CN105420218A - Low-temperature xyloside/Arab furan glycoside bifunctional enzyme AX543 and gene and application thereof - Google Patents

Low-temperature xyloside/Arab furan glycoside bifunctional enzyme AX543 and gene and application thereof Download PDF

Info

Publication number
CN105420218A
CN105420218A CN201510973509.9A CN201510973509A CN105420218A CN 105420218 A CN105420218 A CN 105420218A CN 201510973509 A CN201510973509 A CN 201510973509A CN 105420218 A CN105420218 A CN 105420218A
Authority
CN
China
Prior art keywords
xyloside
enzyme
bifunctional enzyme
low temperature
temperature
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510973509.9A
Other languages
Chinese (zh)
Other versions
CN105420218B (en
Inventor
张同存
李中媛
张明慧
马文建
罗学刚
宋亚囝
王楠
何红鹏
周浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN201510973509.9A priority Critical patent/CN105420218B/en
Publication of CN105420218A publication Critical patent/CN105420218A/en
Application granted granted Critical
Publication of CN105420218B publication Critical patent/CN105420218B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01037—Xylan 1,4-beta-xylosidase (3.2.1.37)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01055—Alpha-N-arabinofuranosidase (3.2.1.55)

Abstract

The invention relates to the field of gene engineering, in particular to a low-temperature xyloside/Arab furan glycoside bifunctional enzyme AX543 and a gene thereof. The amino acid sequence of the low-temperature xyloside/Arab furan glycoside bifunctional enzyme AX543 is shown as SEQ ID NO.1, and the low-temperature xyloside/Arab furan glycoside bifunctional enzyme AX543 has the following properties that the optimal pH is 6.0, and 70% or above of relative enzymatic activity is achieved with the pH ranging from 5.0 to 8.0; the optimal temperature is 25 DEG C, 5%, 20% and 80% and above of the relative activity are maintained at the temperature of 0 DEG C, 4 DEG C and 15 DEG C, good thermal stability is achieved, and 50% and above of the enzyme activity can be maintained after treatment is conducted for one hour at the temperature of 40 DEG C. The AX543 has xylosidase and Arab furan glycosidic enzyme activity at the same time, can be used for industries such as energy, fodder and food and reduces energy consumption.

Description

A kind of xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543 of low temperature and gene thereof and application
Technical field
The present invention relates to genetically engineered field, particularly, the present invention relates to a kind of low temperature xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543 and gene thereof and application.
Background technology
Hemicellulose is the important composition composition in lignocellulose, its structure and composition more complicated, and its main chain to be polymerized by the mode of straight or branched by five-carbon sugar to be formed, and its side chain has multiple substituting group, as semi-lactosi, pectinose etc.Xylan is the main composition forming hemicellulose, is also the abundantest hemicellulose resource.Although hemicellulose is easy to be resolved into monomer by acid, but acid hydrolyzation is easy to environment, adopts bio-enzyme degradation hemicellulose can effectively avoid polluting, realize the energy and " clean " this target.The multiple enzyme of degradable needs of xylan, first the xylo-oligosaccharide molecule of different chain length is cut to randomly by zytase, and then the non reducing end of xylo-oligosaccharide molecule is acted on by xylobiase, degradable one-tenth wood sugar, and arabinofuranosidase, tilactase and feruloyl esterase etc. act on the glycosidic link of side chain, discharge more monose and oligosaccharides.Xylosidase and arabinofuranosidase can be applied to the industry such as traditional industrial technology, Energy resources field, foodstuffs industry, feed, papermaking.
In the industrial production of running continuously, the application of cold-adapted enzyme can reduce the contaminated risk of bacterial classification to a great extent, and production process is carried out at depressed temperatures, or at room temperature, without the need to heating and cooling, can reduce costs save energy; Production process is convenient to monitoring; In food service industry, due to cold-adapted enzyme easy inactivation under middle temperature, after application of cold temperature enzyme reaches optimum response effect, only the short period need be kept just can to make enzyme deactivation in moderate temperature, the local flavor of food can not be destroyed like this because temperature is high.But the most xylosidase found at present and the optimum temperature of arabinofuranosidase are mainly between 40-70 DEG C, therefore, obtain low temperature xylosidase and the arabinofuranosidase of good properties, and it is expressed, purifying, character, the research of constitutional features and application has great significance.
The optimum temperuture of xyloside/arabinofuranosidase of the present invention 25 DEG C, at 0 DEG C, 4 DEG C and 15 DEG C maintain 5% respectively, the relative reactivity of more than 20% and 80%, and there is good thermostability, can keep the enzymic activity of more than 50% at 40 DEG C of process 1h, be a kind of new low temperature xyloside/arabinofuranosidase with application potential.
Summary of the invention
The object of this invention is to provide a kind of low temperature xylosidase/arabinofuranosidase bifunctional enzyme of energy efficient application.
Another object of the present invention is to provide coding above-mentioned low temperature xylosidase/arabinofuranosidase bifunctional enzyme gene.
Another object of the present invention is to provide the recombinant vectors comprising said gene.
Another object of the present invention is to provide the recombinant bacterial strain comprising said gene.
The present invention is separated and obtains a kind of new low temperature xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543 from ring-band shape Acremonium bacterium.
The invention provides a kind of low temperature xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543, its aminoacid sequence is as shown in SEQIDNO.1.
SEQIDNO.1：
MPPLITSIYTADPSAHVFNDKIYIYPSHDRETDIAFNDNGDQYDMADYHVFSTSDFKEVTDHGVVLKTEDVPWASKQLWAPDAAHKNGKYYLYFPARDKEGIFRIGVAVGDKPEGPFTADPEPIKGSYSIDPASFVDDDGQAYLYFGGLWGGQLQCYQKGDDTYDPEWQGPKEVSGEGVAAQGPRAAKLTDDMHQFESPAQELLILDPETKEPILGDDHARRFFEAAWMHKHNGKYYFSYSTGDTHFLCYAVGDSPMGPFTYGGKILEPVLGWTTHHSIVEYKGKTYLFFHDCELSKGVDHLRSVKAKEIFYDDQGRIITTKAD
Wherein, this enzyme genes encoding 324 amino acid and a terminator codon, do not comprise signal peptide, and therefore, the theoretical molecular of ripe bifunctional enzyme AX543 is 36.52kDa.
AX543 of the present invention is a cold-adapted enzyme, and optimum temperuture is 25 DEG C, has good thermostability simultaneously, under normal temperature, in slightly acidic and neutral scope, all has activity.The present invention clones the bifunctional enzyme AX543 obtained, and its optimum pH is 6.0, take pNPX as substrate, records the enzymic activity that its xylosidase activity maintains more than 50% in the scope of PH5.0 ~ 7.0; Be substrate with pNPAf, record the activity that its nofuranosidase activity maintains more than 50% in the scope of PH5 ~ 9; All there is 40 DEG C of process 1h latter two enzymic activitys the enzyme activity of more than 50%.
The invention provides the above-mentioned low temperature bifunctional enzyme AX543 of coding.Particularly, the genome sequence of this gene is as shown in SEQIDNO.2.
SEQIDNO.2：
ATGCCGCCCCTCATTACCTCCATCTACACAGCTGATCCCTCAGCCCACGTCTTCAATGACAAGATCTACATCTACCCGTCTCACGACCGCGAGACGGACATTGCCTTCAACGACAATGGCGACCAGTATGACATGGCCGACTACCATGTCTTCTCCACGTCGGACTTCAAGGAGGTGACCGACCACGGCGTCGTGCTCAAGACAGAGGACGTGCCGTGGGCGAGCAAGCAGCTCTGGGCCCCCGACGCGGCGCACAAGAACGGAAAATACTACCTCTACTTCCCGGCACGAGACAAGGAAGGCATCTTTCGGATTGGCGTGGCCGTGGGTGACAAGCCCGAGGGCCCCTTCACCGCCGACCCAGAGCCCATCAAGGGCAGCTACTCCATCGACCCGGCCAGTTTCGTCGACGATGACGGCCAGGCCTACCTCTACTTTGGCGGTCTCTGGGGTGGCCAGCTCCAATGCTACCAAAAGGGCGACGACACGTACGACCCGGAGTGGCAAGGACCCAAGGAAGTCTCTGGCGAGGGCGTCGCAGCGCAGGGCCCTCGCGCCGCCAAGTTGACAGACGACATGCACCAATTCGAGTCGCCAGCCCAAGAGCTCCTCATTCTGGACCCAGAGACCAAGGAACCCATTCTCGGCGACGACCACGCGCGCCGCTTCTTTGAAGCCGCGTGGATGCACAAGCACAATGGCAAGTACTACTTCTCCTACTCGACGGGCGACACCCACTTCCTCTGCTACGCCGTGGGCGACTCACCCATGGGTCCGTTCACGTATGGCGGCAAGATCCTGGAGCCCGTGCTGGGCTGGACGACGCACCACTCGATTGTCGAGTACAAGGGCAAGACATATCTCTTCTTCCACGACTGTGAGCTGAGCAAGGGTGTGGACCACCTCAGGAGCGTCAAGGCCAAGGAGATCTTTTACGACGATCAGGGTAGGATCATCACGACAAAGGCAGAT
The present invention passes through the method separating clone of PCR bifunctional enzyme AX543, DNA complete sequence analysis result and shows, bifunctional enzyme AX543 structure gene AX543 total length 972bp.
Albumen theoretical molecular is 36.52kDa, bifunctional enzyme Gene A X543 sequence and the aminoacid sequence derived are carried out BLAST comparison in GenBank, and this gene is 86% with the Xylosidase/arabinosidase-likeprotein Amino acid sequence identity deriving from AcremoniumchrysogenumATCC11550.Illustrate that AX543 is a kind of new bifunctional enzyme.
Present invention also offers the recombinant vectors comprising above-mentioned bifunctional enzyme Gene A X543, called after pPIC-AX543.Bifunctional enzyme gene of the present invention is inserted between the suitable restriction enzyme site of expression vector, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, preferably xylosidase gene of the present invention is inserted between EcoRI and the NotI restriction enzyme site on plasmid pPIC9, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulate and control by it, obtain expression of recombinant yeast plasmid pPIC9-AX543.
Present invention also offers the recombinant bacterial strain comprising above-mentioned low temperature bifunctional enzyme AX543, preferred described bacterial strain is intestinal bacteria, yeast, is preferably recombinant bacterial strain GS115/AX543.
Present invention also offers a kind of method preparing low temperature bifunctional enzyme AX543, comprise the following steps:
1) with above-mentioned recombinant vectors transformed host cell, recombinant bacterial strain is obtained;
2) recombinant bacterial strain is cultivated, induction recombination double functions expression of enzymes;
3) the bifunctional enzyme AX543 also expressed by purifying is reclaimed.
Wherein, preferred described host cell is Pichia pastoris, cerevisiae or many types of inferior yeast cell, preferably by expression of recombinant yeast Plastid transformation Pichia pastoris (Pichiapastoris) GS115, obtain recombinant bacterial strain GS115/AX543.
Accompanying drawing explanation
The ni-sepharose purification of Fig. 1 recombination double functions enzyme.
The optimal pH of Fig. 2 recombination double functions enzyme.
The pH stability of Fig. 3 recombination double functions enzyme.
The optimum temperuture of Fig. 4 recombination double functions enzyme.
The thermostability of Fig. 5 recombination double functions enzyme.
The metal ion stability of Fig. 6 recombination double functions enzyme.
Embodiment
Test materials and reagent
1, bacterial strain and carrier: the present invention is separated and obtains a kind of new low temperature bifunctional enzyme AX543 from the ring-band shape Acremonium bacterium 54-7 deriving from pedotheque.Yeast expression vector pPIC9 and bacterial strain GS115 is purchased from Invitrogen company.
2, enzyme and other biochemical reagents: restriction endonuclease is purchased from TaKaRa company, and ligase enzyme is purchased from Invitrogen company.Available from Sigma, other is all domestic reagent (all can buy from common biochemical Reagent Company and obtain).
3, substratum:
(1) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH7.0).
(2) BMGY substratum: 1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerine (V/V).
(3) BMMY substratum: replace glycerine divided by 0.5% methyl alcohol, all the other compositions are all identical with BMGY.
(4) NB substratum: 0.3% yeast powder, 0.5% peptone, 0.6 glucose, 1%Nacl.
Illustrate: in following examples, do not make the experimental methods of molecular biology illustrated, concrete grammar listed in equal reference " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book carries out, or carries out according to test kit and product description.
The clone of embodiment 1 ring-band shape Acremonium bacterium xylosidase encoding gene ax543
Extract the ring-band shape Acremonium bacterium 54-7 genomic dna deriving from pedotheque:
Conserved regions (SKQLWAPD and CWTTHHSIVE) sequences Design according to the 43rd xylosidase gene has synthesized degenerated primer XylF, XylR.With ring-band shape Acremonium bacterium 54-7 STb gene for template carries out Touch-downPCR amplification.PCR reaction parameter is: 94 DEG C of sex change 5min; Then 94 DEG C of sex change 30sec, 65-55 DEG C of annealing 45sec (each cycle down 0.5 degree), 72 DEG C extend 40sec10 circulation, 94 DEG C of sex change 30s, 55 DEG C of annealing 45sec, and 72 DEG C extend 1min, 30 rear 72 DEG C of insulation 10min of circulation.Obtain an about 622bp fragment, be connected with PMD-19T carrier after this fragment is reclaimed and check order.According to the nucleotide sequence obtained that checks order, each three the TAIL-PCR Auele Specific Primers of design upstream and downstream: design direction is the zone of ignorance direction needing amplification, and the Position Design of sp2 is in the inner side of sp1, and sp3 is positioned at the inner side of sp2.Distance between every two primers does not have strict regulation, and the general 22 ~ 30nt of primer length, annealing temperature is at 60 ~ 65 DEG C.And by they difference called after usp1, usp2, usp3 (upstream specific primer), dsp1, dsp2, dsp3 (downstream specific primer) are in table 1.
Table 1. xylosidase Xyl543-1TAIL-PCR Auele Specific Primer
Obtained the flanking sequence of known sequence by TAIL-PCR, amplification obtains product and reclaims the order-checking of Hou Songjinwei intelligence company.AX543 xylosidase gene total length 972bp after splicing, encode 324 amino acid and a terminator codon.The theoretical molecular of the maturation protein of this coded by said gene is 36.52kDa.
The preparation of embodiment 2 recombination double functions enzyme Xyl/Abf543-1
Expression vector pPIC9 is carried out double digestion (EcoRI+NotI), simultaneously by the gene ax543 double digestion (EcoRI+NotI) of encodes xylose glycosides enzyme, the gene fragment cutting out encoding mature xylosidase is connected with expression vector pPIC9, the recombinant plasmid pPIC-ax543 obtained containing xylosidase gene ax543 transforms Pichia pastoris GS115, obtains recombinant pichia yeast strain GS115/ax543.
Get the GS115 bacterial strain containing recombinant plasmid, be inoculated in 100mLBMGY nutrient solution, after 30 DEG C of 250rpm shaking culture 48h, collected by centrifugation thalline.Then resuspended in 50mLBMMY substratum, 30 DEG C of 250rpm shaking culture.After induction 48h, collected by centrifugation supernatant.Measure the vigor of xylosidase.After ni-sepharose purification, SDS-PAGE result shows, recombination double functions enzyme obtains expression in pichia spp.As shown in the figure, swimming lane 1 is the result after purifying, and swimming lane 2 is unpurified result.Recording its xylosidase specific activity is 15.076U/mg; Arabinofuranosidase specific activity is 2.083U/mg.
The activation analysis of embodiment 3 bifunctional enzyme
Concrete grammar is as follows: pNPX/pNPAf substrate and the 150 μ L citrate-phosphate disodium hydrogen damping fluids of 250 μ L2mM mix, and add the enzyme liquid that 100 μ L suitably dilute, and in 25 DEG C of reaction 10min, adds 1.5mL, the Na of 1M 2cO 3termination reaction, uses spectrophotometric determination OD 405value, to calculate the amount of product p-NP.1 xylosidase activity unit (U) is defined as under given respective reaction condition, and per minute decomposition p-nitrophenyl β-D-xyloside (pNPX) substrate generates the enzyme amount required for 1 μm of ol p-NP (pNP).1 α-l-arabfuranglycosidase activity unit (U) is defined as under the given reaction conditions, and per minute decomposition substrate pNPAf generates the enzyme amount needed for 1 μm of ol p-NP.
The property testing of embodiment 4 bifunctional enzyme AX543
1, the optimal pH of recombination double functions enzyme AX543 and the measuring method of pH stability as follows:
The Scrimber Glycosylase of embodiment 2 purifying is carried out under different pH enzymatic reaction to measure its optimal pH.Take pNPX/pNPAf as substrate, final concentration is 2mM, gets 250 μ L substrates and adds the corresponding damping fluid of 150 μ L.The cushion gradient of buffered soln is different: 100mMcitrate-Na 2hPO 4(pH3.0 – 8.0), 100mM glycine-NaOH (pH9.0 – 12.0).Mixing solutions first precooling 5min under the reaction conditions of 25 DEG C of substrate and damping fluid, adds the enzyme liquid that 100 μ L suitably dilute, and mixing is accurate response 10min also, adds 1.5mlNa 2cO 3termination reaction, measures OD after being cooled to room temperature 405value.Result (Fig. 1) shows, the optimal pH of recombinase when taking pNPX as substrate is 6.0, has the relative activity of more than 30% between PH4.0 ~ 7.5.Optimal pH when taking pNPAf as substrate is also 6.0, has the relative activity of more than 50% between PH5.0 ~ 9.Recombinase in the damping fluid of various different PH 37 DEG C, process 1h, then in the damping fluid of PH6.0, measure relative surplus enzyme under the condition of 20 DEG C and live, with the PH stability of studying enzyme.Result (Fig. 2) shows, records its xylosidase activity all very stable between PH5 ~ 7, and relative surplus enzyme is lived all more than 50%.Nofuranosidase activity is also comparatively stable in the scope of PH5.5 ~ 7.5.
2, the optimum temperuture of bifunctional enzyme and thermal stability determination method as follows:
Being determined as of optimum temperuture of bifunctional enzyme carries out enzymatic reaction under citrate-phosphate disodium hydrogen damping fluid (pH6.0) buffer solution system and differing temps.Thermal stability determination is that recombinase processes different time at different temperatures, then carries out enzyme assay at 25 DEG C.Enzyme reaction optimum temperuture measurement result (Fig. 3) shows that two kinds of enzymic activity optimum temperutures are 25 DEG C.The thermostability test of enzyme shows (Fig. 4), and AX543 has good thermostability, incubation 60min at 40 DEG C, and the enzyme of more than 50% can be kept to live.
3, the K of recombinase mvalues determination method is as follows:
Be substrate with pNPX and the pNPAf of different concns respectively, in citrate-phosphate disodium hydrogen damping fluid (pH6.0) buffer solution system, at 25 DEG C, measure enzymic activity, calculate the K at 4 DEG C, 15 DEG C and 25 DEG C respectively mvalue and Vmax.It is as shown in the table for experimental result.(table 2)
Km, Vmax pH-value determination pH under table 2.AX543 differing temps
4, different metal ion chemistry reagent is determined as follows the impact that AX543 enzyme is lived:
In enzymatic reaction system, add different metal ions and chemical reagent, study its impact on enzymic activity, various material final concentration is 5mmol/L.20 DEG C, measure enzymic activity under Ph6.0 condition.Result shows, with pNPX and pNPAf for substrate, most of ion, when concentration is 5mmol, has restraining effect to a certain degree to its enzyme activity.Wherein Fe 2+, Zn 2+, Cu 2+its vigor of energy strongly inhibited, and Mn 2+, Ca 2+obvious enhancing enzyme activity.
5, the substrate specificity of recombinase
This enzyme has outside activity to pNPX, pNPAf, also has certain hydrolytic action (table 3) to beech xylan and birch xylan.
Table 3. bifunctional enzyme AX543 substrate specificity is analyzed

Claims (8)

1. low temperature xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543, it is characterized in that, its aminoacid sequence is as shown in SEQIDNO.1.
2. low temperature xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543 encoding gene, is characterized in that, described genes encoding low temperature xyloside according to claim 1/arabinofuranosidase glucosides bifunctional enzyme AX543.
3. low temperature xyloside according to claim 2/arabinofuranosidase glucosides bifunctional enzyme AX543 encoding gene, it is characterized in that, its nucleotide sequence is as shown in SEQIDNO.2.
4. comprise the recombinant vectors of low temperature xyloside described in claim 2/arabinofuranosidase glucosides bifunctional enzyme AX543 encoding gene.
5. comprise the recombinant vectors pPIC-AX543 of low temperature xyloside described in claim 2/arabinofuranosidase glucosides bifunctional enzyme AX543 encoding gene.
6. comprise the recombinant bacterial strain of low temperature xyloside described in claim 2/arabinofuranosidase glucosides bifunctional enzyme AX543 encoding gene.
7. prepare a method of low temperature xyloside described in claim 1/arabinofuranosidase glucosides bifunctional enzyme AX543, it is characterized in that, said method comprising the steps of:
1) with the recombinant vectors transformed host cell of claim 4, recombinant bacterial strain is obtained;
2) cultivate recombinant bacterial strain, induction restructuring low temperature xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543 encoding gene is expressed;
3) the low temperature xyloside/arabinofuranosidase glucosides bifunctional enzyme AX543 also expressed by purifying is reclaimed.
8. the application of low temperature xyloside described in claim 1/arabinofuranosidase glucosides bifunctional enzyme AX543.
CN201510973509.9A 2015-12-23 2015-12-23 A kind of xyloside of low temperature/arabinofuranosidase glucosides bifunctional enzyme AX543 and its gene and application Active CN105420218B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510973509.9A CN105420218B (en) 2015-12-23 2015-12-23 A kind of xyloside of low temperature/arabinofuranosidase glucosides bifunctional enzyme AX543 and its gene and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510973509.9A CN105420218B (en) 2015-12-23 2015-12-23 A kind of xyloside of low temperature/arabinofuranosidase glucosides bifunctional enzyme AX543 and its gene and application

Publications (2)

Publication Number Publication Date
CN105420218A true CN105420218A (en) 2016-03-23
CN105420218B CN105420218B (en) 2019-02-05

Family

ID=55498759

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510973509.9A Active CN105420218B (en) 2015-12-23 2015-12-23 A kind of xyloside of low temperature/arabinofuranosidase glucosides bifunctional enzyme AX543 and its gene and application

Country Status (1)

Country Link
CN (1) CN105420218B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110564747A (en) * 2019-09-10 2019-12-13 集美大学 application of XylA gene with double functions of xylosidase and arabinofuranosidase
CN110699339A (en) * 2019-09-16 2020-01-17 天津科技大学 Low-temperature beta-xylosidase mutant with improved thermal stability and specific activity and coding gene and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102363748A (en) * 2011-09-30 2012-02-29 中国科学院南海海洋研究所 New fungus Acremonium sp. DPZ-SYz-2-3 for high efficiency cellulose degradation and application thereof
EP2554667A1 (en) * 2010-03-31 2013-02-06 Meiji Seika Pharma Co., Ltd. Novel cellulase gene

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2554667A1 (en) * 2010-03-31 2013-02-06 Meiji Seika Pharma Co., Ltd. Novel cellulase gene
CN102363748A (en) * 2011-09-30 2012-02-29 中国科学院南海海洋研究所 New fungus Acremonium sp. DPZ-SYz-2-3 for high efficiency cellulose degradation and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BARONCELLI,R.等: "NCBI Reference Sequence：XM_007600436.1", 《GENBANK》 *
TERFEHR,D.等: "Genbank：KFH43812.1", 《GENBANK》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110564747A (en) * 2019-09-10 2019-12-13 集美大学 application of XylA gene with double functions of xylosidase and arabinofuranosidase
CN110699339A (en) * 2019-09-16 2020-01-17 天津科技大学 Low-temperature beta-xylosidase mutant with improved thermal stability and specific activity and coding gene and application thereof
CN110699339B (en) * 2019-09-16 2021-12-28 天津科技大学 Low-temperature beta-xylosidase mutant with improved thermal stability and specific activity and coding gene and application thereof

Also Published As

Publication number Publication date
CN105420218B (en) 2019-02-05

Similar Documents

Publication Publication Date Title
Gielkens et al. Two cellobiohydrolase-encoding genes from Aspergillus niger require D-xylose and the xylanolytic transcriptional activator XlnR for their expression
CN102041251B (en) Glucosidase/xylosidase difunctional cellulose degradation enzyme RuGBGX2 as well as coding gene and application thereof
CN107129976B (en) Xylanase, coding gene thereof and application thereof
CN104357429B (en) A kind of high temperature neutral beta glucuroide HiBgl3A and its gene and application
CN102719417B (en) High-temperature resistance arabinfuranosidease Abf51B8, as well as gene and application thereof
CN105420218A (en) Low-temperature xyloside/Arab furan glycoside bifunctional enzyme AX543 and gene and application thereof
CN107002055B (en) Fungus-derived high-temperature acidic beta-glucosidase, and coding gene and application thereof
CN116410960B (en) Beta-xylosidase mutant D41G with cold and pH adaptability improved halophilic suitability and application thereof
EP2646545B1 (en) TEMPERATURE-STABLE ß-PYRANOSIDASE
CN102181416B (en) Alkali-resisting beta-mannase Man5A as well as gene and applications thereof
CN104388408A (en) Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3
CN106995809B (en) Low-temperature xylanase Xyn27, and gene and application thereof
CN104498456A (en) Acidic beta-glucosidase Bgl3B and gene and application thereof
CN108823188B (en) Endoglucanase, and coding gene and application thereof
CN103525791B (en) A kind of high temperature resistant neutral cellulase Cel61P8 and gene thereof and application
CN105018444A (en) Humicola-sourced high-temperature acid beta-glucosidase HiBgl3C as well as gene and application thereof
EP2346894A1 (en) Thermostable cellulase and methods of use
CN109402089B (en) Thermostable arabinofuranosidase and application thereof
CN102978189B (en) High specific activity xylosidase Xyl52B8 and gene and application thereof
Zhang et al. Characterization, gene cloning and expression of new xylanase XYNB with high specific activity
Čepeljnik et al. Isolation and characterization of the Pseudobutyrivibrio xylanivorans Mz5T xylanase XynT—the first family 11 endoxylanase from rumen Butyrivibrio-related bacteria
CN113528491B (en) Method for improving heat stability of Aspergillus niger xylanase through N-glycosylation modification
CN103131684B (en) A kind of C of having holds the method for the zytase XynA of unnecessary sequence and gene thereof and purposes, raising zytase catalytic rate
Li et al. Cloning, heterologus expression and characterization of a thermophilic and salt tolerant GH11 xylanase from Allostreptomyces psammosilenae YIM DR4008 T
CN105176950A (en) Acidic thermophilic xylanase TLXyn10A and genes and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Li Zhongyuan

Inventor after: Zhang Tongcun

Inventor after: Zhang Minghui

Inventor after: Ma Wenjian

Inventor after: Luo Xuegang

Inventor after: Song Yajian

Inventor after: Wang Nan

Inventor after: He Hongpeng

Inventor after: Zhou Hao

Inventor before: Zhang Tongcun

Inventor before: Li Zhongyuan

Inventor before: Zhang Minghui

Inventor before: Ma Wenjian

Inventor before: Luo Xuegang

Inventor before: Song Yajian

Inventor before: Wang Nan

Inventor before: He Hongpeng

Inventor before: Zhou Hao

GR01 Patent grant
GR01 Patent grant