CN102134574A - Arabidopsis thaliana atpp2ca2 gene and application thereof - Google Patents

Abstract

The invention discloses protein phosphatases 2C of arabidopsis thaliana and encoding gene and application thereof. The invention aims at providing the protein phosphatases 2C of the arabidopsis thaliana, the encoding gene thereof, and application thereof to controlling growth and development and stress resistance of plants. The AtPP2CA2 gene disclosed by the invention is found through screening from a cDNA database of arabidopsis thaliana processed by ABA (Abscisic Acid), salt and drought induction by using a gene chip method, the number of the AtPP2CA2 gene in GenBank is At5g59220, the length of cDNA of the gene is 1242bp, and the gene encodes 413 aa proteins. The gene disclosed by the invention and the encoding protein thereof have great theoretic and practical significance in research of inverse resistance mechanism of plants and improvement of inverse resistance such as drought endurance, salt tolerance and the like and relevant properties, and play an important role in the improvement of inverse-resistance gene engineering of plants, and have broad application prospect.

Description

Arabidopis thaliana AtPP2CA2 gene and application thereof

Technical field

The present invention relates to the genetically engineered field, be specifically related to a kind of application of arabis protein Phosphoric acid esterase 2C gene.

Background technology

Biological at different developmental stages and in the changeable external environment of adaptation, all need the phraseology of autogene is made adjustment in time and accurately.For example plant often is subjected to the influence of various environmental factors in growth and development process, wherein have complicated information to experience, discern and conduct and make the process of corresponding biochemical reactions, and a related important cells biology incident of this process is proteinic reversible phosphorylation.Research (Kerk etc. 2002, and Luan 2003) shows that proteinic reversible phosphorylation is played an important role in each signal transduction path of vital movement, by to the modification of substrate molecule with go to modify cascade and the conduction that realizes signal.This modification is to be finished by the enzymatic action of protein kinase and this a pair of enzyme of phosphoprotein phosphatase, wherein the protein kinase instruction of accepting the stream signal molecule makes the substrate molecule phosphorylation, the substrate molecule of phosphorylation and then excite downstream signaling molecule is conducted signal; Phosphoprotein phosphatase then is make it to revert to original state when need removing certain signal pathway that is excited, or plays regulating and controlling effect when keeping the opening or closing of certain signal pathway.Research in the past mainly lays particular emphasis on the effect of protein kinase in signal transduction path, and the finely regulating effect in the bio signal conduction is known little about it to the protein dephosphorylation.Since there is the function overlapping phenomenon between the gene of coding kinases/Phosphoric acid esterase, the function of most of Phosphoric acid esterases, and how protein phosphorylation interrelate with the individual signals pathway, also not clear at present.

Have numerous protein kinase and Phosphoric acid esterase in the plant, participate in all respects of numerous and jumbled signal network in the body, for example the gene of proteins encoded Phosphoric acid esterase has 112 (Kerk etc. 2002) in the arabidopsis gene group.The vegetable-protein Phosphoric acid esterase is divided into two big classes usually, promptly albumen serine/threonine Phosphoric acid esterase (protein Ser/Thr phosphatases, PSPs) and Protein-tyrosine-phosphatase (protein Tyr phosphatases, PTPs).The phosphate group of Serine or threonine residues on the single-minded removal substrate protein of PSPs, the phosphate group of tyrosine residues on the then single-minded removal substrate protein of PTPs.In addition, also have two specialization Phosphoric acid esterases that a class can both work to serine/threonine and tyrosine (dual specificityphosphatases, DSPs).Difference according to catalytic subunit, PSPs is divided into protein phosphatase 1 (protein phosphatase 1, PP1), phosphoprotein phosphatase 2 (protein phosphatase 2, PP2), wherein PP2 then requires further to be subdivided into phosphoprotein phosphatase 2A (protein phosphatase 2A because of the difference to metal ion, PP2A), phosphoprotein phosphatase 2B (protein phosphatase 2B, PP2B), (protein phosphatase 2C PP2C) waits subclass to phosphoprotein phosphatase 2C.PP2A keeps its biological activity does not need ion to participate in, and PP2B needs Ca ²⁺Participate in, PP2C then needs Mg ²⁺Or Mn ²⁺Participate in.Higher sequence homology is arranged between PP1, PP2A, PP2B, form phosphoprotein phosphatase P (proteinphosphatase P, PPP) family; PP2C then with needs Mg ²⁺Pyruvic oxidase Phosphoric acid esterase and other serine/threonine Phosphoric acid esterase (Ser/Thr phosphatases, STs) constitutive protein Phosphoric acid esterase M (protein phosphatase M, PPM) (Luan 2000, and Luan 2003).PP2C is a kind of monomeric protein Phosphoric acid esterase, and its amino acid homology zone mainly is positioned at the catalyst structure domain of C end, and the N end then contains one section elongated area that conservative property is not strong, and may there be regulating and controlling effect in this zone to the activity of PP2C.Up to the present, in the arabidopsis gene group, confirmed the gene (Kerk etc. 2002) of 76 coding PP2C, independently evolve to independent bunch except that 6 genes wherein, remaining 70 gene forms 10 bunches of (A-Jcluster) (Schweighofer etc. 2004).

PP2C plays important effect in the plant in the cell signaling process.Wherein studying morely is the various types of signal pathway that participates in dormin (ABA) regulation and control about PP2C.So far, in Arabidopis thaliana PP2C gene family, identified 5 gene A BI1, ABI2, AtPP2CA, HAB1 and HAB2 that participate in the ABA signal pathways, and they all are that (Saez etc. 2004 for the negative regulatory factor of ABA signal; Kuhn etc. 2006; Nishimura etc. 2007; Fujii etc. 2009; Miyazono etc. 2009; Ma etc. 2009; Park etc. 2009; Rubio etc. 2009; Umezawa etc. 2009).Studies show that (Saez etc. 2004 for seed dormancy/sprouting signal pathway, ionic channel and the Guard Cell Signal Transduction approach of ABI1 and ABI2 participation ABA regulation and control and degeneration-resistant signal pathway; Yoshida etc. 2006; Ma etc. 2009; Umezawa etc. 2009); AtPP2CA also may participate in stomatal closure, seed germination and degeneration-resistant signal pathway (Tahtiharju and the Palva 2001 of ABA regulation and control; Yoshida etc. 2006; Miyazono etc. 2009).PP2C except that each approach that participates in the ABA signal, also may the involved in plant body in other multiple signal pathway, comprise response to traume, grow and disease-resistant etc. (Schweighofer etc. 2004).But the effect of AtPP2CA2 gene in processes such as regulating growth of plants and stress response also do not appear in the newspapers as yet.

Summary of the invention

The purpose of this invention is to provide the application of a kind of arabis protein Phosphoric acid esterase AtPP2CA2 gene in regulating growth of plants and resistance.

The present invention adopts the method for gene chip to screen from the Arabidopis thaliana cDNA library of ABA, salt and drought-induced processing and finds protein phosphatase gene AtPP2CA2, its numbering in GenBank is At5g59220, the long 1242bp of the cDNA of this gene, the albumen of 413 aa of coding.

The present invention finds that the albumen of described arabis protein Phosphoric acid esterase AtPP2CA2 genes encoding mainly is positioned on the nucleus.This gene is functionating in nucleus mainly.

The transgenic experiments of arabis protein Phosphoric acid esterase AtPP2CA2 of the present invention proves, this gene participates in processes such as regulation and control growth and development of plant and stress response, thereby for the improvement of plant variety provides a high-quality gene, the meaning that also biological procedures of deeply understanding phosphoprotein phosphatase PP2C and biological function is had particularly important simultaneously.Gene of the present invention and proteins encoded thereof have important economic implications and application prospect.

Description of drawings

Fig. 1: the onion epidermis cell under the proteic Subcellular Localization .A. blue light of onion epidermis cell transient expression AtPP2CA2 (395nm) excites; Onion epidermis cell after the B.DAPI dyeing.

Fig. 2: the wild-type Arabidopis thaliana is subjected to the expression analysis after the abduction delivering situation .A.PP2CA2 gene of ABA and NaCl is induced by NaCl; Expression analysis after the B.PP2CA2 gene is induced by ABA.

The PP2CA2 gene inserts the mutational site synoptic diagram in the evaluation .A. mutant of Fig. 3: T-DNA insertion mutant; The PCR that the T-DNA of B.PP2CA2 inserts mutant identifies; The sxemiquantitative RT-PCR that the T-DNA of C.PP2CA2 inserts mutant identifies.

Fig. 4: seed germination rate and green bud rate that different concns ABA handles behind wild-type and the pp2ca2 deletion mutant are analyzed the .A. germination rate; B. green bud rate.

Fig. 5: different concns NaCl handles the seed germination rate analysis behind wild-type and the pp2ca2 deletion mutant.

Seed germination rate when Fig. 6: ABA handles behind wild-type and the pp2ca2 deletion mutant the 1st, 2,3 days is analyzed .A.0.1uM ABA; B.0.6uM ABA.

Fig. 7: wild-type and the pp2ca2 mutant root after ABA handles is long to be changed.

Fig. 8: the expression analysis .A.100uM ABA of stress response genes involved in pp2ca2 mutant and wild-type handles; B.300mM NaCl handles.

Fig. 9: wild-type and 35S::AtPP2CA2 cross the sxemiquantitative RT-PCR that expresses the mutant seedling and analyze.

Figure 10: different concns ABA processing wild-type and 35S::AtPP2CA2 cross the seed germination rate analysis behind the expression mutant.

Figure 11: different concns ABA processing wild-type and 35S::AtPP2CA2 cross hypocotyl and the long analysis of root behind the expression mutant.

Figure 12: the comparative analysis of wild-type and 35S::AtPP2CA2 mutant plant leaf rate-of-loss of coolant.

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, and the primer is synthetic to be finished by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd with examining order.

The structure of embodiment 1, AtPP2CA2 gene GFP fusion expression vector

Extract total RNA of Arabidopis thaliana seedling, extracting adopts RNAeasy Mini Kit (Ambiogen Bioisystech Co., Ltd) to carry out according to explanation, reverse transcription is operated according to Invitrogen M-MLV Reverse Transcriptase Instruction, get 2 μ g and be used for the synthetic of cDNA first chain through total RNA of DNaseI processing, product is as the RT-PCR template.The pcr amplification of AtPP2CA2 gene: according to a pair of Auele Specific Primer of mRNA sequences Design of the AtPP2CA2 of TAIR (http://www.arabidopsis.org/) prediction, 5 ' end at the upstream and downstream primer adds attB1 and attB2 site respectively, utilizes the Gateway technology to clone.The primer of AtPP2CA2 full-length cDNA amplification is as follows: 5 ' end primer is 5 '-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTGAGATTTGTTACGAGAA-3 '; 3 ' end primer is 5 '-GGGGACCACTTTGTACAAGAAAGCTGGGTG CGTGTCTCGTCGTAGATC-3 '.The PCR response procedures is: 98 ℃ of pre-sex change 1min, 98 ℃ of 10s, 55 ℃ of 10s, 72 ℃ of 1.5min, totally 30 circulations.Agarose gel electrophoresis with 1% reclaims the PCR product that is about 1242bp.BP recombining reaction: the BP recombination kit that utilizes Invitrogen company, the fragment and the entry vector pDONR201 of AtPP2CA2 gene PCR amplification back purifying are carried out recombining reaction according to the test kit specification sheets, the competent cell of recombinant products transformed into escherichia coli DH5a, obtain the clone that crosses the threshold, with containing kalamycin 50 μ g/ml LB plate screening positive colonies, hand over the order-checking of order-checking company then, obtain positive recombinant pDONR201-AtPP2CA2.LR recombining reaction: the LR recombination kit that utilizes Invitrogen company, the AtPP2CA2 gene and the destination carrier 35S-GW-GFP that are cloned on the pDONR201 are carried out recombining reaction according to the test kit specification sheets, the competent cell of transformed into escherichia coli DH5a, with containing penbritin 100 μ g/ml LB plate screening positive colonies, detect positive colony by bacterium colony PCR, obtain the 35S:GFP:AtPP2CA2 positive recombinant.

The particle gun bombardment of embodiment 2,35S:GFP:AtPP2CA2 fusion expression vector

The bronze embedding of DNA is according to the method for Biolistic PDS-1000/He Particle Delivery System.Get bronze suspension 50 μ L (60gL ^-1), add the CaCl of 50 μ L ₂(2.5mol ^-1), 20 μ L spermidine (0.1molL ^-1), the abundant mixing of 35S:GFP:AtPP2CA2 vector plasmid of 3 μ g, centrifugal, the absolute ethanol washing precipitation, suspending again is deposited in the 50 μ L dehydrated alcohols.Adopt the Bio-RadPDS-1000/He particle gun to bombard, can split film pressure is 1.3kPa, and onion (fritter of about 1cm * 1cm) is placed on 10gL ^-1On the nutrient agar, be 6cm, transform the back and continue to cultivate 16-24h, film-making, the green fluorescence under fluorescent microscope (OLYMPUS-BH2) in the observation of cell to splitting the film distance.Select B (IF-490) exciter filter for use, take pictures with the full-automatic photomicrographic apparatus of PM-30.Experimental result shows that AtPP2CA2 albumen mainly is positioned at (Fig. 1) on the nucleus.

Embodiment 3, wild-type Arabidopis thaliana are subjected to the abduction delivering situation of ABA and NaCl

The Arabidopis thaliana wild-type seedling in 2 ages in week is handled with 100mM NaCl and 10 μ M ABA respectively, and (2h 4h) collects material respectively after the processing for 0h, 1h, extracts total RNA and carries out sxemiquantitative RT-PCR analysis at different time.The primer of PP2CA2 gene is: PP2CA2F (5 '-CAGCGGGTGGTCGTGTTA-3 '), PP2CA2R (5 '-CGCAAGCCTCGTCAGCAA-3 ').The primer of contrast Actin-2 is as follows: Actin-2F:5 '-CACTGTGCCAATCTACGAGGGT-3 '; Actin-2R:5 '-CACAAACGAGGGCTGGAACAAG-3 '.100mMNaCl and 10 μ M ABA induce the rising (Fig. 2) of PP2CA2 gene expression amount.

The phenotype of embodiment 4, AtPP2CA2 gene inactivation homozygous mutation body

One, the screening of AtPP2CA2 gene inactivation homozygous mutation body

With following method screening Arabidopis thaliana AtPP2CA2 inactivation homozygous mutation body: the seed (Salk_108282) that obtains the mutant strain system that the T-DNA in AtPP2CA2 site inserts from ABRC (Arabidopsis Biological Resource Center), AtPP2CA2 inactivation homozygous mutation body, called after pp2ca2 have been obtained by the PCR evaluation.Wherein the T-DNA mutant of AtPP2CA2 identifies that the primer is as follows: 5 ' end primer: 5 '-TTATCCTTTAATTGACCG-3 '; 3 ' end primer: GAGTAAACCATAACCGTAG; LBpROK2:5 '-TGGTTCACGTAGTGGGCCATC-3 '.The primer of contrast Actin-2 is with above-mentioned enforcement 3.Qualification result as shown in Figure 3.

Two, the phenotype analytical of inactivation homozygous mutation body pp2ca2 and wild-type

1, germination rate and green bud rate are analyzed

With Col-0 and pp2ca2 mutant seed after sterilizing in 4 ℃ of vernalization 4 days, the subregion sowing is transferred to continuous white light and is cultivated 4～6 days statistics germination rates in containing the MS substratum of different concns ABA and NaCl then.The result shows (Fig. 4 A and Fig. 5), and when not adding ABA and NaCl in the substratum, the germination rate of wild type seeds is near the pp2ca2 deletion mutant; When with different concns ABA (0,0.1,0.3,0.6uM) and NaCl (50,100,150mM) after the processing, the germination rate of wild type seeds is lower than the pp2ca2 deletion mutant.When (0,0.1,0.3,0.6uM) after the processing, the green bud rate of wild type seeds is lower than pp2ca2 deletion mutant (Fig. 4 B) with different concns ABA.In addition, we analyzed Col-0 and pp2ca2 mutant seed 0.1 and 0.6uM handle the 1st, 2, the germination rate after 3 days, the result shows that the germination rate of wild type seeds is lower than pp2ca2 deletion mutant (Fig. 6).

2, root is long analyzes

In view of the seed germination of pp2ca2 mutant shows the hyposensitiveness sense to ABA, NaCl, we have analyzed the susceptibility of mutant root elongation to ABA again.We to containing 0,0.1,0.3, on the MS substratum of 0.6uM cultivate 6 days mutant and wild-type seedling replanting 12 days, and relatively both roots are long then changes.The result shows (Fig. 7), compares with wild-type, and the long change list of the root of pp2ca2 mutant reveals the hyposensitiveness sense to Exogenous ABA.

3, the expression analysis of stress response genes involved in pp2ca2 mutant and wild-type

The seedling of the wild-type of 15 days seedling ages and pp2ca2 mutant is handled with 100uM ABA and 300mM NaCl respectively, extract and carry out sxemiquantitative RT-PCR behind total RNA and analyze.The ABI1 gene primer is: F:5 '-CTGGGTCACATGGTTCTGAATCTAG-3 ', R:5 '-TCTCTCTACAATAGTTCGCTACCTG-3 '; The ABI2 gene primer is: F:5 '-TTTGACGGAGGAGATAGTGAAGGAG-3 ', R:5 '-GGATTAAATCCATTAGTGACTCGAC-3 '; The KIN2 gene primer is: F:5 '-CTGGCAAAGCTGAGGAGA-3 ', R:5 '-CGTAGTACATCTAAAGGGAG-3 '; The SOS3 gene primer is: F:5 '-TGCAATGCGACCACCGGGATATGAG-3 ', R:5 '-CGTGAATGGCGTGACGGATGCAAGA-3 '; The SOS3 gene primer is: F:5 '-CTACAAAAGCAGTGCAGTGT-3 ', R:5 '-CTACCTTTTGTGAAGTCCTCC-3 '; The OST1 gene primer is: F:5 '-TATGCACGATAGTGATAGGTATGAA-3 ', R:5 '-GTTGCGAATGTAACACTGATGACTT-3 '.The result shows (Fig. 8), the expression amount of these stress response genes involveds in pp2ca2 mutant and wild-type there are differences, the disappearance that shows the PP2CA2 gene has influenced Expression of Related Genes regulation and control in the regulation and control plant stress acknowledge signal pathway, proves that further the PP2CA2 gene is relevant with the anti-ability of coercing of plant.

The phenotype analytical of embodiment 5, AtPP2CA2 gene overexpression mutant

One, the structure of AtPP2CA2 gene overexpression carrier

Based on plant expression vector pLeela, adopt the Gateway technique construction and contained the efficient expression vector of 35S promoter, the primer of AtPP2CA2 gene of wherein increasing is: F:5 '-CCGGAATTCGCCAGACCGTCCGGACGA-3 ', R:5 '-CGCCTCGAGCTACGTGTCTCGTCGTAGATCA-3 ').Concrete operations such as embodiment 1.Adopt inflorescence infusion method arabidopsis thaliana transformation, do when transforming, the bud of Arabidopis thaliana is immersed in the conversion fluid, keep 0.5-2min.Plant after the conversion keeps flat, entangle with preservative film and to preserve moisture,, grow under the normal illumination condition then removing behind the growth 24h under dark or the low light intensity, the Arabidopis thaliana that transforms is the unfertilized flower that will be fertilized, so we can transform 2-3 time once more according to florescence of Arabidopis thaliana.Baster screening transgenic positive plant is for next step phenotype analytical and detection are prepared.

Two, 35S::AtPP2CA2 crosses the feature of express transgenic plant

Behind Baster screening transgenic positive plant, the 35S::AtPP2CA2 transgenosis seedling in 15 day age and wild-type seedling extracted carry out sxemiquantitative RT-PCR behind total RNA and analyze.The result shows (Fig. 9), transgenic line T-7, and T-11, AtPP2CA2 expression of gene amount obviously raises among the T-22.

Three, the phenotype analytical of 35S::AtPP2CA2 genetically modified mutant and wild-type

1, germination rate analysis

With Col-0 and 35S::AtPP2CA2 mutant seed after sterilizing in 4 ℃ of vernalization 4 days, the subregion sowing is transferred to continuous white light and is cultivated 4～6 days statistics germination rates in containing the MS substratum of different concns ABA then.The result shows (Figure 10), when with different concns ABA (0,0.3,0.6uM) handle 48h, 72h, 96h, behind the 120h, the germination rate of wild type seeds is higher than the 35S::AtPP2CA2 mutant.

2, hypocotyl and root are long analyzes

6 days 35S::AtPP2CA2 mutant and wild-type seedling replanting were cultivated 12 days to the MS substratum that contains 0,10,20,30 and 40 μ M ABA, then the relatively long variation of both hypocotyls and root.The result shows (Figure 11), and the hypocotyl length of 35S::AtPP2CA2 mutant is in wild-type, and root rise length in wild-type.

3, the blade rate-of-loss of coolant is analyzed

3 week the 35S::AtPP2CA2 mutant in ages and the blade of wild-type plant respectively with 0 and 10uM ABA processing 2.5h after, analyze the variation of blade rate-of-loss of coolant, the result shows (Figure 12), and under 0uM ABA handled, the blade rate-of-loss of coolant of 35S::AtPP2CA2 mutant was lower than wild-type; Under 10uM ABA handled, the blade rate-of-loss of coolant of 35S::AtPP2CA2 mutant was similar in appearance to the variation of wild-type.

Sequence table

＜110〉Hunan University

＜120〉Arabidopis thaliana AtPP2CA2 gene and application thereof

<130>

<160>23

<170>PatentIn?Version?3.5

<210>1

<211>1242

<212>DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400>1

atggctgaga?tttgttacga?gaacgagact?atgatgattg?aaacgacggc?gacggtggtg 60

aagaaggcaa?cgacgacaac?gaggagacga?gaacggagct?cgtctcaagc?agcgagaaga 120

aggagaatgg?agatccggag?gtttaagttt?gtttccggcg?aacaagaacc?tgtcttcgtc 180

gacggtgact?tacagaggcg?gaggagaaga?gaatccaccg?tcgcagcctc?cacctccacc 240

gtgttttacg?aaacggcgaa?ggaagttgtc?gtcctatgcg?agtctcttag?ttcaacggtt 300

gtggcattgc?ctgatcctga?agcttatcct?aaatacggcg?tcgcttcagt?ctgtggaaga 360

agacgtgaaa?tggaagacgc?cgtcgctgtg?catccgtttt?tttcccgtca?tcagacggaa 420

tattcatcca?ccggatttca?ctattgcggc?gtttacgatg?gccatggctg?ttcccatgta 480

gcgatgaaat?gtagagaaag?actacacgag?ctagtccgtg?aagagtttga?agctgatgct 540

gactgggaaa?agtcaatggc?gcgtagcttc?acgcgcatgg?acatggaggt?tgttgcgttg 600

aacgccgatg?gtgcggcaaa?atgccggtgc?gagcttcaga?ggccggactg?cgacgcggtg 660

ggatccactg?cggttgtgtc?tgtccttacg?ccggagaaaa?tcatcgtggc?gaattgcggt 720

gactcacgtg?ccgttctctg?tcgtaacggc?aaagccattg?ctttatcctc?cgatcataag 780

ccagaccgtc?cggacgagct?agaccggatt?caagcagcgg?gtggtcgtgt?tatctactgg 840

gatggcccac?gtgtccttgg?agtacttgca?atgtcacgag?ccattggaga?taattacttg 900

aagccgtatg?taatcagcag?accggaggta?accgtgacgg?accgggccaa?cggagacgat 960

tttcttattc?tcgcaagtga?cggtctttgg?gacgttgttt?caaacgaaac?tgcatgtagc 1020

gtcgttcgaa?tgtgtttgag?aggaaaagtc?aatggtcaag?tatcatcatc?accggaaagg 1080

gaaatgacag?gtgtcggcgc?cgggaatgtg?gtggttggag?gaggagattt?gccagataaa 1140

gcgtgtgagg?aggcgtcgct?gttgctgacg?aggcttgcgt?tggctagaca?aagttcggac 1200

aacgtaagtg?ttgtggtggt?tgatctacga?cgagacacgt?ag

<210>2

<211>413

<212>PRT

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400>2

Met?Ala?Glu?Ile?Cys?Tyr?Glu?Asn?Glu?Thr?Met?Met?Ile?Glu?Thr?Thr

1 5 10 15

Ala?Thr?Val?Val?Lys?Lys?Ala?Thr?Thr?Thr?Thr?Arg?Arg?Arg?Glu?Arg

20 25 30

Ser?Ser?Ser?Gln?Ala?Ala?Arg?Arg?Arg?Arg?Met?Glu?Ile?Arg?Arg?Phe

35 40 45

Lys?Phe?Val?Ser?Gly?Glu?Gln?Glu?Pro?Val?Phe?Val?Asp?Gly?Asp?Leu

50 55 60

Gln?Arg?Arg?Arg?Arg?Arg?Glu?Ser?Thr?Val?Ala?Ala?Ser?Thr?Ser?Thr

65 70 75 80

Val?Phe?Tyr?Glu?Thr?Ala?Lys?Glu?Val?Val?Val?Leu?Cys?Glu?Ser?Leu

85 90 95

Ser?Ser?Thr?Val?Val?Ala?Leu?Pro?Asp?Pro?Glu?Ala?Tyr?Pro?Lys?Tyr

100 105 110

Gly?Val?Ala?Ser?Val?Cys?Gly?Arg?Arg?Arg?Glu?Met?Glu?Asp?Ala?Val

115 120 125

Ala?Val?His?Pro?Phe?Phe?Ser?Arg?His?Gln?Thr?Glu?Tyr?Ser?Ser?Thr

130 135 140

Gly?Phe?His?Tyr?Cys?Gly?Val?Tyr?Asp?Gly?His?Gly?Cys?Ser?His?Val

145 150 155 160

Ala?Met?Lys?Cys?Arg?Glu?Arg?Leu?His?Glu?Leu?Val?Arg?Glu?Glu?Phe

165 170 175

Glu?Ala?Asp?Ala?Asp?Trp?Glu?Lys?Ser?Met?Ala?Arg?Ser?Phe?Thr?Arg

180 185 190

Met?Asp?Met?Glu?Val?Val?Ala?Leu?Asn?Ala?Asp?Gly?Ala?Ala?Lys?Cys

195 200 205

Arg?Cys?Glu?Leu?Gln?Arg?Pro?Asp?Cys?Asp?Ala?Val?Gly?Ser?Thr?Ala

210 215 220

Val?Val?Ser?Val?Leu?Thr?Pro?Glu?Lys?Ile?Ile?Val?Ala?Asn?Cys?Gly

225 230 235 240

Asp?Ser?Arg?Ala?Val?Leu?Cys?Arg?Asn?Gly?Lys?Ala?Ile?Ala?Leu?Ser

245 250 255

Ser?Asp?His?Lys?Pro?Asp?Arg?Pro?Asp?Glu?Leu?Asp?Arg?Ile?Gln?Ala

260 265 270

Ala?Gly?Gly?Arg?Val?Ile?Tyr?Trp?Asp?Gly?Pro?Arg?Val?Leu?Gly?Val

275 280 285

Leu?Ala?Met?Ser?Arg?Ala?Ile?Gly?Asp?Asn?Tyr?Leu?Lys?Pro?Tyr?Val

290 295 300

Ile?Ser?Arg?Pro?Glu?Val?Thr?Val?Thr?Asp?Arg?Ala?Asn?Gly?Asp?Asp

305 310 315 320

Phe?Leu?Ile?Leu?Ala?Ser?Asp?Gly?Leu?Trp?Asp?Val?Val?Ser?Asn?Glu

325 330 335

Thr?Ala?Cys?Ser?Val?Val?Arg?Met?Cys?Leu?Arg?Gly?Lys?Val?Asn?Gly

340 345 350

Gln?Val?Ser?Ser?Ser?Pro?Glu?Arg?Glu?Met?Thr?Gly?Val?Gly?Ala?Gly

355 360 365

Asn?Val?Val?Val?Gly?Gly?Gly?Asp?Leu?Pro?Asp?Lys?Ala?Cys?Glu?Glu

370 375 380

Ala?Ser?Leu?Leu?Leu?Thr?Arg?Leu?Ala?Leu?Ala?Arg?Gln?Ser?Ser?Asp

385 390 395 400

Asn?Val?Ser?Val?Val?Val?Val?Asp?Leu?Arg?Arg?Asp?Thr

405 410

<210>3

<211>54

<212>DNA

＜213〉synthetic

<400>3

ggggacaagtttgtacaaaaaagcaggcttcatggctgagatttgttacgagaa 54

<210>4

<211>48

<212>DNA

＜213〉synthetic

<400>4

ggggaccactttgtacaagaaagctgggtg?cgtgtctcgtcgtagatc 48

<210>5

<211>18

<212>DNA

＜213〉synthetic

<400>5

cagcgggtggtcgtgtta 18

<210>6

<211>18

<212>DNA

＜213〉synthetic

<400>6

cgcaagcctcgtcagcaa 18

<210>7

<211>22

<212>DNA

＜213〉synthetic

<400>7

cactgtgccaatctacgagggt 22

<210>8

<211>22

<212>DNA

＜213〉synthetic

<400>8

cacaaacgagggctggaacaag 22

<210>9

<211>18

<212>DNA

＜213〉synthetic

<400>9

ttatcctttaattgaccg 18

<210>10

<211>19

<212>DNA

＜213〉synthetic

<400>10

gagtaaaccataaccgtag 19

<210>11

<211>21

<212>DNA

＜213〉synthetic

<400>11

tggttcacgtagtgggccatc 21

<210>12

<211>25

<212>DNA

＜213〉synthetic

<400>12

ctgggtcacatggttctgaatctag 25

<210>13

<211>25

<212>DNA

＜213〉synthetic

<400>13

tctctctacaatagttcgctacctg 25

<210>14

<211>25

<212>DNA

＜213〉synthetic

<400>14

tttgacggaggagatagtgaaggag 25

<210>15

<211>25

<212>DNA

＜213〉synthetic

<400>15

ggattaaatccattagtgactcgac 25

<210>16

<211>18

<212>DNA

＜213〉synthetic

<400>16

ctggcaaagctgaggaga 18

<210>17

<211>20

<212>DNA

＜213〉synthetic

<400>17

cgtagtacatctaaagggag 20

<210>18

<211>25

<212>DNA

＜213〉synthetic

<400>18

tgcaatgcgaccaccgggatatgag 25

<210>19

<211>25

<212>DNA

＜213〉synthetic

<400>19

cgtgaatggcgtgacggatgcaaga 25

<210>20

<211>20

<212>DNA

＜213〉synthetic

<400>20

tttcggactcagtgcattgc 20

<210>21

<211>25

<212>DNA

＜213〉synthetic

<400>21

gctacatagttcggagttccacatg 25

<210>22

<211>25

<212>DNA

＜213〉synthetic

<400>22

tatgcacgatagtgataggtatgaa 25

<210>23

<211>25

<212>DNA

＜213〉synthetic

<400>23

gttgcgaatgtaacactgatgactt 25

Claims (1)

1. the protein phosphatase gene AtPP2CA2 of an Arabidopis thaliana is in the application that improves on the plant stress-resistance ability.It is characterized in that described gene A tPP2CA2 derives from Arabidopis thaliana cDNA library, its numbering in GenBank is At5g59220, the long 1242bp of cDNA, the albumen of 413 aa of coding.

Images