CN105483213B - LAMP detection primer group, LAMP detection kit and the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 - Google Patents
LAMP detection primer group, LAMP detection kit and the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 Download PDFInfo
- Publication number
- CN105483213B CN105483213B CN201510705069.9A CN201510705069A CN105483213B CN 105483213 B CN105483213 B CN 105483213B CN 201510705069 A CN201510705069 A CN 201510705069A CN 105483213 B CN105483213 B CN 105483213B
- Authority
- CN
- China
- Prior art keywords
- dna
- bps
- primer
- resistant herbicide
- soybean
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Abstract
The invention discloses LAMP detection primer group, LAMP detection kit and the detection methods of Transgenic Resistant Herbicide soybean BPS-CV127-9.LAMP detection primer group includes four specific primers；LAMP detection kit includes primer liquid, reaction solution, archaeal dna polymerase and control；LAMP detection kit can also have color developing agent or fluorescence indicator；Its detection method be by extract measuring samples DNA, using four specific primers and a kind of archaeal dna polymerase with strand-displacement activity, sample DNA templates are expanded at 60~65 DEG C, short time amplification efficiency can reach 109~1010A copy, identification are changed using the interior turbidity precipitated of reaction tube, color change in color developing agent observing response pipe is added, observes whether determining measuring samples contain Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties using real-time fluorescence detector.The present invention have many advantages, such as rapidly and efficiently, easy to operate, high specific, high sensitivity, identification is easy, is suitble to on-site test, be suitable for popularization and application.
Description
Technical field
The present invention relates to technical field of molecular biology, belong to the detection method of transgenic crop, specifically relate to
And LAMP detection primer group, LAMP detection kit and the inspection of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derivative
Survey method.
Background technique
Soybean is important oil crops, and soybean yields occupies first of all edible oil material crop in the world.Soybean is simultaneously
It is a kind of plant resources of high-quality high protein, contains 8 kinds of amino acid needed by human.The source area of soybean is China, main product
Mainly there are the U.S., Brazil, Argentina and China.Domestic soybean is not able to satisfy the market demand, and the quantity of imported soybean increases therewith.
BPS-CV127-9 soybean be by BASF plant science company research and develop, anti-imidazolone type agricultural herbicide it is big
Bean crop, the gene csr1-2 containing herbicide-resistant arabidopsis acetohydroxy acid synthetase large subunit AHASL and its natural promoter.
The soybean of the antiweed can allow grower can inhibit under normal imidazolidinone weedicide dosage weed growth without
Influence soybean growth.Roundup Ready soybean BPS-CV127-9 is mainly planted in Brazil, and China is the main body entrance state of Brazil Soybeans
One of family.
The approval Roundup Ready soybean BPS-CV127-9 of the Ministry of Agriculture in 2013 can import be used as and process raw material, removed to fight
The circulation of careless agent soybean BPS-CV127-9 carries out standardized administration, establishes effective Transgenic Resistant Herbicide soybean BPS-CV127-9
Detection method and system, to genetically modified crops and products thereof mark system implementation and safety evaluatio have it is highly important
Meaning.
Currently, the detection method of genetically modified crops mainly has following 2 class:
1) based on the detection of protein, that now most widely used is enzyme linked immunosorbent assay (ELISA) and Western
The detection method of blot, such methods require the antibody of high quality, high specific, otherwise will affect the accuracy of detection, detect
Sensitivity it is lower；
2) it based on the detection of DNA, is detected, is mainly had point primarily directed to the external source insertion gene in genetically modified crops
Sub- hybridization technique, PCR detection technique and chip detection technique, wherein PCR detection method is main, most accurate detection turn
The method of gene crops, but the reaction system of such methods and operating process are more complicated, need professional；It needs specific
PCR instrument, proliferation time 2~3 hours, amplification needed to carry out final product detection such as electrophoresis；Electrophoresis common dyes such as EB etc.
There is more virulent property, and is difficult to carry out on-site test.Quantitative PCR detection high sensitivity, the used main Taqman of fluorescent species
Probe, SYBR Green Ι and molecular beacon, as reaction carries out, the fluorescence signal value generated in system is increased with it.Other
Two methods are relatively high compared with I dye method sensitivity of SYBR Green, but quantitative fluorescent PCR instrument cost is larger.
In conclusion be required in production practice it is a kind of quickly, high sensitivity, easy to operate, high specificity, be easy it is general
And genetically modified crops detection method that is safe and reliable and being suitable for execute-in-place.
Ring mediated isothermal gene amplification technology (Loop-Mediated Isothermal Amplification, it is simple below
Claim LAMP method) it is the gene amplification technology that the front and back Notomi and Okayama2000 is developed, with fast and convenient, operation
Accurately, it is easy universal, safe and reliable advantage, there has been no by constant-temperature amplification visual detection technology, constant temperature real-time fluorescence skill at present
Art is applied to quickly detection Transgenic Resistant Herbicide soybean BPS-CV127-9 and its kit of derived varieties.
Summary of the invention
The purpose of the present invention is to provide the LAMP detection primer group of Transgenic Resistant Herbicide soybean BPS-CV127-9,
LAMP detection kit and detection method, to solve the problems mentioned in the above background technology.
To achieve the above object, the invention provides the following technical scheme:
The LAMP detection primer group of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties, including outer primer 1
With outer primer 2, inner primer 1 and inner primer 2, nucleotide sequence is distinguished as follows:
Outer primer 1:TGTTTGGAAGCTTGAAACG(SEQ ID No:1)；
Outer primer 2:GATCGGGTTTGTGACAGC(SEQ ID No:2)；
Inner primer 1:CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA(SEQ ID No:3)；
Inner primer 2:AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA(SEQ ID No:4).
The LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties, including below at
Point:
(1) primer liquid: the LAMP inspection containing above-mentioned Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties
Primer sets are surveyed, the concentration of each primer is respectively 48~52 μM of outer primers, 1,48~52 μM of outer primer 2,48~52 in the primer liquid
μM 1,48~52 μM of inner primer 2 of inner primer；
(2) reaction solution: contain 12mM dNTPs, 10 × Isothermal Amplification reaction buffer, 150mM
MgSO4Aqueous solution, the dNTPs, reaction buffer and MgSO4The volume ratio of aqueous solution is 7~9:4~6:2；
(3) archaeal dna polymerase: the concentration of archaeal dna polymerase is 7~9U/ μ l；
(4) compare: positive control is the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties or contains
The e. coli plasmid dna of target gene, negative control are the reaction mixture without target gene.
As a further solution of the present invention: containing in 50 μM of 1,50 μM of outer primer, 2,50 μM of outer primers in the primer liquid
1,50 μM of inner primer 2 of primer.
As a further solution of the present invention: the archaeal dna polymerase be Bst archaeal dna polymerase, Bst archaeal dna polymerase it is dense
Degree is 8U/ μ l.
As a further solution of the present invention: in the reaction solution, 12mM dNTP:10 × Isothermal
Amplification reaction buffer: 150mM MgSO4The volume ratio of aqueous solution is 8:5:2.
As a further solution of the present invention: also containing color developing agent, the color developing agent is fluorescent dye Calcein.
As a further solution of the present invention: also containing fluorescence indicator, the fluorescence indicator is SYTO-9.
Turn base using the detection of the LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties
Because of Roundup Ready soybean BPS-CV127-9 and its detection method of derived varieties, include the following steps:
1) extraction of measuring samples DNA: Transgenic Resistant Herbicide soybean BPS-CV127-9 is extracted using CTAB method and its is spread out
Health product kind purification of samples DNA；
2) Constant Temperature Detection is reacted: reaction system is prepared in PCR pipe: 1.8 μ l of primer liquid, 15.2 μ l, DNA polymerization of reaction solution
Enzyme 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing to 25 μ l；Setting is positive right
When according to reaction, with the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties or the large intestine bar containing target gene
Bacteria plasmid DNA substitutes DNA to be checked, to be checked with the reaction mixture substitution without target gene when setting negative control reacts
DNA；It is centrifuged after prepared PCR pipe is mixed, and in 60~65 DEG C of 45~90min of reaction, and continues under the conditions of 80 DEG C
2min；
3) result judges: judging amplification by the turbidity variation precipitated in observation PCR pipe.
Turn base using the detection of the LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties
Because of Roundup Ready soybean BPS-CV127-9 and its detection method of derived varieties, include the following steps:
1) extraction of measuring samples DNA: Transgenic Resistant Herbicide soybean BPS-CV127-9 is extracted using CTAB method and its is spread out
Health product kind purification of samples DNA；
2) Constant Temperature Detection is reacted: reaction system is prepared in 200 μ l PCR pipes: 1.8 μ l of primer liquid, 15.2 μ l of reaction solution,
Archaeal dna polymerase 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing to 25 μ l；Setting
When positive control reacts, with the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties or containing target gene
E. coli plasmid dna substitutes DNA to be checked and is substituted when setting negative control reacts with the reaction mixture without target gene
DNA to be checked；It is centrifuged after prepared PCR pipe is mixed, and in 60~65 DEG C of 45~90min of reaction, and is held under the conditions of 80 DEG C
Continuous 2min；
3) result judges: 1~2 μ l color developing agent being added in above-mentioned PCR pipe, mixes, judges to expand according to colour developing result
As a result.
Turn base using the detection of the LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties
Because of Roundup Ready soybean BPS-CV127-9 and its detection method of derived varieties, include the following steps:
1) extraction of measuring samples DNA: Transgenic Resistant Herbicide soybean BPS-CV127-9 is extracted using CTAB method and its is spread out
Health product kind purification of samples DNA；
2) Constant Temperature Detection is reacted: preparing reaction system in 200 μ l PCR pipes: primer liquid 1.8 μ l, 15.2 μ of reaction solution
L, archaeal dna polymerase 1 μ l, fluorescence indicator SYTO-9 1 μ l, 1~6 μ l of DNA to be checked use DNase/RNase-Free
Distilled Water polishing is to 25 μ l；When positive control reaction is arranged, with Transgenic Resistant Herbicide soybean BPS-CV127-9
And its derived varieties DNA or e. coli plasmid dna containing target gene substitute DNA to be checked, when setting negative control reacts,
DNA to be checked is substituted with the reaction mixture without target gene；It is centrifuged after prepared PCR pipe is mixed, and in real-time fluorescence
Detector continues 2min in 60~65 DEG C of 45~90min of reaction under the conditions of 80 DEG C；
3) result judges: according to whether S type amplification curve occur judges amplification.
Wherein, the method that CTAB method extracts the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties
Are as follows:
(1) genetically engineered soybean MON89788 about 100mg is taken, is put into mortar, a small amount of liquid nitrogen is added and grinds rapidly, liquid nitrogen
It grinds 3 times repeatedly；
(2) CTAB Extraction buffer (100mM Tris-HCI (pH 8.0), 1.4M that 1.5ml is preheated to 65 DEG C is added
NaCI, 20mM EDTA pH 8.0), 20 μ l of mercaptoethanol is added, shakes, is sufficiently mixed, 65 DEG C of heat preservation 30min, often up and down
It is mixed by inversion once every 10min；
(3) about 12000rpm is centrifuged 10min, shifts supernatant to new centrifuge tube, isometric phenol: chloroform is added: different
Amylalcohol (25:24:1) extracting, is sufficiently mixed, and 4 DEG C of 12000rpm are centrifuged 5min, takes supernatant into new centrifuge tube；
(4) isometric chloroform is added: isoamyl alcohol (24:1) is sufficiently mixed, and 4 DEG C of 12000rpm are centrifuged 5min, is taken
Clearly into new centrifuge tube；
(5) dehydrated alcohol of 2 times of volumes is added, adds 1/10 volume NaAC(pH5.2) gently overturn, it is sufficiently mixed
Even, -20 DEG C of refrigerators stand 10min；
(6) 12000rpm is centrifuged 5min, abandons supernatant, and 500 μ l, 70% ethanol solution is added, and gently overturns centrifuge tube for several times,
12000rpm is centrifuged 2min, abandons supernatant；
(7) (6) are repeated once,
(8) sufficiently dry DNA precipitates, and adds 100 μ l DNase/RNase-Free Distilled Water dissolving DNAs.-
20 DEG C of preservations.
DNTP is the abbreviation of deoxyribonucleoside triphosphate, and N refers to nitrogenous base, represents variable and refers to A, T, G, C etc.,
Being includes dATP, dGTP, dTTP, and the general designation including dCTP etc. plays raw material in biological DNA synthesis and in various PCR
Effect.
10 × Isothermal Amplification reaction buffer is the reaction buffer of 10 times of isothermal duplications.
Fluorescent dye Calcein is fluorescent dye calcein.
Fluorescent dye SYTO 9 is saturated fluorescence dyestuff, and maximum excitation light is 483nm, and emission maximum light is 503nm
DNase/RNase-Free Distilled Water is DNA enzymatic/enzyme distilled water.
Compared with prior art, the beneficial effects of the present invention are:
The present invention is based on loop-mediated isothermal amplification technique LAMP methods, can specificity knowledge according to four primers of target gene design
Six isolated areas on other target-gene sequence, starting circulation strand replacement reaction, in the starting complementary strand synthesis of target region of DNA, knot
Fruit is formed with the stem-loop DNA mixture of the cauliflower structure of many rings in cycles on same chain.Drawn using 4 specificity
Object and a kind of archaeal dna polymerase with strand-displacement activity, carry out amplification reaction nucleic acid at 60~65 DEG C, and reaction need to be in constant temperature item
It is carried out under part, the reaction time is according to template DNA mass change, generally 90min or less, within the short time of 45~90min
Amplification efficiency can achieve 109~1010A copy.Template DNA is added, after 60~65 DEG C of 45~90min of reaction, is protected at 80 DEG C
Warm 2min terminates reaction.In the reaction, when thering is nucleic acid largely to synthesize, the pyrophosphate ion and reaction solution that are precipitated from dNTP
Middle Mg ions binding generates the white precipitate of by-product magnesium pyrophosphate.
The present invention have rapidly and efficiently, easy to operate, high specific, high sensitivity, identification is easy, is suitble to on-site test etc.
Advantage.It is described in detail below:
(1) rapidly and efficiently: entire amplification only can be completed with 45~90min, expand yield up to 109~1010A copy；
(2) easy to operate: not need complicated instrument, do not need special reagent, do not need the change for carrying out double-stranded DNA in advance
The tedious steps such as property, it is only necessary to which a real-time fluorescence detector can be reacted and be detected, and condition is milder；
(3) high specific: the present invention is set at the Specific native genes according to Transgenic Resistant Herbicide soybean BPS-CV127-9
Four specific primers have been counted, using above-mentioned four primers, have expanded 6 regions of target sequence, there is very strong strain specificity,
And it is highly stable, formation primer dimer probability is low, ensure that going on smoothly for reaction；
(4) highly sensitive: the lowest detection limit can reach 100 copies；
(5) identification is easy: can be added by observation Calcein color change, with the presence or absence of magnesium pyrophosphate precipitating or whether
There is " S " type amplification curve without other any analytical procedures such as electrophoresis, to be suitble to on-site test whether judging amplification.
Detailed description of the invention
Fig. 1 is the color developing detection result figure (1: positive control of embodiment 1；2-5: measuring samples；6: negative control)；
Fig. 2 is the augmentation detection result figure (1: positive control of embodiment 1；2-5: measuring samples；6: negative control)；
Fig. 3 is the augmentation detection result figure (1: positive control of embodiment 2；2-5: measuring samples；6: negative control)；
Fig. 4 is the augmentation detection result figure (1: positive control of embodiment 3；2-7 is successively are as follows: 3%, 0.3%, 0.8%, 0.03%,
0.08%, 0.003% sample DNA；8: negative control)；
Fig. 5 be the augmentation detection result figure of embodiment 4 (1-19 successively are as follows: Transgenic Resistant Herbicide soybean BPS-CV127-
9、Roundup Ready GTS 40-3-2、A2704-12、A5547-127、DP305423、DP56423、MON89788、
MON87701, transgenic corns MON810, transgenic paddy rice BT63, transgenic potato EH92-527-1, transgene cotton
MON531, transgene rape T45, Non-transgenic soybean, rice, wheat, corn, cotton, deionized water.
Specific embodiment
Below in conjunction with the embodiment of the present invention, technical scheme in the embodiment of the invention is clearly and completely described,
Obviously, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based in the present invention
Embodiment, every other embodiment obtained by those of ordinary skill in the art without making creative efforts, all
Belong to the scope of protection of the invention.
Kit and detection method of the embodiment 1 containing color developing agent
A kind of LAMP detection kit, including primer liquid, reaction solution, archaeal dna polymerase, control and color developing agent:
(1) primer liquid: contain 50 μM of 1,50 μM of outer primer, 2,50 μM of outer primer, 1,50 μM of inner primers 2 of inner primer, four are drawn
Object are as follows:
Outer primer 1:TGTTTGGAAGCTTGAAACG(SEQ ID No:1)；
Outer primer 2:GATCGGGTTTGTGACAGC(SEQ ID No:2)；
Inner primer 1:CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA(SEQ ID No:3)；
Inner primer 2:AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA(SEQ ID No:4).
(2) reaction solution: contain 12mM dNTP, 10 × Isothermal Amplification reaction buffer, 150mM
MgSO4Aqueous solution, the volume ratio of three are 8:5:2；
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l；
(4) compare: the e. coli plasmid dna containing target gene, negative control are the reaction mixing without target gene
Liquid；
(5) color developing agent: fluorescent dye Calcein.
Sample to be tested is detected by the following method with mentioned reagent box:
1) extraction of measuring samples DNA: CTAB method extraction purification sample to be tested DNA is used；
2) Constant Temperature Detection is reacted: reaction system: 1.8 μ l of primer liquid, 15.2 μ l of reaction solution is prepared in 200 μ l PCR pipes,
Archaeal dna polymerase 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing to 25 μ l；Setting
When positive control reacts, DNA to be checked is substituted when setting negative control reacts with the e. coli plasmid dna containing target gene and is used
Reaction mixture without target gene substitutes DNA to be checked；It is centrifuged after prepared PCR pipe is mixed, and anti-in 60~65 DEG C
45~90min is answered, and in 80 DEG C of lasting 2min；
3) result judges: 2 μ l color developing agents are added in above-mentioned reaction tube, mix, are the positive if shows green, it is orange
For feminine gender.
In the present embodiment, negative control shows orange, positive control shows green, the aobvious green of the PCR pipe of sample to be tested 1,2
(Guan Yang in Fig. 1) shows to contain Transgenic Resistant Herbicide soybean BPS-CV127-9 in sample to be tested 1,2, sample to be tested 3,4
PCR pipe shows orange (pipe yin in Fig. 1), shows in sample to be tested 3,4 without Transgenic Resistant Herbicide soybean BPS-CV127-9.
A kind of LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9, including primer liquid, reaction solution,
Archaeal dna polymerase, control and fluorescence indicator:
(1) primer liquid: contain 50 μM of 1,50 μM of outer primer, 2,50 μM of outer primer, 1,50 μM of inner primers 2 of inner primer, four are drawn
Object are as follows:
Outer primer 1:TGTTTGGAAGCTTGAAACG(SEQ ID No:1)；
Outer primer 2:GATCGGGTTTGTGACAGC(SEQ ID No:2)；
Inner primer 1:CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA(SEQ ID No:3)；
Inner primer 2:AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA(SEQ ID No:4).
(2) reaction solution: contain 12mM dNTP, 10 × Isothermal Amplification reaction buffer, 150mM
MgSO4Aqueous solution, the volume ratio of three are 8:5:2；
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l；
(4) compare: the e. coli plasmid dna containing target gene, negative control are the reaction mixing without target gene
Liquid；
(5) fluorescence indicator: SYTO-9.
Sample to be tested is detected by the following method with mentioned reagent box:
1) extraction of measuring samples DNA: CTAB method extraction purification sample to be tested DNA is used；
2) Constant Temperature Detection is reacted: reaction system: 1.8 μ l of primer liquid, 15.2 μ l of reaction solution is prepared in 200 μ l PCR pipes,
Archaeal dna polymerase 1 μ l, SYTO-9 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing
To 25 μ l；When positive control reaction is arranged, with the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 or containing target gene
E. coli plasmid dna substitutes DNA to be checked and is substituted when setting negative control reacts with the reaction mixture without target gene
DNA to be checked；Will prepared PCR pipe mix after be centrifuged, and on 9640 qPCR instrument of LineGene 60~65 DEG C reaction 45~
90min, and in 80 DEG C of lasting 2min；
3) result judges: according to whether " S " type amplification curve occur judges amplification, if showing " S " type amplification curve
It is then the positive, is negative if not showing " S " type amplification curve.
In the present embodiment, negative control shows " straight line " amplification curve, and positive control shows " S " type amplification curve, to be measured
Sample 1,2 shows " S " type amplification curve (sample 2,3 in Fig. 2), shows to contain Transgenic Resistant Herbicide in sample to be tested 1,2
Soybean BPS-CV127-9, sample to be tested 3,4 show " straight line " amplification curve (sample 4,5 in Fig. 2), show in sample to be tested 3,4
Without Transgenic Resistant Herbicide soybean BPS-CV127-9.
Referring to the primer BPS-CV127-9 in EU Reference Laboratory for GM Food and Feed
F:AACAGAAGTTTCCGTTGAGCTTTAAGAC(SEQ ID No:5), BPS-CV127-9 R:
CATTCGTAGCTCGGATCGTGTAC(SEQ ID No:6) and probe BPS-CV127-9 Probe:6-FAM-
TTTGGGGAAGCTGTCCCATGCCC-TAMRA(SEQ ID No:7) carry out quantitative fluorescent PCR inspection, inspection result with it is above-mentioned
LAMP methods and results are consistent.
Embodiment 2 is free of the kit and its detection method of color developing agent
In kit in addition to lacking the color developing agent and fluorescence indicator in embodiment 1, remaining is the same as embodiment 1.
Sample to be tested is detected by the following method with mentioned reagent box:
1) extraction of measuring samples DNA: CTAB method extraction purification sample to be tested DNA is used；
2) Constant Temperature Detection is reacted: reaction system: 1.8 μ l of primer liquid, 15.2 μ l of reaction solution is prepared in 200ul PCR pipe,
Archaeal dna polymerase 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing to 25 μ l；Setting
When positive control reacts, with the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 or containing the escherichia coli plasmid of target gene
DNA substitutes DNA to be checked, when setting negative control reacts, substitutes DNA to be checked with the reaction mixture without target gene；It will match
The PCR pipe made is centrifuged after mixing, and in 60~65 DEG C of 45~90min of reaction, and in 80 DEG C of lasting 2min；
3) result judges: reaction tube being placed in transmissometer by step reaction in 2), is precipitated in observing response pipe turbid
Degree variation or quantitative fluorescent PCR check whether that " S " type amplification curve occur judges amplification: if there is precipitating then for sun
Property, no precipitating is then feminine gender；It is positive that quantitative fluorescent PCR, which is examined if showing " S " type amplification curve, if not showing the expansion of " S " type
It is then negative for increasing curve.
In the present embodiment, negative control generates precipitating without precipitating, positive control, and the PCR pipe of sample to be tested 1,2 is sunk
It forms sediment, show " S " type amplification curve (Fig. 3 line 2,3), show to contain Transgenic Resistant Herbicide soybean BPS- in measuring samples 1,2
CV127-9.The PCR pipe of sample to be tested 3,4 do not occur precipitating, do not show " S " type amplification curve (Fig. 3 line 4,5), show to
Transgenic Resistant Herbicide soybean BPS-CV127-9 is free of in sample product 3,4.
Referring to the primer BPS-CV127-9 in EU Reference Laboratory for GM Food and Feed
F:AACAGAAGTTTCCGTTGAGCTTTAAGAC(SEQ ID No:5), BPS-CV127-9 R:
CATTCGTAGCTCGGATCGTGTAC(SEQ ID No:6) and probe BPS-CV127-9 Probe:6-FAM-
TTTGGGGAAGCTGTCCCATGCCC-TAMRA(SEQ ID No:7) carry out quantitative fluorescent PCR inspection, inspection result with it is above-mentioned
LAMP methods and results are consistent.
3 PCR of embodiment reacts compared with detection method sensitivity
The LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 is prepared according to the following formula:
(1) primer liquid: contain 50 μM of 1,50 μM of outer primer, 2,50 μM of outer primer, 1,50 μM of inner primers 2 of inner primer, four are drawn
Object are as follows:
Outer primer 1:TGTTTGGAAGCTTGAAACG(SEQ ID No:1)；
Outer primer 2:GATCGGGTTTGTGACAGC(SEQ ID No:2)；
Inner primer 1:CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA(SEQ ID No:3)；
Inner primer 2:AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA(SEQ ID No:4).
(2) reaction solution: contain 12mM dNTP, 10 × Isothermal Amplification reaction buffer, 150mM
MgSO4Aqueous solution, the volume ratio of three are 8:5:2；
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l；
(4) compare: positive control is the e. coli plasmid dna containing target gene, and negative control is without target gene
Reaction mixture；
(5) color developing agent: fluorescent dye Calcein.
It is detected by the following method to being determined as sample to be tested with mentioned reagent box:
1) extraction of measuring samples DNA: using CTAB method extraction purification sample to be tested DNA, be diluted to 3% respectively, 0.3%,
0.8%, 0.03%, 0.08%, 0.003% sample DNA；
2) Constant Temperature Detection is reacted: reaction system: 1.8 μ l of primer liquid, 15.2 μ l of reaction solution is prepared in 200 μ l PCR pipes,
Archaeal dna polymerase 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing to 25 μ l；Setting
When positive control reacts, DNA to be checked is substituted when setting negative control reacts with the e. coli plasmid dna containing target gene and is used
Reaction mixture without target gene substitutes DNA to be checked；；It is centrifuged after prepared PCR pipe is mixed, and in LineGene
63 DEG C of reaction 90min(1 min are set as 1 circulation on 9640 qPCR instrument), and in 80 DEG C of lasting 2min；
3) result judges: reaction tube being placed in transmissometer by step reaction in 2), is precipitated in observing response pipe turbid
Degree variation then has amplification to judge amplification, if there is precipitating, and no precipitating is then without amplification.Product can also be obtained in 2)
1 μ l color developing agent of middle addition is mixed, is visually observed.The pipe presentation of no amplified reaction is orange, has the pipe of amplified reaction to become green
Color.
The LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 is prepared according to the following formula:
(1) primer liquid: contain 50 μM of 1,50 μM of outer primer, 2,50 μM of outer primer, 1,50 μM of inner primers 2 of inner primer, four are drawn
Object are as follows:
Outer primer 1:TGTTTGGAAGCTTGAAACG(SEQ ID No:1)；
Outer primer 2:GATCGGGTTTGTGACAGC(SEQ ID No:2)；
Inner primer 1:CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA(SEQ ID No:3)；
Inner primer 2:AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA(SEQ ID No:4).
(2) reaction solution: contain 12mM dNTP, 10 × Isothermal Amplification reaction buffer, 150mM
MgSO4Aqueous solution, the volume ratio of three are 8:5:2；
(3) archaeal dna polymerase: Bst archaeal dna polymerase, concentration are 8U/ μ l；
(4) compare: positive control is the e. coli plasmid dna containing target gene, and negative control is without target gene
Reaction mixture；
(5) fluorescence indicator: SYTO-9.
With mentioned reagent box by the following method to the sample to be tested for being determined as Transgenic Resistant Herbicide soybean BPS-CV127-9
It is detected:
1) extraction of measuring samples DNA: using CTAB method extraction purification sample to be tested DNA, be diluted to 3% respectively, 0.3%,
0.8%, 0.03%, 0.08%, 0.003% sample DNA；
2) Constant Temperature Detection is reacted: reaction system: 1.8 μ l of primer liquid, 15.2 μ l of reaction solution is prepared in 200 μ l PCR pipes,
Archaeal dna polymerase 1 μ l, SYTO-9 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing
To 25 μ l；When positive control reaction is set, DNA to be checked is substituted with the e. coli plasmid dna containing target gene that concentration is 3%,
When negative control reaction is set, DNA to be checked is substituted with the reaction mixture without target gene；Prepared PCR pipe is mixed
After be centrifuged, and be set as 1 circulation in 60~65 DEG C of reaction 90min(1 min on 9640 qPCR instrument of LineGene), and 80
DEG C continue 2min；
3) result judges: according to whether " S " type amplification curve occur judges amplification, if showing " S " type amplification curve
It is then the positive, is negative if not showing " S " type amplification curve.
Referring to Fig. 4, positive control, 3%, 0.3%, 0.8%, 0.03%, 0.08%, 0.003% sink in the present embodiment
Shallow lake, " S " type amplification curve are shown with amplification, and negative control is without precipitating, nothing " S " type amplification curve, i.e., without amplification；Colour developing is added
After agent, positive control, 3%, 0.3%, 0.8%, 0.03%, 0.08%, 0.003% the aobvious green of PCR pipe, orange is presented in negative control pipe
Color.
PCR reacts primer using the outer primer 1 and outer primer 2 in this method reaction.PCR reaction be 25 μ l systems, 10 ×
PCR Buffer(PCR reaction buffer, Life technologies) 2.5 μ l, 10mM dNTPs (Life
Technologies) 0.5 μ l, upstream and downstream primer respectively correspond outer primer 1 and outer primer 2, each 0.2 μ l, Taq enzyme (5U/ μ l,
Life technologies) 0.5 μ l, 1 μ l of DNA profiling mends with DNase/RNase-Free Distilled Water to 25 μ
l.Response procedures are 95 DEG C of initial denaturations 3min, 95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extensions 30s, 72 DEG C of extension 5min.
PCR product takes 3 μ l and 2% agarose gel electrophoresis, 30min under 120V voltage, by gel image analyser observation as a result, M,
DL600 DNA Marker(DNA molecular weight standard, maximum DNA segment are 600 base-pairs)；1, positive control；2-7,3%,
0.3%,0.8%,0.03%,0.08%,0.003%；8, negative control.Wherein the sensitivity of PCR method is 0.03%, and 6,7 displays
For negative findings.
By two methods compare it can be seen from the result of sensitivity of kit of the invention can achieve 0.003%, PCR
The sensitivity of method is 0.03%, and 0.08% or shown below as negative findings；Through comparing, kit of the invention and method spirit
Sensitivity is apparently higher than the susceptibility of PCR method, can detect the sample of lower loading, shows better sensitivity.
4 specificity experiments of embodiment
With the identification method of embodiment 1 respectively to the Transgenic Resistant Herbicide soybean BPS-CV127-9 isolated and purified,
Roundup Ready GTS 40-3-2、A2704-12、A5547-127、DP305423、DP56423、MON89788、
MON87701, transgenic corns MON810, transgenic paddy rice BT63, transgenic potato EH92-527-1, transgene cotton
MON531, transgene rape T45, Non-transgenic soybean, rice, wheat, corn, cotton are identified, referring to EU
Primer BPS-CV127-9 F in Reference Laboratory for GM Food and Feed:
AACAGAAGTTTCCGTTGAGCTTTAAGAC(SEQ ID No:5), BPS-CV127-9 R:
CATTCGTAGCTCGGATCGTGTAC(SEQ ID No:6) and probe BPS-CV127-9 Probe:6-FAM-
TTTGGGGAAGCTGTCCCATGCCC-TAMRA(SEQ ID No:7) carry out quantitative fluorescent PCR inspection.
Referring to Fig. 5, qualification result is shown: genetically engineered soybean Roundup Ready GTS 40-3-2, A2704-12,
A5547-127, DP305423, DP56423, MON89788, MON87701, transgenic corns MON810, transgenic paddy rice BT63,
Transgenic potato EH92-527-1, transgene cotton MON531, transgene rape T45, Non-transgenic soybean, rice, wheat, jade
Rice, cotton) reaction tube be it is orange, without " S " type amplification curve (being detailed in the curve 2- curve 19 in Fig. 5), i.e., without amplification；Turn
The reaction tube of transgenic soybean BPS-CV127-9 is green, shows " S " type amplification curve (being detailed in the curve 1 in Fig. 5), that is, is had
Amplification.This result is reacted with the quantitative fluorescent PCR in EU Reference Laboratory for GM Food andFeed
As a result consistent, show good specificity.
It is obvious to a person skilled in the art that invention is not limited to the details of the above exemplary embodiments, Er Qie
In the case where without departing substantially from spirit or essential attributes of the invention, the present invention can be realized in other specific forms.Therefore, no matter
From the point of view of which point, the present embodiments are to be considered as illustrative and not restrictive, and the scope of the present invention is by appended power
Benefit requires rather than above description limits, it is intended that all by what is fallen within the meaning and scope of the equivalent elements of the claims
Variation is included within the present invention.
In addition, it should be understood that although this specification is described in terms of embodiments, but not each embodiment is only wrapped
Containing an independent technical solution, this description of the specification is merely for the sake of clarity, and those skilled in the art should
It considers the specification as a whole, the technical solutions in the various embodiments may also be suitably combined, forms those skilled in the art
The other embodiments being understood that.
SEQUENCE LISTING
<110>applicant
<120>the LAMP detection primer group, LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 and
Inspection
Survey method
<130> 2015
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213>artificial sequence
<400> 1
tgtttggaag cttgaaacg 19
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<400> 2
gatcgggttt gtgacagc 18
<210> 3
<211> 44
<212> DNA
<213>artificial sequence
<400> 3
cggaattggt aatcgaaatt agggtgggca aactagtctc gtaa 44
<210> 4
<211> 44
<212> DNA
<213>artificial sequence
<400> 4
aagaagtcat ggaagccatt gattcgagac gaacactgct ctta 44
<210> 5
<211> 28
<212> DNA
<213>artificial sequence
<400> 5
aacagaagtt tccgttgagc tttaagac 28
<210> 6
<211> 23
<212> DNA
<213>artificial sequence
<400> 6
cattcgtagc tcggatcgtg tac 23
<210> 7
<211> 23
<212> DNA
<213>artificial sequence
<400> 7
tttggggaag ctgtcccatg ccc 23
Claims (10)
1. the LAMP detection primer group of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties, it is characterised in that: packet
Outer primer 1 and outer primer 2, inner primer 1 and inner primer 2 are included, nucleotide sequence difference is as follows:
Outer primer 1:TGTTTGGAAGCTTGAAACG(SEQ ID No:1)；
Outer primer 2:GATCGGGTTTGTGACAGC(SEQ ID No:2)；
Inner primer 1:CGGAATTGGTAATCGAAATTAGGGTGGGCAAACTAGTCTCGTAA(SEQ ID No:3)；
Inner primer 2:AAGAAGTCATGGAAGCCATTGATTCGAGACGAACACTGCTCTTA(SEQ ID No:4).
2. the LAMP detection kit of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties, which is characterized in that packet
Include following component:
(1) primer liquid: containing Transgenic Resistant Herbicide soybean BPS-CV127-9 described in claim 1 and its derived varieties
LAMP detection primer group, the concentration of each primer is respectively 48~52 μM of outer primers, 1,48~52 μM of outer primer 2 in the primer liquid,
48~52 μM of inner primers, 1,48~52 μM of inner primer 2；
(2) reaction solution: contain 12mM dNTPs, 10 × Isothermal Amplification reaction buffer, 150mM
MgSO4Aqueous solution, the dNTPs, reaction buffer and MgSO4The volume ratio of aqueous solution is 7~9:4~6:2；
(3) archaeal dna polymerase: the concentration of archaeal dna polymerase is 7~9U/ μ l；
(4) compare: positive control is the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties or contains purpose
The e. coli plasmid dna of gene, negative control are the reaction mixture without target gene.
3. the Transgenic Resistant Herbicide soybean BPS-CV127-9 according to claim 2 and its LAMP of derived varieties detection
Kit, it is characterised in that: containing in 50 μM of 1,50 μM of outer primer, 1,50 μM of inner primer of 2,50 μM of outer primers in the primer liquid
Primer 2.
4. the Transgenic Resistant Herbicide soybean BPS-CV127-9 according to claim 2 and its LAMP of derived varieties detection
Kit, it is characterised in that: the archaeal dna polymerase is Bst archaeal dna polymerase, and the concentration of Bst archaeal dna polymerase is 8U/ μ l.
5. the Transgenic Resistant Herbicide soybean BPS-CV127-9 according to claim 2 and its LAMP of derived varieties detection
Kit, it is characterised in that: in the reaction solution, 12mM dNTP:10 × Isothermal Amplification reaction buffering
Liquid: 150mM MgSO4The volume ratio of aqueous solution is 8:5:2.
6. according to Transgenic Resistant Herbicide soybean BPS-CV127-9 described in any one of claim 2~5 claim and its
The LAMP detection kit of derived varieties, it is characterised in that: also contain color developing agent, the color developing agent is fluorescent dye Calcein.
7. according to Transgenic Resistant Herbicide soybean BPS-CV127-9 described in any one of claim 2~5 claim and its
The LAMP detection kit of derived varieties, it is characterised in that: also contain fluorescence indicator, the fluorescence indicator is SYTO-9.
8. using as described in any one of claim 2~5 claim Transgenic Resistant Herbicide soybean BPS-CV127-9 and
The LAMP detection kit detection Transgenic Resistant Herbicide soybean BPS-CV127-9 of its derived varieties and its detection of derived varieties
Method, characterized by the following steps:
1) Transgenic Resistant Herbicide soybean BPS-CV127-9 and its spin-off the extraction of measuring samples DNA: are extracted using CTAB method
Kind purification of samples DNA；
2) Constant Temperature Detection is reacted: reaction system is prepared in PCR pipe: 1.8 μ l of primer liquid, reaction solution 15.2 μ l, 1 μ of archaeal dna polymerase
L, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing to 25 μ l；It is anti-that positive control is set
At once, with the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties or the Escherichia coli matter containing target gene
Grain DNA substitutes DNA to be checked, when setting negative control reacts, substitutes DNA to be checked with the reaction mixture without target gene；It will
Prepared PCR pipe is centrifuged after mixing, and in 60~65 DEG C of 45~90min of reaction, and continues 2min under the conditions of 80 DEG C；
3) result judges: judging amplification by the turbidity variation precipitated in observation PCR pipe.
9. being examined using Transgenic Resistant Herbicide soybean BPS-CV127-9 as claimed in claim 6 and its LAMP of derived varieties
Test agent box detects the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties, it is characterised in that: packet
Include following steps:
1) Transgenic Resistant Herbicide soybean BPS-CV127-9 and its spin-off the extraction of measuring samples DNA: are extracted using CTAB method
Kind purification of samples DNA；
2) Constant Temperature Detection is reacted: preparing reaction system in 200 μ l PCR pipes: 1.8 μ l of primer liquid, reaction solution 15.2 μ l, DNA
Polymerase 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled Water polishing to 25 μ l；Setting sun
Property control reaction when, with the DNA of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties or containing the big of target gene
Enterobacteria Plasmid DNA substitutes DNA to be checked, when setting negative control reacts, with the reaction mixture substitution without target gene to
Examine DNA；It is centrifuged after prepared PCR pipe is mixed, and in 60~65 DEG C of 45~90min of reaction, and continues under the conditions of 80 DEG C
2min；
3) result judges: 1~2 μ l color developing agent being added in above-mentioned PCR pipe, mixes, judges amplification according to colour developing result.
10. being examined using Transgenic Resistant Herbicide soybean BPS-CV127-9 as claimed in claim 7 and its LAMP of derived varieties
Test agent box detects the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 and its derived varieties, which is characterized in that packet
Include following steps:
1) Transgenic Resistant Herbicide soybean BPS-CV127-9 and its spin-off the extraction of measuring samples DNA: are extracted using CTAB method
Kind purification of samples DNA；
2) Constant Temperature Detection is reacted: preparing reaction system in 200 μ l PCR pipes: 1.8 μ l of primer liquid, reaction solution 15.2 μ l, DNA
Polymerase 1 μ l, fluorescence indicator SYTO-9 1 μ l, 1~6 μ l of DNA to be checked, with DNase/RNase-Free Distilled
Water polishing is to 25 μ l；When positive control reaction is arranged, with Transgenic Resistant Herbicide soybean BPS-CV127-9 and its spin-off
Kind DNA or e. coli plasmid dna containing target gene substitute DNA to be checked, when setting negative control reacts, with being free of purpose
The reaction mixture of gene substitutes DNA to be checked；It is centrifuged after prepared PCR pipe is mixed, and in real-time fluorescence detector 60
~65 DEG C of 45~90min of reaction, and continue 2min under the conditions of 80 DEG C；
3) result judges: according to whether S type amplification curve occur judges amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510705069.9A CN105483213B (en) | 2015-10-27 | 2015-10-27 | LAMP detection primer group, LAMP detection kit and the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510705069.9A CN105483213B (en) | 2015-10-27 | 2015-10-27 | LAMP detection primer group, LAMP detection kit and the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105483213A CN105483213A (en) | 2016-04-13 |
| CN105483213B true CN105483213B (en) | 2018-12-18 |
Family
ID=55670484
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510705069.9A Active CN105483213B (en) | 2015-10-27 | 2015-10-27 | LAMP detection primer group, LAMP detection kit and the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105483213B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586306A (en) * | 2012-03-02 | 2012-07-18 | 山东省农业科学院植物保护研究所 | Standard plasmid molecules for transgenetic soybean BPS-CV127-9 detection, constructing method thereof and application thereof |
| CN104593504A (en) * | 2015-01-22 | 2015-05-06 | 无锡中德美联生物技术有限公司 | Composite PCR (polymerase chain reaction) amplification fluorescence detection kit for 27 plant transgenic loci |
| CN104789649A (en) * | 2009-01-07 | 2015-07-22 | 巴斯夫农化产品有限公司 | Soybean event 127 and methods related thereto |
-
2015
- 2015-10-27 CN CN201510705069.9A patent/CN105483213B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789649A (en) * | 2009-01-07 | 2015-07-22 | 巴斯夫农化产品有限公司 | Soybean event 127 and methods related thereto |
| CN102586306A (en) * | 2012-03-02 | 2012-07-18 | 山东省农业科学院植物保护研究所 | Standard plasmid molecules for transgenetic soybean BPS-CV127-9 detection, constructing method thereof and application thereof |
| CN104593504A (en) * | 2015-01-22 | 2015-05-06 | 无锡中德美联生物技术有限公司 | Composite PCR (polymerase chain reaction) amplification fluorescence detection kit for 27 plant transgenic loci |
Non-Patent Citations (2)
| Title |
|---|
| Multiplex real-time PCR Method for the detection and quantificaiton of DNA from the four transgenic soy traits DP-356043-5, MON 87701, AND BPS-CV127-9 and lectin;Koeppel等;《EUROPEAN FOOD RESEARCH AND TECHNOLOGY》;20140430;第239卷(第2期);第347-355页 * |
| 转基因大豆BPS-CV127-9 PCR定量检测研究;李宁等;《大豆科学》;20121031;第31卷(第5期);第808-812页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105483213A (en) | 2016-04-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102634593B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize EVENT98140 and derived varieties thereof | |
| CN102634588B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize MIR604 and derived varieties thereof | |
| CN102634591B (en) | Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof | |
| CN104513861B (en) | LAMP detection primer group, detection kit and the detection method of genetically engineered soybean MON89788 and its derived varieties | |
| CN101225435A (en) | Method for quickly detecting transgenic soybean | |
| CN102051416B (en) | LAMP (loop-mediated isothermal amplification) primer group for detecting transgenic corn strain MIR604 at normal temperature | |
| Shin et al. | Event-specific detection system of stacked genetically modified maize by using the multiplex-PCR technique | |
| CN102649976B (en) | LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method | |
| CN109136341A (en) | A kind of primer, probe and kit and method detecting genetically engineered soybean A2704-12 | |
| CN104726582A (en) | Probe method based constant temperature detection primer group, detection kit and detection method of genetically modified soybeans MON89788 | |
| CN105483213B (en) | LAMP detection primer group, LAMP detection kit and the detection method of Transgenic Resistant Herbicide soybean BPS-CV127-9 | |
| CN102634592B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize BT176 and derived varieties thereof | |
| CN105063207B (en) | Genetically engineered soybean MON87705 LAMP detection primer group, kit and detection method | |
| CN109055592A (en) | A kind of anti-ring spot virus papaya YK16-0-1 of transgenosis and its efficient qualitative, quantitative identification method of spin-off | |
| CN105506071B (en) | LAMP detection primer group, LAMP detection kit and the detection method of transgenic pest-resistant soybean MON87701 and its derived varieties | |
| Sarmadi et al. | PCR-based detection of genetically modified soybean at a grain receiving port in Iran | |
| CN107142322A (en) | Transgenic corns MON87403 strain specificities real-time fluorescent PCR testing primer, probe, method and kit | |
| CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
| CN102634590B (en) | LAMP (Loop-Mediated Isothermal Amplification) detection primer group, detection kit and detection method of transgenic soybean A5547-127 and derived varieties thereof | |
| CN104726580B (en) | A kind of transgenic corns MON810 constant temperature probe method detection primer group, detection kit and detection method | |
| CN103060460A (en) | Primer, kit and method for detecting transgenic rice containing NOS (Nitric Oxide Synthase) terminator | |
| CN110643734A (en) | RPA primer and probe combination, kit and detection method of transgenic corn DAS-40278-9 | |
| CN105483122A (en) | Detection method, LAMP (loop-mediated isothermal amplification) detection kit and LAMP detection primer group of herbicide-resistant soybean DP-356043 and derived varieties thereof | |
| CN102634589B (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic soybean DP-305423 and derived varieties thereof | |
| CN105002291B (en) | Genetically engineered soybean MON87708 LAMP detection primer group, kit and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20170421 Address after: 201321 Shanghai city Pudong New Area schleid road 908 Lane Room 401 No. 23 Applicant after: Shanghai quick diagnosis Products Co., Ltd. Address before: 200434 Shanghai, Guangzhou road, No., room 1, building 738, Room 102 Applicant before: SHANGHAI SUXIN BIOTECHNOLOGY CO., LTD. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |