CN105418740A - Pineapple function centromere antigenic polypeptide and application thereof - Google Patents
Pineapple function centromere antigenic polypeptide and application thereof Download PDFInfo
- Publication number
- CN105418740A CN105418740A CN201510950637.1A CN201510950637A CN105418740A CN 105418740 A CN105418740 A CN 105418740A CN 201510950637 A CN201510950637 A CN 201510950637A CN 105418740 A CN105418740 A CN 105418740A
- Authority
- CN
- China
- Prior art keywords
- pineapple
- function
- kinetochore
- centromere
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/06—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from serum
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/16—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from plants
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides pineapple function centromere antigenic polypeptide and application thereof, an amino acid sequence is as shown in SEQ ID NO.2, one polypeptide is synthesized according to a specific sequence at an N terminal of the amino acid sequence, a New Zealand white rabbit is conventionally immunized by using the polypeptide, antiserum is prepared, an antibody of CENH3 protein is obtained by affinity purification of an antigen, an immunofluorescence test of the antibody is performed, the antibody of the pineapple CENH3 protein can be used for cytological localization of position of pineapple function centromere, also can be used for ChIP-seq combined with a chromatin immunoprecipitation technology of the pineapple, the position, size and sequence information of function centromere on chromosome of the pineapple are determined, the location of a centromere genome genetic map and a physical map is performed, and important tools and information are provided for formation of the centromere and study of a function performing mechanism and the construction of artificial chromosome.
Description
Technical field
The present invention relates to information biology and molecular cytogenetics field, be specifically related to pineapple function kinetochore antigenic peptide and application thereof.
Background technology
Kinetochore is functional element important on higher eucaryote karyomit(e).In cell mitogen with reduction division process, be responsible for chromosomal equalization be separated, thus play the vital role guaranteeing genetic material stable delivery.Therefore the research carrying out aspect, kinetochore has important theory and realistic meaning for the something lost rule disclosing organism.Due to the importance of kinetochore function, people have carried out large quantifier elimination to kinetochore, in cytology, we are defined as kinetochore in the primary constriction district on karyomit(e), when observing chromosomal form, this region clearly can be seen by us, but fuzzyyer for centric concrete boundary definition, in order to carry out further research, we need clearerly to know centric structure.Along with going deep into of research, people have carried out a fine division more to centric structure, kinetochore is made up of two structural domains, the i.e. periphery centromeric heterochromatin structural domain of Core domain and Core domain both sides, they exercise centric difference in functionality respectively, wherein the function of Core domain sets up kinetochore, attachment spindle fibre, participate in chromosomal migration, exercise centric major function, therefore this region be it is believed that it is actual centric region, people call function kinetochore it, by to the centric research of plant function, it is found that and it also exists the very important albumen of a kind of function and CENH3 albumen, its effect to raise kinetochore protein, therefore, the region that it exists on chromosome is considered to centric region, it is also by the special marking as identification kinetochore functional area, by centric position and size can be reflected to the research of CENH3 position and size.At present, immunofluorescence technique and chromatin immune chemical coprecipitation technique utilize CENH3 antibody research function kinetochore the best way, and therefore, the qualification of CENH3 gene and the preparation of specific recognition antibody thereof also become function kinetochore and study indispensable instrument.
Summary of the invention
The object of this invention is to provide a kind of pineapple function kinetochore antigenic peptide and application thereof, obtain the gene order of pineapple function kinetochore histone CENH3 and the aminoacid sequence obtained by this genetic expression and the specific antibody obtaining CENH3 albumen, then this antibody is used for immunofluorescence experiment, carry out the research of aspect, pineapple kinetochore, determine the centric position of function and size and sequence information on pineapple karyomit(e), make its physical map information more comprehensive, the information in kinetochore can also be provided simultaneously in the genomic assembling of pineapple.
For achieving the above object, the technical scheme taked of the present invention is as follows:
Pineapple function kinetochore antigenic peptide, aminoacid sequence is MARTKHFSNKPSSRSKKRLQ.The aminoacid sequence of corresponding CENH3 albumen is obtained according to the gene nucleotide series of obtained pineapple function kinetochore histone CENH3, and according to section special sequence synthetic of wherein pineapple function kinetochore antigenic peptide, prepare corresponding antibody using this polypeptide as antigen.
Pineapple function kinetochore histone CENH3, aminoacid sequence is as shown in SEQIDNO.2.
Encode the gene of described pineapple function kinetochore histone CENH3, its nucleotides sequence is classified as shown in SEQIDNO.1.Described pineapple function kinetochore histone CENH3 is used for antibody preparation.
First the method for information biology sequence alignment is utilized to predict the nucleotide sequence obtaining pineapple CENH3 protein gene, then the one section of distinguished sequence held according to the aminoacid sequence N of this sequence encoding synthesizes a polypeptide, again with this polypeptide routine immunization new zealand white rabbit, prepare antiserum(antisera), eventually pass the antibody that antigen affinity purification obtains CENH3 albumen.Due to the differential protein that CENH3 albumen is on function kinetochore, gained antibody capable identifies the function kinetochore of pineapple specifically, can at the Chromatin immunoprecipitation assay of pineapple (ChIP), and in the application that combines on (ChIP-seq) with s-generation high throughput sequencing technologies of this technology, in conjunction with the analytical procedure of information biology, determine the centric size of function and position and sequence information on pineapple karyomit(e).
Method is as follows:
1, carry out sequence alignment analysis by bioinformatics software, obtain the gene nucleotide series that pineapple CENH3 albumen is corresponding;
2, the aminoacid sequence of the corresponding CENH3 albumen of pineapple is obtained according to above-mentioned nucleotide sequence;
3, according to the difference between CENH3 albumen and H3 albumen, one section of distinguished sequence synthetic polypeptide that CENH3 Argine Monohydrochloride N holds is chosen, using this polypeptide as antigen;
4, by antigen routine immunization 2 new zealand white rabbits;
5, prepare antiserum(antisera), obtain antibody;
6, through Immunofluorescence test, result shows this antibody specific combination pineapple chromosome centromere position, confirms that this antibody is the antibody of pineapple CENH3 albumen.
beneficial effect
The gene order of pineapple CENH3 albumen that the present invention obtains and the aminoacid sequence obtained by this genetic expression and the specific antibody obtaining CENH3 albumen, through immunofluorescence experiment, find only to have occurred in centric position bright and signal clearly, show that the antibody of the CENH3 albumen that the present invention obtains is true and reliable, can follow-up use be carried out.
The present invention is conducive to the research carrying out aspect, pineapple kinetochore, the sequencing technologies (ChIP-seq) that the DNA hybridization in situ technique (ChIP-FISH) that can be obtained by pineapple chromatin imrnunoprecipitation in follow-up research and Chromatin immunoprecipitation assay are combined, obtain pineapple function centric position size and sequence information, build and improve pineapple genetic map and physical map, thus inquiring into the mechanism that pineapple kinetochore is formed and function is exercised further.
Accompanying drawing explanation
Immunofluorescence experiment-the A of Fig. 1: pineapple CENH3 protein antibodies: pineapple cell mitogen karyomit(e), B: fluorescent signal, C: composite diagram.As we can see from the figure, the fluorescent signal that the antibody that the present invention obtains produces, all in region, pineapple chromosomal kinetochore, demonstrates the operability of CENH3 antibody.
Embodiment
the acquisition of embodiment 1 pineapple function kinetochore histone CENH3 sequence
According to the sequence information of known H3 albumen and the relation between H3 albumen and CENH3 albumen, they have the homology of height at histone fold domain, but there is obvious difference at N end, use the search of BLAST homology, using the H3 protein sequence of pineapple as search sequence, in est database, carry out homology search comparison, have found the total length CDNA of the CENH3 albumen of pineapple, resulting in the gene order of CENH3 albumen and the protein sequence of CENH3 of pineapple.
The present invention uses the method for BLAST sequence alignment, obtains the corresponding sequence information of CENH3 albumen according to the relation between CENH3 albumen to H3 albumen.
embodiment 2: the selection of antigen
According to the protein sequence of the pineapple function kinetochore CENH3 obtained
,by bioinformatics software comparison CENH3 protein sequence and H3 protein sequence, obtain the distinguished sequence (MARTKHPAVRKSKAEPKKKL) that pineapple CENH3 Argine Monohydrochloride N holds, adopt this section of sequence artificial synthetic polypeptide, through HPLC and Mass Spectrometric Identification, the purity of this polypeptide is more than 85%, and content is 10-14mg.
embodiment 3: the Preparation and evaluation of antibody
1, with the polypeptide of above-mentioned acquisition for antigen.
2, carrier conjugation, is coupled to the polypeptide of synthesis on protein carrier.
3, animal immune, antiserum prepare.Immunity 2 new zealand white rabbits, first to take a blood sample in advance, then at the 0th day with Split completely+antigen, 600 ~ 800ug/ only, carry out initial immunity, cannotd be used up at the 21st day full freund adjuvant+antigen, 400 ~ 500ug/ only, carry out first time booster immunization, cannotd be used up at the 35th day full freund adjuvant+antigen, 400 ~ 500ug/ only, carry out second time booster immunization, Virus monitory is carried out at the 42nd day, required antiserum(antisera) ELISA tires as 1:20000, requirement is reached if tire, whole blood is adopted at the 49th day, be separated antiserum(antisera), as do not reached requirement, cannotd be used up at the 49th day full freund adjuvant+antigen, 200ug/ only, carry out third time booster immunization, Virus monitory is carried out at the 56th day, requirement is reached if tire, within 63rd day, adopt whole blood, be separated antiserum(antisera).
4, antigen affinity purification, every antibody purification rabbit 30ml antiserum(antisera).The antibody obtained detects purity more than 90% through SDS-PAGE.
In order to the identification pineapple CENH3 albumen determining that this antibody can be special further, We conducted the DNA hybridization in situ experiment (ChIP-FISH) that the immunofluorescence experiment of this antibody protein and chromatin immune co-precipitation obtain, result shows, in pineapple root-tip cells, all there is bright and signal clearly in every bar chromosomal centric region, wherein Metaphase Chromosome has 50 pairs of signal (see photo), thus confirm that this antibody can identify CENH3 albumen really specifically, also demonstrate that antigenic peptide of the present invention can produce special antibody really, in follow-up research, can be tested by immunostaining, carry out the location of pineapple chromosome centromere and the determination of size, build simultaneously and improve genetic map and the physical map of pineapple.
The foregoing is only preferred embodiment of the present invention, all equalizations done according to the present patent application the scope of the claims change and modify, and all should belong to covering scope of the present invention.
SEQUENCELISTING
<110> University Of Agriculture and Forestry In Fujian
<120> pineapple function kinetochore antigenic peptide and application thereof
<130>3
<160>3
<170>PatentInversion3.3
<210>1
<211>456
<212>DNA
<213> artificial sequence
<400>1
atggcgcggacgaagcacttctccaacaagccctcctcacgctccaagaagcgcctccaa60
tggaatcgctcccctcgaccccgacccgggggagcgaccacctccgccaccccaacgtcg120
ccgggtcagcagcagcagcagaagcagaggcagcgccatagattcaggcccggcaccgta180
gcgctccgggagatccggaagcttcagaagtcggtcaagctgctcatccctttcgccccc240
ttcgtcagaattgtgaaggagattagtaacttctattcaaaggatgtctcacgatgggcc300
gccgaagctctattggctttgcaagaggcagcagaatcgcatttacaggagttgtttgcg360
gatgctaatctttgtgcaattcatgctaaacgtgttacactcatgcaaaaggatatacaa420
cttgcgaggaggattggtggtcagaggacgtggtga456
<210>2
<211>151
<212>PRT
<213> artificial sequence
<400>2
MetAlaArgThrLysHisPheSerAsnLysProSerSerArgSerLys
151015
LysArgLeuGlnTrpAsnArgSerProArgProArgProGlyGlyAla
202530
ThrThrSerAlaThrProThrSerProGlyGlnGlnGlnGlnGlnLys
354045
GlnArgGlnArgHisArgPheArgProGlyThrValAlaLeuArgGlu
505560
IleArgLysLeuGlnLysSerValLysLeuLeuIleProPheAlaPro
65707580
PheValArgIleValLysGluIleSerAsnPheTyrSerLysAspVal
859095
SerArgTrpAlaAlaGluAlaLeuLeuAlaLeuGlnGluAlaAlaGlu
100105110
SerHisLeuGlnGluLeuPheAlaAspAlaAsnLeuCysAlaIleHis
115120125
AlaLysArgValThrLeuMetGlnLysAspIleGlnLeuAlaArgArg
130135140
IleGlyGlyGlnArgThrTrp
145150
<210>3
<211>20
<212>PRT
<213> artificial sequence
<400>3
MetAlaArgThrLysHisPheSerAsnLysProSerSerArgSerLys
151015
LysArgLeuGln
20
Claims (3)
1. pineapple function kinetochore antigenic peptide, is characterized in that, aminoacid sequence is MARTKHFSNKPSSRSKKRLQ.
2. pineapple function kinetochore according to claim 1 antigenic peptide, it is characterized in that: described antigenic peptide is the polypeptide that the one section of distinguished sequence held according to pineapple function kinetochore CENH3 protein amino acid sequence N synthesizes, and pineapple function kinetochore CENH3 protein amino acid sequence is as shown in SEQIDNO.2; Encode the gene of described pineapple function kinetochore histone CENH3, its nucleotides sequence is classified as shown in SEQIDNO.1.
3. a pineapple function kinetochore as claimed in claim 1 antigenic peptide is used for antibody preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510950637.1A CN105418740B (en) | 2015-12-19 | 2015-12-19 | Pineapple function centromere antigen polypeptide and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510950637.1A CN105418740B (en) | 2015-12-19 | 2015-12-19 | Pineapple function centromere antigen polypeptide and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105418740A true CN105418740A (en) | 2016-03-23 |
| CN105418740B CN105418740B (en) | 2019-03-12 |
Family
ID=55497334
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510950637.1A Expired - Fee Related CN105418740B (en) | 2015-12-19 | 2015-12-19 | Pineapple function centromere antigen polypeptide and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105418740B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111410683A (en) * | 2020-03-10 | 2020-07-14 | 南京林业大学 | Antigenic polypeptide of poplar functional centromere histone CENH3 and application thereof |
| CN114957421A (en) * | 2022-05-06 | 2022-08-30 | 南京农业大学 | Antigen polypeptide of cucumber functional centromere histone CENH3 and application thereof |
-
2015
- 2015-12-19 CN CN201510950637.1A patent/CN105418740B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111410683A (en) * | 2020-03-10 | 2020-07-14 | 南京林业大学 | Antigenic polypeptide of poplar functional centromere histone CENH3 and application thereof |
| CN114957421A (en) * | 2022-05-06 | 2022-08-30 | 南京农业大学 | Antigen polypeptide of cucumber functional centromere histone CENH3 and application thereof |
| CN114957421B (en) * | 2022-05-06 | 2023-06-09 | 南京农业大学 | Antigen polypeptide of cucumber functional centromere histone CENH3 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105418740B (en) | 2019-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sheynkman et al. | Proteogenomics: integrating next-generation sequencing and mass spectrometry to characterize human proteomic variation | |
| US8841419B2 (en) | Hybridoma cell line 10G4 and a monoclonal antibody against the total of aflatoxin B1, B2, G1 and G2 | |
| Carpentier et al. | Functional genomics in a non‐model crop: transcriptomics or proteomics? | |
| JPH05508701A (en) | Methods for identifying ligands that bind to analytes | |
| Hinata et al. | Evolutionary aspects of the S-related genes of the Brassica self-incompatibility system: synonymous and nonsynonymous base substitutions. | |
| CN110003333A (en) | Polypeptide, PD-L1 single-domain antibody, nucleotide sequence and kit | |
| CN110003329A (en) | Polypeptide, IL17A/F single domain antibody, nucleotide sequence and kit | |
| CN105418740A (en) | Pineapple function centromere antigenic polypeptide and application thereof | |
| CN112415195A (en) | Kit for detecting novel coronavirus double targets and application thereof | |
| Kersten et al. | Protein microarray technology and ultraviolet crosslinking combined with mass spectrometry for the analysis of protein–DNA interactions | |
| CN105925599A (en) | Preparation method of high-purity monoclonal antibodies, monoclonal antibodies and applications of monoclonal antibodies | |
| CN110003337B (en) | IL17RA single domain antibody, nucleic acid and kit | |
| LaRoche et al. | Cloning and nucleotide sequence of a cDNA encoding a major fucoxanthin-, chlorophyll a/c-containing protein from the chrysophyte Isochrysis galbana: implications for evolution of the cab gene family | |
| CN105399805A (en) | Pawpaw functional centromere antigen polypeptide, and applications thereof | |
| CN105461789A (en) | Brachypodium distachyon functional centromere antigen polypeptide and application | |
| WO2014152660A1 (en) | Engineered antibody scaffolds | |
| Pozo et al. | APPRIS principal isoforms and MANE Select transcripts define reference splice variants | |
| CN105189753B (en) | DNA aptamers combination histidine tags and its application | |
| Baggs et al. | Convergent gene loss in aquatic plants predicts new components of plant immunity and drought response | |
| Colas et al. | Mass spectrometry in plant proteomic analysis | |
| CN104774923A (en) | Method for determining transcriptional control complex | |
| Finger et al. | Biosynthesis and structure of Paramecium hybrid antigen | |
| Zhu et al. | Modeling of kiwifruit metallothionein kiwi503 | |
| CN103254294A (en) | CD34-SG17 polypeptide fragment as well as preparation method and application thereof | |
| CN103033617B (en) | Tumor marker detection kit based on variable lymphocyte receptors and method for preparing same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190312 Termination date: 20211219 |