CN105368851A - Omega-3 desaturase from Phytophthora nicotianae, vector containing desaturase, recombinant microorganism and their application - Google Patents

Abstract

The invention relates to a recombinant nucleotide sequence as shown in SEQ ID NO. 3 and used for encoding Omega-3 desaturase from Phytophthora nicotianae, a vector containing the Omega-3 desaturase, and a recombinant microorganism containing the vector, in particular recombinant Saccharomyces cerevisiae and also relates to a construction method of the recombinant Saccharomyces cerevisiae as well as application of the Saccharomyces cerevisiae containing the desaturase in the biological synthesis of polyunsaturated fatty acids. The Saccharomyces cerevisiae can catalyze C20:4<Delta5,8,11,14> into C20:5<Delta5,8,11,14,17> at normal temperature, with catalytic efficiency up to 65%.

Description

A kind of derive from phytophthora parasitica ω-3 desaturase, carrier containing described desaturase, recombinant microorganism and application thereof

[technical field]

The invention belongs to technical field of bioengineering, relate to and utilize Microbe synthesis polyunsaturated fatty acid, be specifically related to a kind of ω-3 desaturase for the synthesis of polyunsaturated fatty acid, containing the described carrier of ω-3 desaturase, the recombinant microorganism containing described carrier and application thereof.

[background technology]

Long chain polyunsaturated fatty acids (LC-PUFAs) refers to the polyunsaturated fatty acid containing more than 20 or 20 carbon atoms, and the position of holding according to first double bond distance C can be divided into ω-6 and ω-3 liang of classes.ω-3LC-PUFAs cannot synthesize voluntarily in human body, needs to obtain from diet, belongs to indispensable fatty acid, as EPA and DHA.Research finds, as the precursor substance of some hormone of synthesis, can have multiple physiological function and potential pharmaceutical use using the ω-3LC-PUFAs that EPA and DHA is representative.Up to now, the source of ω-3LC-PUFAs based on abyssal pelagic fishes, but the LC-PUFAs therefrom extracted but existence and stability is poor, purifying process is complicated, the shortcoming such as oxidizable.In recent years, microorganism is just being subject to paying close attention to more and more widely as a kind of new LC-PUFAs source: marine algae is grown by autotrophy, heterotrophism and mixotrophic mode, growth cycle is short, is the primary producer of EPA and DHA, is also one of most potential source of ω-3LC-PUFAs; The research cost such as yeast, mould is low, be applicable to scale operation and genetic background is detailed, has the potentiality of producing multiple LC-PUFAs.Along with the develop rapidly of molecular biology and biotechnology, increasing sight has been invested produce oil fungi by people, to producing EPA, DHA by genetic engineering modified thalline fatty acid synthetic pathway, but due to reasons such as inefficiencies, still unrealized commercialization so far.

Occurring in nature ω-3LC-PUFAs, usually by the initial synthesis of LA and ALA, through a series of desaturase and extending enzyme catalysis, finally forms EPA and DHA.Wherein, ω-3 desaturase is one of key enzyme in ω-3LC-PUFAs building-up process, there is the structural domain that three are rich in Histidine, can by omega 6 polyunsaturated fatty acid as LA (C18:2), GLA (C18:3), DGLA (C20:3) and ARA (C20:4) catalysis generation is corresponding respectively omega-3 polyunsaturated fatty acids ALA (C18:3), SDA (C18:4), ETA (C20:4) and EPA (C20:5).

Research finds, the lipid acid of ω-3 desaturase to different carbon chain lengths of different sources has different catalytic efficiencies.At present, known ω-3 desaturase deriving from algae and plant can only the omega 6 polyunsaturated fatty acid of catalysis 18C as LA and GLA.ω-3 desaturase FAT1 deriving from Caenorhabditis elegans then can simultaneously with the polyunsaturated fatty acid of 18C and 20C for substrate, but wherein very low to the catalytic activity of 20C substrate.Subsequently, the people such as Pereira find that the polyunsaturated fatty acid of omega-fatty acid desaturase sdd17 to 18C deriving from different branch water mold does not have catalytic activity, and can be but EPA by the ARA catalysis of 20C, transformation efficiency be 25.9%.Same, ω-3 desaturase OPIN17 deriving from phytophthora infestans with the polyunsaturated fatty acid of 18C for substrate, but can not reach 30.94% to the transformation efficiency of ARA.

In recent years, the people such as Xue are mould from melon and fruit corruption, isolate three kinds of ω-3 desaturases soyabean phytophthora, robur sudden death pathogen---and PaD17, PsD17 and PrD17 also separate in fat yeast in restructuring and realize heterogenous expression (Identificationandcharacterizationofnew Δ-17fattyaciddesaturases, ApplMicrobiolBiotechnol (2013) 97:1973 – 1985).These three kinds of enzymes can catalysis 18C again can the polyunsaturated fatty acid of catalysis 20C, but preference catalysis 20C substrate A RA.By finding the further research of these preference catalysis 20C desaturase, it has higher transformation efficiency to ARA at normal temperatures, achieves biological accumulation EPA under normal temperature.This class preference with 20C ω-6LC-PUFAs for substrate catalyze and synthesize ω-3LC-PUFAs desaturase can directly, efficiently catalysis ARA generate EPA, providing substrate for catalyzing and synthesizing DHA by extending enzyme, ω-3LC-PUFAs tool being produced for biological synthesis process and is of great significance.In order to enhance productivity, the desaturase screening this kind of efficient catalytic ARA synthesis EPA seems particularly important.This is by the engineering bacteria for building high yield ω-3LC-PUFAs, and normal temperature fermentation produces EPA, DHA, lays a solid foundation.

[summary of the invention]

The object of the invention is the method utilizing information biology, obtain ω-3 desaturase of some normal temperature preference 20C, by building recombinant bacterial strain, the ability each ω-3 desaturase catalysis ARA being generated to EPA is identified, to obtain the desaturase that the efficient catalytic 20C ω-6LC-PUFAs most with important application potentiality synthesizes ω-3LC-PUFAs.

Thinking of the present invention is compared at ω-3 desaturase sequence of 5 kinds of known normal temperature preference 20C, according to sequence similarity and homology analysis, filter out high with known array similarity, that affinity the is near gene order from phytophthora parasitica as SEQIDNO.1 and the gene order SEQIDNO.5 from fungi medium silk capsule bacterium.Utilize ClustalW2 software ω-3 desaturase sequence of its aminoacid sequence and multiple known normal temperature preference 20C to be compared, find that natural gene order such as the SEQIDNO.1 from phytophthora parasitica has 3 the His-box districts similar to known array with the gene order SEQIDNO.5 from fungi medium silk capsule bacterium.By the selected sequence of TMHMM software analysis result display, there is the membrane-spanning domain similar to known array, carry out activity checking subsequently.

Further, the present invention utilizes full genome synthetic technology to construct two sections of ω-3 desaturase sequences through optimizing: the oPpFADS17 as SEQIDNO.3 and the oAiFADS17 as SEQIDNO.7.Round pcr is used to amplify goal gene fragment, insert PYES2/NTC expression vector obtain PYES2/NTC-oPpFADS17 and PYES2/NTC-oAiFADS17 and complete sequence verification, and then being transformed into yeast saccharomyces cerevisiae INVSc1 with chemical method, the recombinant strain obtained can express the albumen of two fragment gene codings smoothly.The polyunsaturated fatty acid substrate adding different carbon chain lengths finally by external source carries out activity checking, determines that oPpFADS17, oAiFADS17 sequence of screening has ω-3 desaturase active.

The invention provides the encoding sequence of ω-3 desaturase with specific catalytic 20C ability, its nucleotide sequence is respectively as SEQIDNO.3 and SEQIDNO.7.

The present invention also provides expression vector PUC57-oPpFADS17 and PUC57-oAiFADS17 respectively containing SEQIDNO.3 and SEQIDNO.7 nucleotide sequence, can express ω-3 desaturase of phytophthora parasitica and fungi medium silk capsule bacterium respectively.

The present invention also provides the recombinant microorganism of ω-3 desaturase can expressing phytophthora parasitica and fungi medium silk capsule bacterium respectively.Preferably, described recombinant microorganism is yeast saccharomyces cerevisiae.

ω-3 desaturase oPpFADS17 and oAiFADS17 that successful expression of the present invention derives from phytophthora parasitica and fungi medium silk capsule bacterium, plays a crucial role in polyunsaturated fatty acid biosynthetic pathway, its aminoacid sequence is respectively as SEQIDNO.4 and SEQIDNO.8.

The invention still further relates to the purposes of above-mentioned ω-3 desaturase oPpFADS17 and oAiFADS17 in polyunsaturated fatty acid biosynthesizing, particularly at normal temperatures by C20:4 ^{Δ 5,8,11,14}catalysis is C20:5 ^{Δ 5,8,11,14,17}.

The present invention by experiment method obtain two kinds of ω-3 desaturases can catalysis 18C again can the polyunsaturated fatty acid of catalysis 20C, but prefer to the ARA of 20C be converted into EPA, catalytic efficiency reaches 65%.Be that follow-up suitability for industrialized production EPA, DHA have established application foundation with this gene constructed engineering strain.

[accompanying drawing explanation]

Fig. 1 is the goal gene fragment figure of pcr amplification;

Wherein M is nucleic acid Marker; Swimming lane 1 is oPaFADS17 gene fragment (1080bp); Swimming lane 2 is oPpFADS17 gene fragment (1086bp); Swimming lane 3 is oAiFADS17 gene fragment (1095bp);

Fig. 2 is the agarose gel electrophoresis figure of the sub-PCR qualification of yeast saccharomyces cerevisiae recombinant conversion;

Wherein M is nucleic acid Marker; Swimming lane 1 is the carrier containing empty plasmid; Swimming lane 2-4 is 1,2, No. 3 transformant of INVSc1-oPaFADS17; Swimming lane 5-7 is 1,2, No. 3 transformant of INVSc1-oPpFADS17; Swimming lane 8-10 is 1,2, No. 3 transformant of INVSc1-oAiFADS17;

Fig. 3 is the transcriptional level of each ω-3 desaturase transformant;

Fig. 4 is each ω-3 desaturase transformant vapor detection figure;

A is INVSc1-oPpFADS17 vapor detection figure;

B is INVSc1-oAiFADS17 vapor detection figure;

C is INVSc1-oPaFADS17 vapor detection figure;

[embodiment]

Following examples are used for explaining technical scheme of the present invention without limitation.

Embodiment 1: the determination of ω-3 desaturase of normal temperature preference 20C

ω-3 desaturase sequence (gene OPIN17, sdd17, PsD17, PrD17 and PaD17) of 5 kinds of known normal temperature preference 20C is compared in NCBI library, according to sequence similarity and homology analysis, filter out ω-3 desaturase gene order that two kinds high with known array similarity, affinity is near, come from phytophthora parasitica, fungi medium silk capsule bacterium respectively, the gene numbering of its correspondence is respectively XM_008906963, XM_008870610.NCBI library all belongs to fatty acid desaturase family to the annotation of these two sections of sequences, but does not do detailed annotation to its concrete function.

By ClustalW2 software, ω-3 desaturase sequence of the coding region sequence of above two fragment genes and aforementioned 5 kinds of known preference 20C is carried out protein ratio pair, find that above two sections of sequences have 3 the His-box districts similar to known array, the i.e. common ground of all ω-3 desaturases, its similar His-box district protein sequence is in table 1.Find that above two sections of sequences have the membrane-spanning domain similar to known array by TMHMM software analysis.

3 His-box aminoacid sequences of ω-3 desaturase of preference 20C under table 1 normal temperature

Embodiment 2: the structure of recombinant expression vector

1, goal gene is obtained

Owing to deriving from phytophthora parasitica, fungi medium silk capsule bacterium and the rotten mould gene order codon usage bias of melon and fruit are different from host's yeast saccharomyces cerevisiae, so according to Eukaryotic codon usage bias, GenscriptOptimumGeneTMsystem is utilized to carry out codon optimized to its nucleotide sequence, distinguish the gene order oPpFADS17 after synthetic optimization, oAiFADS17 and oPaFADS17 (for positive control), as SEQIDNO.3, SEQIDNO.7 and SEQIDNO.11, then PUC57-oPpFADS17 is connected to obtain with PUC57-simple carrier respectively, PUC57-oAiFADS17 and PUC57-oPaFADS17, be kept in intestinal bacteria Top10 and (buy from Nanjing of China Jin Sirui company).

According to oPpFADS17, oAiFADS17 and oPaFADS17, primers, often pair of primer adds restriction enzyme site EcoRI and XhoI (underscore place).With plasmid PUC57-oPpFADS17, PUC57-oAiFADS17 and the PUC57-oPaFADS17 respectively containing above optimized gene for template, answer primer with often kind of gene pairs, KOD exo+ polymerase, obtain goal gene fragment by pcr amplification.PCR program is: 94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C of 1.5min, 30 circulations, 68 DEG C of 10min, and carries out purifying to PCR primer, and the purified product agarose gel electrophoresis of 1.0% is verified.Result is as Fig. 1.

Primer sequence for amplifying target genes is as follows:

oPpFADS17FctaattgaattcATGGCAACCAAGCAAGC

oPpFADS17RcgattctcgagTTAAGTTGACTTGGTTTTAACAGCG

oAiFADS17FacaatggaattcATGCCATCCCCTAAAGCCAC

oAiFADS17RcctgatctcgagTTATAAGGTCTTTTTAACTGAGTTTGCTCT

oPaFADS17FcatgtagaattcATGGCTTCGTCCACCGTTG

oPaFADS17RttacgactcgagTTAGTTAGCCTTGGTCTTGGCAG

2, endonuclease reaction:

Under 37 DEG C of conditions, endonuclease reaction is carried out with restriction enzyme EcoRI and XhoI double digestion goal gene fragment and carrier PYES2/NTC, enzyme cuts system (100 μ L): 2 μ LEcoRI, 2 μ LXhoI, 30 μ L goal gene/carriers, 10 μ LcutsmartBuffer, 56 μ L deionized waters, hatch 12h for 37 DEG C.After digestion products ThermoScientificGeneJETgelextractionkit test kit carries out glue recovery, be stored in-20 DEG C stand-by.

Wherein, restriction endonuclease damping fluid 10 × cutsmartBuffer:500mM potassium acetate, 200mMTris-acetate buffer, 100mM magnesium acetate, 1000 μ g/mL bovine serum albumins, pH7.9.

3, ligation:

The goal gene fragment oPpFADS17 after purifying, oAiFADS17, oPaFADS17 and carrier PYES2/NTC is connected respectively with T4 ligase enzyme, hatch 12h for 4 DEG C, linked system is: PYES2/NTC carrier (50ng/ μ L) 1 μ L, gene fragment 75-150ng, buffer1 μ L, T4 ligase enzyme 1 μ L, moisturizing to 10 μ L.

Wherein, 10 × ligase enzyme buffer:660mMTris-hydrochloride buffer (pH7.6), 66mM magnesium chloride, 100mM bis-sulphur threose, 1mM Triphosaden.

4, transformation of E. coli TOP10 competent cell:

Method for transformation is as follows:

1) get 100 μ L competent cells under sterile state, add 1-2 μ L and connect product, pressure-vaccum mixes.

2) competent cell in above-mentioned steps is moved in electric revolving cup, avoid producing bubble.

3) electric revolving cup is put into Bio-Rad electroporation, be transferred to desired preset program gear, use operation instructions to carry out electricity according to instrument and transform, voltage conditions is 1.8kv.

4) move in the centrifuge tube containing 1mLSOC recovery medium by the competent cell after conversion, 37 DEG C, 150rpm hatches 1h.

5) getting 200 μ L, to coat LB solid medium containing 100 μ g/mL ammonia benzyl mycins dull and stereotyped.Be inverted 37 DEG C of overnight incubation.

Picking positive transformant, extract plasmid and check order, sequencing result mates completely with gene order, shows successful connection, obtains expression vector, respectively called after PYES2/NTC-oPpFADS17, PYES2/NTC-oAiFADS17, PYES2/NTC-oPaFADS17.

Wherein, consisting of of SOC recovery medium: 20g/L Tryptones, 5g/L yeast extract, 0.5g/L sodium-chlor, 2.5mM Repone K, 10mM magnesium chloride, 20mM glucose.

The composition of LB solid medium is: 10g/L Tryptones, 5g/L yeast extract, 10g/L sodium-chlor, 20g/L agar.

Picking yeast saccharomyces cerevisiae INVSc1 (purchased from American hero company) is cloned in 10mLYPD substratum, 30 DEG C of incubated overnight.Survey OD600, a certain amount of bacterium liquid of transferring makes OD value be 0.4 in 50mL substratum, continues to cultivate 2-4h.2500rpm centrifugal 3min, 40mL1 × TE is resuspended.2500rpm centrifugal 3min, 2mL1 × LiAc/0.5XTE is resuspended, incubated at room 10min.

Each transformant of embodiment 2 is got to the sterilised yeast suspension of 100 μ l previous steps, add 1 μ g recombinant expression vector plasmid DNA and 100 μ g salmons essence carrier DNA.In order to obtain best transformation efficiency, repeat to carry out denaturing treatment to carrier DNA, boiling water bath 2min, ice bath 2min, quadruplication before each conversion.Add 700 μ l1 × LiAc/40wt%PEG-3350/1 × TE, mixing.Hatch 30min for 30 DEG C.Add 88 μ lDMSO, mixing, 42 DEG C of shock 7min.Centrifugal 10s, removes supernatant.Add 1mL1 × TE resuspended, recentrifuge.The resuspended thalline of 50-100 μ l1 × TE, is applied to SC and selects to support on base flat board.Cultivate 2-5d for 30 DEG C.

Wherein 1 × TE:10mMTris-hydrochloride buffer (PH=8.0), 1mM ethylenediamine tetraacetic thanomin (PH=8.0); 1 × LiAc:10mM Lithium Acetate.

YPD substratum consists of: 10g/L yeast extract, 20g/L peptone, 20g/L glucose.

Wherein SC Selective agar medium is: 6.7g/L yeast nitrogen (having ammonium sulfate without amino acid), 20g/L glucose, and 0.1g/L (is respectively VITAMIN B4, arginine, halfcystine, leucine, Methionin, Threonine, tryptophane), 0.05g/L (is respectively aspartic acid, Histidine, Isoleucine, methionine(Met), phenylalanine, proline(Pro), Serine, tyrosine and α-amino-isovaleric acid), 20g/L agar powder.

The PCR checking of experimental example 4, Saccharomyces cerevisiae transformant

The colony inoculation good from picking growth conditions flat board contains in the YPD substratum of ammonia benzyl resistance to 5mL, 30 DEG C of 200rpm cultivate 48h, with plasmid extraction test kit (purchased from Tian Gen company) extracting plasmid, measure A260nm and A280nm value, calculate the concentration of plasmid, cryopreservation.

PCR qualification is carried out with corresponding primer.Primer is as follows:

T7TAATACGACTCACTATAGGG

T7terminatorTCGGTTAGAGCGGATGTG

PCR reaction system is as follows: ddH ₂o7 μ L, 10 × TaqMIX10 μ L, universal primer T71 μ L, universal primer T7terminator1 μ L, template (plasmid) 1 μ L.PCR reaction conditions: 94 DEG C of 5min, 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1.5min, 30 circulations, 72 DEG C of 7min.Get 3 μ LPCR products after amplified reaction terminates and carry out 1wt% agarose gel electrophoresis, detect PCR primer stripe size, as shown in Figure 2.

Each gene obtains 3 transformants respectively as seen from Figure 2.Recombinant conversion called after INVSc1-oPpFADS171-3, INVSc1-oAiFADS171-3 and INVSc1-oPaFADS171-3 respectively, in the preservation of 30wt% glycerine pipe.Do not insert the PYES2/NTC empty carrier of gene fragment as negative control group.

Experimental example 5: the sub-inducing culture of Saccharomyces cerevisiae transformant

Single colony inoculation on the sub-flat board of picking Saccharomyces cerevisiae transformant, in seed culture medium SC-U, is cultivated 48h for 28 DEG C, is measured OD ₆₀₀value.Transfer into inducing culture, make OD value reach 0.4, external source adds the polyunsaturated fatty acid substrate of different carbon chain lengths simultaneously.Cultivate 48h for 28 DEG C, collect thalline.

Wherein seed culture medium SC-U is: 6.7g/L yeast nitrogen (having ammonium sulfate without amino acid), 20g/L glucose, and 0.1g/L (has VITAMIN B4 respectively, arginine, halfcystine, leucine, Methionin, Threonine, tryptophane and uridylic), 0.05g/L (has aspartic acid, Histidine, Isoleucine respectively, methionine(Met), phenylalanine, proline(Pro), Serine, tyrosine and α-amino-isovaleric acid).

Inducing culture is that the carbon source of seed culture medium is replaced by 10g/L raffinose, and adds 20g/L inductor semi-lactosi.

Experimental example 6: the transcriptional level of Saccharomyces cerevisiae transformant measures

Extract the sub-total serum IgE of Saccharomyces cerevisiae transformant, concrete steps are:

1) take out appropriate thalline frozen in liquid nitrogen, in precooling aseptic is without enzyme mortar, adds liquid nitrogen fully grinds.

2) add 1mLTRIzol (buying from American I nvitrogen company) to continue to be ground to powder, room temperature is placed to dissolving.

3) with drawing 1mL aforesaid liquid without enzyme rifle head in without in enzyme centrifuge tube, 200 μ L trichloromethane mixings are added.

4) 12000rpm4 DEG C of centrifugal 15min, suct clearly in new without in enzyme centrifuge tube.

5) add 200 μ L trichloromethanes mixings, 12000rpm4 DEG C of centrifugal 15min, suct clearly in new without in enzyme centrifuge tube.

6) add isopyknic Virahol, leave standstill 15min, 12000rpm4 DEG C of centrifugal 15min.Abandon supernatant, room temperature is dried.

7) 1mL70vol% ethanol is added, 12000rpm4 DEG C of centrifugal 15min.Suck ethanol with without enzyme rifle head, room temperature is placed dry.

8) 50 μ L are added without enzyme water dissolution RNA ,-80 DEG C of storages.

9) concentration determination: get 1 μ LRNA NaNodrop2000 and measure concentration.

10) sex change gel electrophoresis detects RNA integrity: get 1 μ gRNA electrophoresis in the sex change glue of 1.2wt%, observes RNA integrity.

According to oPpFADS17, oAiFADS17, oPaFADS17 gene order and yeast saccharomyces cerevisiae internal reference 18SrDNA sequences Design qRT-PCR primer:

q-oPpFADS17FGGCAACCAAGCAAGCCTATGTA

q-oPpFADS17RGCTAAGGCAACTGCAATTACCAAAC

q-oAiFADS17FTACTACTTCGCTCCATTGTTCGTTT

q-oAiFADS17RCAACCGTAGGATCTATCAACTGAAG

q-oPaFADS17FCTTCGTCCACCGTTGCTG

q-oPaFADS17RAGCCAGCGATTCCGAGA

18S-FAATCATCAAAGAGTCCGAAGACATTG

18S-RCCTTTACTACATGGTATAACTGTGG

Getting 0.5-1 μ g total serum IgE is template, illustrates and operates, obtain the cDNA of recombinant bacterial strain according to PrimeScriptRTreagentkit (purchased from Japanese TaKaRa company) test kit.ABI-Prism7900sequencedetectionsystem (AppliedBiosystems, CA) is used to carry out RT-qPCR reaction according to the explanation of SYBRGreenPCRMasterMix (AppliedBiosystems, CA).

Reaction system is: 10 μ lSYBRGreenPCRMasterMix, each 0.5 μ l of each gene upstream and downstream primer, 8 μ l without enzyme water, 1 μ l template.It is 50 DEG C of 2min that PCR is circularly set, 95 DEG C of 10min, 95 DEG C of 15s, 60 DEG C of 30s, 40 circulations.The 18SrRNA of yeast saccharomyces cerevisiae is as reference gene.

According to 2 ^{-Δ Δ Ct}method calculates the relative transcript levels of gene, and wherein all samples surveys three repetitions, wherein: Δ Δ Ct=Δ Ct (sample)-Δ Ct (contrast)

Result as shown in Figure 3.Analyze and find, each gene transformants comparatively control group, Δ Δ Ct value all reaches about 10, proves that the expression amount of this gene there occurs the change of growing out of nothing, and shows all successfully to transcribe in host strain.

Experimental example 7: the protein expression of yeast saccharomyces cerevisiae measures

With identical condition, after heterogeneic different transformant is induced respectively, extract total protein of cell with the broken thalline of 0.5mm pickling glass pearl.

After measuring protein concentration by BSA method, carry out SDS-PAGE electrophoresis with the applied sample amount of 100 μ g total proteins, be separated completely to Marker.

In Bio-Rad electrophoresis apparatus by the protein delivery in protein gelatin on pvdf membrane.Transferring film condition is 20mA, spends the night.

After transferring film completes, pvdf membrane is immersed in TBST damping fluid, incubated at room 10min on horizontal shaker.In triplicate.

Pvdf membrane is immersed in the TBST damping fluid containing 5wt% skimming milk, incubated at room 90min on horizontal shaker.

Pvdf membrane to be immersed in TBST damping fluid incubated at room 10min on horizontal shaker.In triplicate.

During anti-His primary antibodie is dissolved in containing 5wt% skimming milk TBST damping fluid with the ratio of 1:5000, horizontal shaker hatches 1h.

Pvdf membrane to be immersed in TBST damping fluid incubated at room 10min on horizontal shaker.In triplicate.

Anti-for the sheep anti mouse two TBST buffer level shaking table be dissolved in containing 5wt% skimming milk with the ratio of 1:10000 is hatched 1h.

Pvdf membrane to be immersed in TBST damping fluid incubated at room 10min on horizontal shaker.In triplicate.

Pvdf membrane ECL method is developed.Expose in western imager and take pictures.

Result shows, heterogeneic different transformant albumen is all expressed, and different transformant expressing quantity is almost consistent.

Wherein TBST damping fluid (1L) consists of: 8.8g sodium-chlor; 20mL1MTris-HCl pH of buffer 8.0; 0.5mL polysorbas20.

Embodiment 8: the extraction of yeast saccharomyces cerevisiae lipid acid

Comprise the following steps:

Collect the rear thalline of induction, vacuum lyophilization.

Fully grind, take 10mg and add 1mL10wt% methanol hydrochloride solution (methyl alcohol namely containing 10wt%HCl), interior mark (each 100 μ l of C15:0, C21:0), vibration mixing.60 DEG C of water-bath 3h, every 0.5h concussion once.

Add 1mL normal hexane and 1mL saturated sodium-chloride vibration mixing, the centrifugal 5min of 4000rpm.Get supernatant in clean bottle.

Get 1mL normal hexane and be added on former bottle, the centrifugal 5min of 4000rpm, get supernatant in above-mentioned new bottle.

Liquid N in new bottle ₂dry up.Add 1mL normal hexane, screw lid, vibration is dissolved, and obtains fatty acid methyl ester solution.

The analysis of gained fatty acid methyl ester adopts GC-MS (ShimadzuCo., Japan), and chromatographic column is Rtx-Wax (30m × 0.25mm, 0.25 μm).Carry out mass detector detection, vaporizing chamber and detector temperature are respectively 240 DEG C and 250 DEG C, and shunting mode sample introduction 1 μ L, splitting ratio 10:1, carrier gas is helium.

Temperature programming: initial temperature 40 DEG C keeps 5min, is raised to 150 DEG C, then is raised to 190 DEG C with 5 DEG C/min with 20 DEG C/min, keeps 5min, is finally raised to 220 DEG C with 5 DEG C/min, keeps 17min.By with fatty acid methyl ester standard substance (C15:0) retention time, peak area ratio to and mass spectrometry results, fatty acid component in qualitative, quantitative sample.

Embodiment 9: ω-3 desaturase activity identification of normal temperature preference 20C

In inducing culture, the ARA of interpolation three concentration gradient 0.05mM, 0.1mM, 0.2mM induces as substrate, collects thalline, and extract lipid acid, GC-MS determination of fatty acid result as shown in Figure 4.

Compared with Ctrl group, there is new peak in INVSc1-oPpFADS17, INVSc1-oAiFADS17, INVSc1-oPaFADS17 in 37.5min, by with the comparison of fatty acid methyl ester standard substance and mass spectroscopy, judge that this peak is as EPA.Concrete analysis the results are shown in Table 2

The catalytic efficiency of table 2 different ω-3 desaturase yeast saccharomyces cerevisiae recombinant conversion to ARA

The catalytic efficiency of three transformants to ARA of INVSc1-oPpFADS17 is the highest, wherein INVSc1-oPpFADS173 reaches 64.8%, 49.0%, 43.8% respectively under three concentration gradients, with the catalytic efficiency 69.7% of positive control INVSc1-oPaFADS17 under three concentration, 48.4%, 39.5% does not almost have difference, and absolute yield is better than each transformant of positive control further.

Especially, with the restructuring solution fat Yeast Phase ratio recorded in prior art <Identificationandcharacterizationofnew Δ-17fattyaciddesaturases>, INVSc1-oPpFADS17 transformant of the present invention is when realizing suitable catalytic conversion, substrate A RA concentration in inducing culture needed for it significantly reduces, particularly under 0.05mM, realize peak rate of conversion, and EPA output also improves further, demonstrate better EPA conversion capability.In addition, only containing Δ 9 fatty acid dehydrogenase in the expression vector yeast saccharomyces cerevisiae that the present invention uses, namely linolic acid and Zoomeric acid two kinds of monounsaturated fatty acids are only had in yeast saccharomyces cerevisiae, fat Yeast Phase ratio is separated with existing restructuring, recombinant Saccharomyces cerevisiae of the present invention can not disturb the polyunsaturated fatty acid route of synthesis that will utilize, and with His label on recombinant vectors of the present invention, be more conducive to the Purification and Characterization of following protein.

In addition, above data are found out, although with ω-3 desaturase gene order from phytophthora parasitica, ω-3 desaturase gene order from fungi medium silk capsule bacterium has the advantages that similarity is high, affinity is near, the recombinant bacterium obtained by constructed means can not play identical effect.Catalytic efficiency from the transformant INVSc1-oAiFADS17 of fungi medium silk capsule bacterium is relatively low, is respectively 46.3%, 33.5%, 23.9%.In order to verify the substrate of this few fragment gene whether preference catalysis 20C further, choose INVSc1-oPpFADS173, INVSc1-oAiFADS173 and INVSc1-oPaFADS171 tri-strain recombinant conversion sub, in inducing culture, add 0.2mMLA, GLA, DGLA, ARA respectively and add 0.1mMLA and 0.1mMARA simultaneously and induce respectively, result is as table 3.

The table 328 DEG C catalytic efficiency of different ω-3 desaturation yeast saccharomyces cerevisiae recombinant conversion to different substrate

Analyze known, sub-INVSc1-oPpFADS173 and INVSc1-oAiFADS173 of recombinant conversion, the transformation efficiency of INVSc1-oPaFADS171 to 20C substrate are significantly higher than 18C substrate, wherein particularly evident to the transformation efficiency of ARA.The transformation efficiency of INVSc1-oPpFADS173 to ARA is the highest, suitable with the transformation efficiency of positive control INVSc1-oPaFADS171, and output is then higher than positive control; In addition, the transformation efficiency of INVSc1-oPpFADS173 to the ω-6PUFAs beyond ARA is about the twice of positive control, illustrates that the efficiency of recombinant bacterium of the present invention synthesis ω-3PUFAs is apparently higher than positive control.

In order to ω-3 desaturase that proves to reach phytophthora parasitica normal temperature and comparatively under low temperature catalytic activity all higher, add 0.2mMLA, GLA, DGLA, ARA at inducing culture and add 0.1mMLA and 0.1mMARA simultaneously, induce under 12 DEG C of conditions, result is as table 4.

The table 412 DEG C catalytic efficiency of different ω-3 desaturation yeast saccharomyces cerevisiae recombinant conversion to different substrate

Show from the determination of fatty acid result of table 4, the transformation efficiency under different recombinant bacterium low temperature all decreases.But, the recombinant Saccharomyces cerevisiae bacterium can expressing phytophthora parasitica ω-3 desaturase in the present invention, compared with EPA transformation efficiency and the EPA output under low temperature with the recombinant Saccharomyces cerevisiae bacterium being significantly higher than ω-3 desaturase can expressing fungi medium silk capsule bacterium, is also better than EPA transformation efficiency and the EPA output of the recombinant Saccharomyces cerevisiae bacterium can expressing rotten mould ω-3 desaturase of melon and fruit.

In sum, ω-3 desaturase obtained by the present invention can catalysis 18C, again can the polyunsaturated fatty acid of catalysis 20C, but the ARA of 20C is converted into EPA by preference, and transformation efficiency is higher at normal temperatures, the efficiency of synthesizing ω-3PUFAs is in addition better than prior art further.Be that follow-up suitability for industrialized production EPA, DHA have established application foundation with this gene constructed engineering strain.

Although patent of the present invention with preferred embodiment openly as above, it is also not used to limit the present invention.Any person skilled in the art, without departing from the spirit and scope of the present invention, can do various change and modification.What therefore protection scope of the present invention should define with claims is as the criterion.

Claims (10)

1. as the recombinant nucleic acid sequence of coding phytophthora parasitica ω-3 desaturase of SEQIDNO.3.

2. the expression vector containing nucleic acid described in claim 1, is characterized in that ω 3 desaturase can expressing phytophthora parasitica.

3. expression vector according to claim 2, is characterized in that described carrier is PYES2/NTC-oPpFADS17.

4. expression vector according to claim 3, is characterized in that the primer of amplifying target genes is:

oPpFADS17F：ctaattgaattcATGGCAACCAAGCAAGC

oPpFADS17R：cgattctcgagTTAAGTTGACTTGGTTTTAACAGCG。

5. the recombinant microorganism containing expression vector described in Claims 2 or 3, is characterized in that described recombinant microorganism can express ω-3 desaturase of phytophthora parasitica.

6. recombinant microorganism according to claim 5, is characterized in that described recombinant microorganism is recombinant Saccharomyces cerevisiae bacterium.

7. the construction process of recombinant Saccharomyces cerevisiae bacterium according to claim 6, comprises the following steps:

(1) according to the codon usage bias of yeast saccharomyces cerevisiae, carry out codon optimized to the nucleotide sequence of phytophthora parasitica, synthetic is as the gene order oPpFADS17 after the optimization of SEQIDNO.3, then be connected to obtain recombinant plasmid PUC57-oPpFADS17 with PUC57-simple carrier, be kept in intestinal bacteria Top10;

(2) according to oPpFADS17 primers:

oPpFADS17F：ctaattgaattcATGGCAACCAAGCAAGC

oPpFADS17R：cgattctcgagTTAAGTTGACTTGGTTTTAACAGCG

With plasmid PUC57-oPpFADS17 for template, pcr amplification obtains goal gene fragment;

(3) after carrying out glue recovery with restriction enzyme EcoRI and XhoI double digestion goal gene fragment and carrier PYES2/NTC, digestion products ThermoScientificGeneJETgelextractionkit test kit, be stored in-20 DEG C stand-by; Connect the goal gene fragment oPpFADS17 after purifying and carrier PYES2/NTC with T4 ligase enzyme, hatch 12h for 4 DEG C, obtain recombinant expression vector plasmid PYES2/NTC-oPpFADS17;

(4) transformed saccharomyces cerevisiae INVSc1 obtains recombinant Saccharomyces cerevisiae bacterium.

8. construction process according to claim 7, it is characterized in that the reaction conditions of pcr amplification in step (2) is: 94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C of 1.5min, 30 circulations, 68 DEG C of 10min, and purifying is carried out to PCR primer, the purified product agarose gel electrophoresis of 1.0% is verified.

9. as the restructuring aminoacid sequence of coding phytophthora parasitica ω-3 desaturase of SEQIDNO.4.

10. the purposes of desaturase according to claim 7 in polyunsaturated fatty acid biosynthesizing, is characterized in that at normal temperatures by C20:4 ^{Δ 5,8,11,14}catalysis is C20:5 ^{Δ 5,8,11,14,17}, catalytic efficiency reaches 65%.