on control of rice drought resistance | |
| Li et al. | Analysis of physiological characteristics of abscisic acid sensitivity and salt resistance in Arabidopsis ANAC mutants (ANAC019, ANAC072 and ANAC055) | |
| CN111979253A (en) | TrFQR1 gene, clone thereof, expression vector construction method and application | |
| CN103602644A (en) | Vacuole proton pyrophosphatase as well as encoding gene and application thereof | |
| CN105949296A (en) | Peanut MYB transcription factor AhMYB32 and application thereof | |
| CN103804478A (en) | Stress tolerance associated protein TaSAP1 of plants as well as coding gene and application thereof | |
| CN103194458B (en) | Method for improving phosphorus absorption efficiency of wheat plant by using sucrose transporter gene | |
| CN104531722A (en) | Suaeda salsa RAV gene and recombinant vector containing same | |
| CN111269924B (en) | Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof | |
| CN103468711B (en) | Pongamia pinnata stress tolerance relative gene MpZFP as well as coded protein and application thereof | |
| CN103421810B (en) | Application of BIP4 gene in controlling drought resistance of submerged rice | |
| CN111718942A (en) | Rice salt tolerance related gene GT3 and application thereof | |
| KR102633465B1 (en) | SIPRR2-1 gene and Method for improving the resistance to the drought and salt stresses using SIPRR2-1 in plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 310021 No. 198 Shiqiao Road, Hangzhou, Zhejiang, Jianggan District Patentee after: Zhejiang Academy of Agricultural Sciences Patentee after: Zhejiang Baifan Agricultural Development Co., Ltd Address before: 310021 No. 198 Shiqiao Road, Hangzhou, Zhejiang, Jianggan District Patentee before: Zhejiang Academy of Agricultural Sciences Patentee before: Zhejiang Baifan Agricultural Development Co., Ltd |
|
| CP01 | Change in the name or title of a patent holder |