CN105368851B - It is a kind of from ω -3 desaturase of phytophthora parasitica, the carrier containing the desaturase, recombinant microorganism and its application - Google Patents

Abstract

The present invention relates to recombinant nucleic acid sequence, the carriers containing ω -3 desaturase, the especially recombinant Saccharomyces cerevisiae bacterium of the recombinant microorganism containing the carrier of coding phytophthora parasitica ω -3 desaturase of such as SEQ ID NO.3, further relate to the construction method of recombinant Saccharomyces cerevisiae bacterium, and purposes of the saccharomyces cerevisiae containing the desaturase in polyunsaturated fatty acid biosynthesis, it at normal temperature can be by C20:4^Δ5,8,11,14Catalysis is C20:5^{Δ5,8,11,14,17}, catalytic efficiency reaches 65%.

Description

A kind of ω -3 desaturase from phytophthora parasitica, the load containing the desaturase Body, recombinant microorganism and its application

[technical field]

The invention belongs to technical field of bioengineering, relate to the use of Microbe synthesis polyunsaturated fatty acid, and in particular to A kind of ω -3 desaturase for synthesizing polyunsaturated fatty acid, contains the load at the carrier containing ω -3 desaturase The recombinant microorganism of body and its application.

[background technique]

Long-chain polyunsaturated fatty acid (LC-PUFAs) refers to the how unsaturated rouge containing 20 or 20 or more carbon atoms Fat acid, the position according to first double bond apart from C-terminal can be divided into ω -6 and ω -3 liangs of class.ω -3LC-PUFAs nothing in human body Method voluntarily synthesizes, and needs to obtain from diet, belongs to essential fatty acid, such as EPA and DHA.The study found that using EPA and DHA as generation ω-the 3LC-PUFAs of table can be used as the precursor substance for synthesizing certain hormones, have the function of multiple physiological and potential medicinal valence Value.So far, the source of ω -3LC-PUFAs is based on abyssal fishes, however the LC-PUFAs therefrom extracted but has stabilization The disadvantages of property is poor, purifying process is complicated, oxidizable.In recent years, microorganism is as a kind of new source LC-PUFAs just by more Come more extensive concern: marine algae is grown by autotrophy, heterotrophism and mixotrophic mode, and growth cycle is short, be EPA and One of the primary producer of DHA and the most potential source ω -3LC-PUFAs；The research costs such as saccharomycete, mould are low, suitable Large-scale production and genetic background detail are closed, the potentiality for producing a variety of LC-PUFAs are possessed.With molecular biology and biological skill More and more sight have been invested oil-producing fungi by the rapid development of art, people, to which thallus fat is transformed by genetic engineering Sour synthesis path produces EPA, DHA, but due to low efficiency is inferior, and commercialization is still not implemented so far.

ω -3LC-PUFAs is usually synthesized by LA and ALA starting in nature, by a series of desaturases and extends enzyme Catalysis, ultimately forms EPA and DHA.Wherein, ω -3 desaturase is one of the key enzyme in ω -3LC-PUFAs synthesis process, Tool, can be by omega 6 polyunsaturated fatty acid such as LA (C18:2), GLA (C18:3), DGLA there are three the structural domain for being rich in histidine (C20:3) and ARA (C20:4) be catalyzed respectively generate corresponding omega-3 polyunsaturated fatty acids ALA (C18:3), SDA (C18: 4), ETA (C20:4) and EPA (C20:5).

The study found that ω -3 desaturase of separate sources there is different catalysis to imitate the fatty acid of different carbon chain lengths Rate.At present it is known that ω -3 desaturase from algae and plant can only be catalyzed the omega 6 polyunsaturated fatty acid of 18C such as LA and GLA.And it then can be simultaneously with the how unsaturated rouge of 18C and 20C from the ω -3 desaturase FAT 1 of Caenorhabditis elegans Fat acid is substrate, but wherein very low to the catalytic activity of 20C substrate.Then, Pereira et al. discovery is from different branch water mold Omega-fatty acid desaturase sdd17 does not have catalytic activity to the polyunsaturated fatty acid of 18C, but can be by the ARA of 20C catalysis EPA, conversion ratio 25.9%.Likewise, ω -3 desaturase the OPIN 17 from phytophthora infestans can not be with the more of 18C Unsaturated fatty acid is substrate, but has reached 30.94% to the conversion ratio of ARA.

In recent years, Xue et al. from melon and fruit corruption mould, soyabean phytophthora, that three kinds of ω -3 are isolated in robur sudden death pathogen is de- full And enzyme --- PaD 17, PsD 17 and PrD 17 simultaneously realize heterogenous expression (Identification in recombination solution rouge saccharomycete and characterization of newΔ-17fatty acid desaturases,Appl Microbiol Biotechnol(2013)97:1973–1985).These three enzymes can be catalyzed 18C but also be catalyzed the polyunsaturated fatty acid of 20C, But preference is catalyzed 20C substrate A RA.By to these preferences be catalyzed 20C desaturase further study show that, at normal temperature There is higher conversion ratio to ARA, realizes biological accumulation EPA under room temperature.This kind of preferences are using 20C ω -6LC-PUFAs substrate The desaturase for catalyzing and synthesizing ω -3LC-PUFAs can directly, efficiently be catalyzed ARA and generate EPA, for by extending enzymatic Synthesis DHA provides substrate, and biological synthesis process production ω -3LC-PUFAs is had a very important significance.In order to improve life Efficiency is produced, the desaturase for screening such efficient catalytic ARA synthesis EPA is particularly important.This will be building high yield ω -3LC- The engineering bacteria of PUFAs, normal temperature fermentation produce EPA, DHA, lay a solid foundation.

[summary of the invention]

The purpose of the present invention is the methods using bioinformatics, obtain ω -3 desaturase of some room temperature preference 20C, By constructing recombination engineering, each ω -3 desaturase catalysis ARA ability for generating EPA is identified, to obtain The most desaturase of the efficient catalytic 20C ω -6LC-PUFAs synthesis ω -3LC-PUFAs of important application potentiality.

Thinking of the invention is that the ω -3 desaturase sequence of room temperature preference 20C known to 5 kinds is compared, according to sequence Column similarity and homology analysis filter out the gene sequence from phytophthora parasitica close with known array similarity height, affinity Column such as the SEQ ID NO.1 and gene order SEQ ID NO.5 from fungi medium silk capsule bacterium.It will using Clustal W2 software Its amino acid sequence is compared with the ω -3 desaturase sequence of a variety of known room temperature preference 20C, finds natural come from The gene order of phytophthora parasitica such as SEQ ID NO.1 and gene order SEQ ID NO.5 from fungi medium silk capsule bacterium possess 3 areas His-box similar with known array.By the analysis of TMHMM software, selected sequence has and known array as the result is shown Similar transmembrane domain then carries out active verifying.

Further, the present invention constructs two sections of ω -3 desaturase sequences by optimization using full genome synthetic technology: OPpFADS17 such as the SEQ ID NO.3 and oAiFADS17 such as SEQ ID NO.7.Target gene is amplified using round pcr Segment, insertion PYES 2/NT C expression vector obtain PYES2/NT C-oPpFADS17 and PYES2/NT C-oAiFADS17 simultaneously Sequence verification is completed, and then is transformed into saccharomyces cerevisiae INVSc 1 with chemical method, obtained recombinant strain can smoothly express two The albumen of section gene coding.Activity is carried out finally by the polyunsaturated fatty acid substrate of external source addition different carbon chain lengths to test Card determines that oPpFADS17, oAiFADS17 sequence of screening have ω -3 desaturase activity.

The present invention provides the coded sequence with ω -3 desaturase of specific catalytic 20C ability, nucleic acid sequence point Not such as SEQ ID NO.3 and SEQ ID NO.7.

The present invention also provides the expression vector PUC57- respectively containing SEQ ID NO.3 and SEQ ID NO.7 nucleic acid sequence OPpFADS17 and PUC57-oAiFADS17 can express ω -3 desaturation of phytophthora parasitica and fungi medium silk capsule bacterium respectively Enzyme.

The present invention also provides the recombinations for ω -3 desaturase that can express phytophthora parasitica and fungi medium silk capsule bacterium respectively Microorganism.Preferably, the recombinant microorganism is saccharomyces cerevisiae.

Successful expression of the present invention from phytophthora parasitica and fungi medium silk capsule bacterium, in polyunsaturated fatty acid biology ω -3 the desaturase oPpFADS17 and oAiFADS17 to play a crucial role in route of synthesis, amino acid sequence is respectively such as SEQ ID NO.4 and SEQ ID NO.8.

The invention further relates to above-mentioned ω -3 desaturase oPpFADS17 and oAiFADS17 in polyunsaturated fatty acid biology Purposes in synthesis, especially at normal temperature by C20:4^Δ5,8,11,14Catalysis is C20:5^{Δ5,8,11,14,17}。

The present invention can be catalyzed 18C by experimental method two kinds of ω -3 desaturases of acquisition but also be catalyzed more insatiable hungers of 20C And fatty acid, but prefer to convert EPA for the ARA of 20C, catalytic efficiency reaches 65%.With this gene constructed genetic engineering bacterium Strain is that subsequent industrialized production EPA, DHA has established application foundation.

[Detailed description of the invention]

Fig. 1 is the target gene fragment figure of PCR amplification；

Wherein M is nucleic acid Marker；Swimming lane 1 is oPaFADS17 genetic fragment (1080bp)；Swimming lane 2 is oPpFADS17 base Because of segment (1086bp)；Swimming lane 3 is oAiFADS17 genetic fragment (1095bp)；

Fig. 2 is the agarose gel electrophoresis figure of the sub- PCR identification of saccharomyces cerevisiae recombinant conversion；

Wherein M is nucleic acid Marker；Swimming lane 1 is the carrier containing empty plasmid；Swimming lane 2-4 is INVSc 1-oPaFADS17's 1,2, No. 3 transformants；Swimming lane 5-7 is 1,2, No. 3 transformant of INVSc 1-oPpFADS17；Swimming lane 8-10 is INVSc 1- 1,2, No. 3 transformant of oAiFADS17；

Fig. 3 is the transcriptional level of each ω -3 desaturase transformant；

Fig. 4 is each ω -3 desaturase transformant vapor detection figure；

A is INVSc 1-oPpFADS17 vapor detection figure；

B is INVSc 1-oAiFADS17 vapor detection figure；

C is INVSc 1-oPaFADS17 vapor detection figure；

[specific embodiment]

Following embodiment for explaining technical solution of the present invention without limitation.

Embodiment 1: the determination of ω -3 desaturase of room temperature preference 20C

By the ω -3 desaturase sequence of room temperature preference 20C known to 5 kinds (gene OPIN 17, sdd 17, PsD 17, PrD 17 and PaD 17) be compared in the library NCBI, according to sequence similarity and homology analysis, filter out two kinds with Know the ω -3 desaturase gene order that sequence similarity is high, affinity is close, is respectively from phytophthora parasitica, fungi medium silk capsule Bacterium, corresponding gene number is respectively XM_008906963, XM_008870610.Annotation of the library NCBI to this two sections of sequences Fatty acid desaturase family is belonged to, but detailed annotation is not done to its concrete function.

By Clustal W2 software by preference 20C's known to the coding region sequence of above two sections of genes and aforementioned 5 kinds ω -3 desaturase sequence carries out albumen comparison, and the above two sections of sequences of discovery have 3 His-box similar with known array Area, i.e., the common ground of all ω -3 desaturases, the similar area His-box protein sequence are shown in Table 1.Pass through TMHMM software point The above two sections of sequences of analysis discovery have transmembrane domain similar with known array.

3 His-box amino acid sequences of ω -3 desaturase of preference 20C under 1 room temperature of table

Embodiment 2: the building of recombinant expression carrier

1, target gene is obtained

Due to from the rotten mould gene order codon usage bias of phytophthora parasitica, fungi medium silk capsule bacterium and melon and fruit Different from host's saccharomyces cerevisiae, so utilizing Genscript according to Eukaryotic codon usage bias OptimumGeneTM system carries out codon optimization to its nucleic acid sequence, respectively the gene order after artificial synthesized optimization OPpFADS17, oAiFADS17 and oPaFADS17 (for positive control), such as SEQ ID NO.3, SEQ ID NO.7 and SEQ ID Then NO.11 connect to obtain PUC57-oPpFADS17, PUC57-oAiFADS17 and PUC57- with PUC57-simple carrier respectively OPaFADS17, is stored in Escherichia coli Top10 and (buys from Nanjing of China Jin Sirui company).

According to oPpFADS17, oAiFADS17 and oPaFADS17, primers, each pair of primer adds restriction enzyme site EcoR I and Xho I (at underscore).To contain plasmid PUC57-oPpFADS17, PUC57- of the above optimization gene respectively OAiFADS17 and PUC57-oPaFADS17 is template, and with every kind of gene corresponding primer, KOD exo+ polymerase is expanded by PCR Increasing obtains target gene fragment.PCR program are as follows: 94 DEG C of 30s, 55 DEG C of 30s, 68 DEG C of 1.5min, 30 circulations, 68 DEG C of 10min, and PCR product is purified, purified product is verified with 1.0% agarose gel electrophoresis.As a result such as Fig. 1.

Primer sequence for amplifying target genes is as follows:

oPpFADS17F ctaattgaattcATGGCAACCAAGCAAGC

oPpFADS17R cgattctcgagTTAAGTTGACTTGGTTTTAACAGCG

oAiFADS17F acaatggaattcATGCCATCCCCTAAAGCCAC

oAiFADS17R cctgatctcgagTTATAAGGTCTTTTTAACTGAGTTTGCTCT

oPaFADS17F catgtagaattcATGGCTTCGTCCACCGTTG

oPaFADS17R ttacgactcgagTTAGTTAGCCTTGGTCTTGGCAG

2, endonuclease reaction:

Under the conditions of 37 DEG C, with restriction enzyme EcoR I and Xho I double digestion target gene fragment and carrier PYES2/NT C carries out endonuclease reaction, digestion system (100 μ L) are as follows: 2 μ L EcoR I, 2 μ L Xho I, 30 μ L target gene/load Body, 10 μ L cutsmart Buffer, 56 μ L deionized waters, 37 DEG C of incubation 12h.Digestion products Thermo Scientific After GeneJET gel extraction kit kit carries out glue recycling, it is stored in -20 DEG C for use.

Wherein, 10 × cutsmart of inscribe enzyme buffer liquid Buffer:500mM potassium acetate, 200mM Tris- acetate are slow Fliud flushing, 100mM magnesium acetate, 1000 μ g/mL bovine serum albumin(BSA)s, pH 7.9.

3, connection reaction:

With T4 ligase be separately connected target gene fragment oPpFADS17, oAiFADS17, oPaFADS17 after purification and Carrier PYES2/NT C, 4 DEG C of incubation 12h, linked system are as follows: PYES2/NT C carrier (50ng/ μ L) 1 μ L, genetic fragment 75- 1 μ L, T4 ligase of 150ng, buffer, 1 μ L, moisturizing to 10 μ L.

Wherein, 10 × ligase buffer:660mM Tris- hydrochloride buffer (pH 7.6), 66mM magnesium chloride, 100mM Two sulphur threoses, 1mM atriphos.

4,10 competent cell of Escherichia coli TOP is converted:

Method for transformation is as follows:

1) 100 μ L competent cells are taken under germ-free condition, 1-2 μ L connection product is added, and pressure-vaccum mixes.

2) competent cell in above-mentioned steps is moved into electric revolving cup, avoids generating bubble.

3) electric revolving cup is put into Bio-Rad electroporation, is transferred to desired preset program gear, operating instruction is used according to instrument Carry out electrotransformation, voltage conditions 1.8kv.

4) competent cell after conversion is moved in the centrifuge tube containing 1mL SOC recovery medium, 37 DEG C, 150rpm It is incubated for 1h.

5) 200 μ L is taken to be coated on the LB solid medium tablets containing 100 μ g/mL ammonia benzyl mycins.37 DEG C are inverted to cultivate Night.

Picking positive transformant extracts plasmid and is sequenced, and sequencing result and gene order exactly match, and shows to connect into Function obtains expression vector, is respectively designated as PYES2/NT C-oPpFADS17, PYES2/NT C-oAiFADS17, PYES2/NT C-oPaFADS17。

Wherein, the composition of SOC recovery medium are as follows: 20g/L tryptone, 5g/L yeast extract, 0.5g/L sodium chloride, 2.5mM potassium chloride, 10mM magnesium chloride, 20mM glucose.

The composition of LB solid medium is: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride, 20g/L fine jade Rouge.

One saccharomyces cerevisiae INVSc 1 of picking (being purchased from U.S. hero company) is cloned in 10mL YPD culture medium, 30 DEG C It is incubated overnight.OD600 is surveyed, a certain amount of bacterium solution of transferring makes OD value 0.4 in 50mL culture medium, continues to cultivate 2-4h.2500rpm from The heart 1 × TE of 3min, 40mL is resuspended.2500rpm is centrifuged 3min, and 1 × LiAc/0.5X of 2mL TE is resuspended, and is incubated at room temperature 10min.

The sterilised yeast suspension of 100 μ l previous steps is taken to each transformant of embodiment 2, and 1 μ g recombinant expression carrier plasmid is added DNA and 100 μ g salmon essence carrier DNA.In order to obtain optimal transformation efficiency, repeat to become carrier DNA before conversion every time Property processing, boiling water bath 2min, ice bath 2min, quadruplication.700 1 × LiAc/40wt%PEG-3350/1 of μ l × TE is added, mixes It is even.30 DEG C of incubation 30min.88 μ l DMSO are added, are mixed, 42 DEG C of shock 7min.It is centrifuged 10s, removes supernatant.1 × TE of 1mL is added It is resuspended, is centrifuged again.Thallus is resuspended in 50-100 1 × TE of μ l, is applied to SC and selects to support on base plate.30 DEG C of culture 2-5d.

Wherein 1 × TE:10mM Tris- hydrochloride buffer (PH=8.0), 1mM ethylenediamine tetraacetic ethanol amine (PH=8.0)；1 × LiAc:10mM lithium acetate.

YPD culture medium composition are as follows: 10g/L yeast extract, 20g/L peptone, 20g/L glucose.

Wherein SC Selective agar medium are as follows: 6.7g/L yeast nitrogen (no amino acid has ammonium sulfate), 20g/L glucose, 0.1g/ L (respectively adenine, arginine, cysteine, leucine, lysine, threonine, tryptophan), (the respectively day 0.05g/L Aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine and valine), 20g/L Agar powder.

The PCR verifying of experimental example 4, Saccharomyces cerevisiae transformant

The good colony inoculation of growth conditions is picked from the plate into the YPD culture medium of the 5mL resistance of benzyl containing ammonia, 30 DEG C 200rpm cultivates 48h, with plasmid extraction kit (being purchased from Tiangeng company) extracting plasmid, measures A 260nm and A 280nm value, Calculate the concentration of plasmid, cryo-conservation.

PCR identification is carried out with corresponding primer.Primer is as follows:

T7 TAATACGACTCACTATAGGG

T7 terminator TCGGTTAGAGCGGATGTG

PCR reaction system is as follows: dd H₂7 μ L, 10 × Taq MIX of O 10 μ L, 1 μ L of universal primer T7, universal primer 1 μ L of T7terminator, 1 μ L of template (plasmid).PCR reaction condition: 94 DEG C of 5min, 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C 1.5min, 30 circulations, 72 DEG C of 7min.3 μ L PCR products are taken to carry out 1wt% agarose gel electrophoresis after amplified reaction, PCR product stripe size is detected, as shown in Figure 2.

Each gene respectively obtains 3 transformants as seen from Figure 2.Recombinant conversion is respectively designated as INVSc 1- OPpFADS17 1-3, INVSc 1-oAiFADS17 1-3 and INVSc 1-oPaFADS17 1-3 are protected in 30wt% glycerol tube Hiding.The PYES2/NT C empty carrier of genetic fragment is not inserted into as negative control group.

Experimental example 5: the sub- Fiber differentiation of Saccharomyces cerevisiae transformant

Single colonie on the sub- plate of picking Saccharomyces cerevisiae transformant is inoculated in seed culture medium SC-U, 28 DEG C of culture 48h, measurement OD₆₀₀Value.It transfers into induced medium, OD value is made to reach 0.4, while the polyunsaturated fat of external source addition different carbon chain lengths Sour substrate.28 DEG C of culture 48h collect thallus.

Wherein seed culture medium SC-U are as follows: 6.7g/L yeast nitrogen (no amino acid has ammonium sulfate), 20g/L glucose, 0.1g/L (has adenine, arginine, cysteine, leucine, lysine, threonine, tryptophan and uracil) respectively, 0.05g/L (has aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine respectively And valine).

Induced medium is the carbon source of seed culture medium to be changed to 10g/L raffinose, and add 20g/L inducer gala Sugar.

Experimental example 6: the transcriptional level measurement of Saccharomyces cerevisiae transformant

Extract the sub- total serum IgE of Saccharomyces cerevisiae transformant, specific steps are as follows:

1) thallus frozen in liquid nitrogen in right amount is taken out, liquid nitrogen is added in the sterile no enzyme mortar of pre-cooling and is fully ground.

2) 1mL TRIzol (buying from Invitrogen company, the U.S.) is added to continue to be ground to powder, is placed at room temperature for molten Solution.

3) 1mL aforesaid liquid is drawn in no enzyme centrifuge tube with no enzyme pipette tips, 200 μ L chloroforms are added and mix.

4) 4 DEG C of centrifugation 15min of 12000rpm are sucted clearly in new no enzyme centrifuge tube.

5) 200 μ L chloroforms are added to mix, 4 DEG C of centrifugation 15min of 12000rpm are sucted clearly in new no enzyme centrifuge tube In.

6) isometric isopropanol is added, stands 15min, 4 DEG C of centrifugation 15min of 12000rpm.Supernatant is abandoned, room temperature is dried.

7) 1mL 70vol% ethyl alcohol, 4 DEG C of centrifugation 15min of 12000rpm are added.Ethyl alcohol is sucked with no enzyme pipette tips, room temperature is put Set drying.

8) 50 μ L are added and dissolve RNA, -80 DEG C of storages without enzyme water.

9) concentration mensuration: 1 μ L RNA is taken to measure concentration with NaNodrop 2000.

10) denaturation gel electrophoresis detects RNA integrality: taking 1 μ g RNA electrophoresis in the denaturation glue of 1.2wt%, observation RNA is complete Whole property.

It is set according to oPpFADS17, oAiFADS17, oPaFADS17 gene order and saccharomyces cerevisiae internal reference 18S rDNA sequence Count qRT-PCR primer:

q-oPpFADS17F GGCAACCAAGCAAGCCTATGTA

q-oPpFADS17R GCTAAGGCAACTGCAATTACCAAAC

q-oAiFADS17F TACTACTTCGCTCCATTGTTCGTTT

q-oAiFADS17R CAACCGTAGGATCTATCAACTGAAG

q-oPaFADS17F CTTCGTCCACCGTTGCTG

q-oPaFADS17R AGCCAGCGATTCCGAGA

18S-F AATCATCAAAGAGTCCGAAGACATTG

18S-R CCTTTACTACATGGTATAACTGTGG

Taking 0.5-1 μ g total serum IgE is template, (public purchased from Japan TaKaRa according to PrimeScript RT reagent kit Department) kit illustrates to be operated, obtain the cDNA of recombinant bacterial strain.Use ABI-Prism 7900sequence detection System (Applied Biosystems, CA) is according to SYBR Green PCR Master Mix (Applied Biosystems, CA) illustrate carry out RT-qPCR reaction.

Reaction system are as follows: 10 μ l SYBR Green PCR Master Mix, each each 0.5 μ l of gene upstream and downstream primer, 8 μ l Without enzyme water, 1 μ l template.PCR cycle is set as 50 DEG C of 2min, 95 DEG C of 10min, 95 DEG C of 15s, 60 DEG C of 30s, 40 circulations.Wine brewing The 18S rRNA of yeast is as reference gene.

According to 2^-ΔΔCtMethod calculates the relative transcript levels of gene, and wherein all samples survey three repetitions, in which: Δ Δ Ct =Δ Ct (sample)-Δ Ct (control)

As a result as shown in Figure 3.Analysis finds that each gene transformants reach 10 or so compared with control group, Δ Δ Ct value, it was demonstrated that The expression quantity of this gene is changed from scratch, shows successfully to transcribe in host strain.

Experimental example 7: the protein expression measurement of saccharomyces cerevisiae

With identical condition, after being induced respectively the different transformants of different genes, bacterium is crushed with 0.5mm pickling glass pearl Body extracts total protein of cell.

After measuring protein concentration with BSA method, SDS-PAGE electrophoresis is carried out with the applied sample amount of 100 μ g total proteins, until Marker It is kept completely separate.

It will be on the protein delivery to pvdf membrane in protein gel in Bio-Rad electrophoresis apparatus.Transferring film condition is 20mA, mistake Night.

After the completion of transferring film, pvdf membrane is immersed in TBST buffer, in being incubated at room temperature 10min on horizontal shaker.It repeats Three times.

Pvdf membrane is immersed in the TBST buffer of the skimmed milk containing 5wt%, in being incubated at room temperature 90min on horizontal shaker.

Pvdf membrane is immersed in TBST buffer in being incubated at room temperature 10min on horizontal shaker.In triplicate.

Anti- His primary antibody is dissolved in horizontal shaker in the TBST buffer containing 5wt% skimmed milk with the ratio of 1:5000 to incubate Educate 1h.

Pvdf membrane is immersed in TBST buffer in being incubated at room temperature 10min on horizontal shaker.In triplicate.

Sheep anti mouse secondary antibody is dissolved in the TBST buffer level shaking table containing 5wt% skimmed milk with the ratio of 1:10000 to incubate Educate 1h.

Pvdf membrane is immersed in TBST buffer in being incubated at room temperature 10min on horizontal shaker.In triplicate.

Pvdf membrane ECL method is developed.It exposes and takes pictures in western imager.

The result shows that the different transformant albumen of different genes are expressed, and different transformant expressing quantities are several It is consistent.

Wherein TBST buffer (1L) forms are as follows: 8.8g sodium chloride；20mL 1M Tris-HCl pH of buffer 8.0； 0.5mL polysorbas20.

Embodiment 8: the extraction of saccharomyces cerevisiae fatty acid

The following steps are included:

Collect thallus after inducing, vacuum freeze drying.

It is fully ground crushing, 10mg is weighed and 1mL 10wt% methanol hydrochloride solution is added (i.e. containing the first of 10wt%HCl Alcohol), internal standard (each 100 μ l of C15:0, C21:0), oscillation mixes.60 DEG C of water-bath 3h, it is primary every 0.5h concussion.

1mL n-hexane is added and the oscillation of 1mL saturated sodium-chloride mixes, 4000rpm is centrifuged 5min.Take supernatant to clean bottle In.

1mL n-hexane is taken to be added on former bottle, 4000rpm is centrifuged 5min, takes supernatant in above-mentioned new bottle.

Liquid N in new bottle₂Drying.1mL n-hexane is added, screws lid, it is molten to obtain fatty acid methyl ester for oscillation dissolution Liquid.

Gained fatty acid methyl ester analysis use GC-MS (Shimadzu Co., Japan), chromatographic column be Rtx-Wax (30m × 0.25mm, 0.25 μm).Mass detector detection is carried out, vaporizing chamber and detector temperature are respectively 240 DEG C and 250 DEG C, shunting side 1 μ L of formula sample introduction, split ratio 10:1, carrier gas is helium.

Temperature programming: 40 DEG C of holding 5min of initial temperature are raised to 150 DEG C with 20 DEG C/min, then be raised to 190 with 5 DEG C/min DEG C, 5min is kept, is finally raised to 220 DEG C with 5 DEG C/min, keeps 17min.By being protected with fatty acid methyl ester standard items (C15:0) Stay time, peak area ratio pair and mass spectrometry results, fatty acid component in qualitative, quantitative sample.

Embodiment 9: the ω -3 desaturase activity identification of room temperature preference 20C

The ARA that three concentration gradients 0.05mM, 0.1mM, 0.2mM are added in induced medium is lured as substrate It leads, collects thallus, extract fatty acid, GC-MS determination of fatty acid result is as shown in Figure 4.

Compared with Ctrl group, INVSc 1-oPpFADS17, INVSc 1-oAiFADS17, INVSc 1-oPaFADS17 exist Occur new peak in 37.5min, by comparing with fatty acid methyl ester standard items and mass spectral analysis, determines this peak for EPA.Specific point Analysis the results are shown in Table 2

Catalytic efficiency of 2 difference ω -3 desaturase saccharomyces cerevisiae recombinant conversion of table to ARA

Three transformants of INVSc 1-oPpFADS17 are to the catalytic efficiency highest of ARA, wherein INVSc 1- OPpFADS17 3 respectively reaches 64.8%, 49.0%, 43.8% under three concentration gradients, with positive control INVSc 1- Catalytic efficiency 69.7% of the oPaFADS17 under three concentration, 48.4%, 39.5% almost without difference, and absolute yield into One step is better than each transformant of positive control.

Particularly, with the prior art < Identification and characterization of new Δ -17 Fatty acid desaturases > middle recombination solution rouge yeast recorded is compared, INVSc 1-oPpFADS17 conversion of the invention Son when realizing comparable catalytic conversion, needed for induced medium in substrate A RA concentration significantly reduce, especially exist Maximum conversion is realized under 0.05mM, and EPA yield also further increases, show better EPA conversion capability.In addition, this It invents in the expression vector saccharomyces cerevisiae used only containing 9 fatty acid dehydrogenase of Δ, i.e., only has linoleic acid and palm fibre in saccharomyces cerevisiae Two kinds of monounsaturated fatty acids of palmitic acid oleic acid, compared with existing recombination solves rouge yeast, recombinant Saccharomyces cerevisiae of the invention will not be done The polyunsaturated fatty acid route of synthesis to be utilized is disturbed, and has His label on recombinant vector of the invention, is more advantageous to subsequent The purifying and identification of albumen.

In addition, above data is found out, the ω -3 desaturase gene order from fungi medium silk capsule bacterium is although with coming from ω -3 desaturase the gene order of phytophthora parasitica has the characteristics that similarity is high, affinity is close, but passes through same technique means The recombinant bacterium of acquisition cannot but play identical effect.Transformant INVSc 1-oAiFADS17 from fungi medium silk capsule bacterium Catalytic efficiency it is relatively low, respectively 46.3%, 33.5%, 23.9%.It is whether inclined in order to further verify this several sections of genes It is catalyzed the substrate of 20C well, chooses INVSc 1-oPpFADS17 3, INVSc 1-oAiFADS17 3 and INVSc 1- 1 three plant weight group transformant of oPaFADS17 adds 0.2mM LA, GLA, DGLA, ARA and simultaneously in induced medium respectively Addition 0.1mM LA and 0.1mM ARA is induced respectively, as a result such as table 3.

Catalytic efficiency of 3 28 DEG C of difference ω -3 desaturation saccharomyces cerevisiae recombinant conversion of table to different substrates

Analysis is it is found that recombinant conversion sub- INVSc 1-oPpFADS17 3 and INVSc 1-oAiFADS17 3, INVSc 1- OPaFADS17 1 is significantly higher than 18C substrate to the conversion ratio of 20C substrate, wherein the transformation efficiency to ARA is particularly evident.INVSc Conversion ratio highest of the 1-oPpFADS17 3 to ARA, yield suitable with the conversion ratio of positive control INVSc 1-oPaFADS17 1 Then it is higher than positive control；In addition, INVSc 1-oPpFADS17 3 is positive control to the conversion ratio of the ω -6PUFAs other than ARA Twice or so, illustrate that the efficiency of recombinant bacterium synthesis ω -3PUFAs of the invention is apparently higher than positive control.

In order to prove that ω -3 desaturase up to phytophthora parasitica in room temperature and higher compared with catalytic activity under low temperature, is luring Lead culture medium addition 0.2mM LA, GLA, DGLA, ARA and add 0.1mM LA and 0.1mM ARA simultaneously, under the conditions of 12 DEG C into Row induction, as a result such as table 4.

Catalytic efficiency of 4 12 DEG C of difference ω -3 desaturation saccharomyces cerevisiae recombinant conversion of table to different substrates

From the determination of fatty acid of table 4, the result shows that, the conversion ratio under different recombinant bacterium low temperature decreases.However, The recombinant Saccharomyces cerevisiae bacterium that phytophthora parasitica ω -3 desaturase can be expressed in the present invention has at relatively low temperatures is significantly higher than energy The EPA conversion ratio and EPA yield for enough expressing the recombinant Saccharomyces cerevisiae bacterium of ω -3 desaturase of fungi medium silk capsule bacterium, also superior to The EPA conversion ratio and EPA yield of the recombinant Saccharomyces cerevisiae bacterium of rotten mould ω -3 desaturase of melon and fruit can be expressed.

In conclusion ω -3 desaturase obtained through the invention can be catalyzed 18C and be catalyzed more insatiable hungers of 20C And fatty acid, but the ARA of 20C is converted EPA by preference, and transformation efficiency is higher at normal temperature, furthermore synthesizes ω -3PUFAs's Efficiency is further better than the prior art.It is that subsequent industrialized production EPA, DHA is established with this gene constructed engineering strain Application foundation.

Although the invention patent has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention.It is any to be familiar with The people of this technology can do various changes and modification without departing from the spirit and scope of the present invention.Therefore protection of the invention Range should subject to the definition of the claims.

Claims (1)

1. the recombinant Saccharomyces cerevisiae bacterium of phytophthora parasitica ω -3 desaturase can be expressed in polyunsaturated fatty acid biosynthesis Purposes, encode the recombination amino acid sequence of phytophthora parasitica ω -3 desaturase as shown in SEQ ID NO. 4, feature It is the recombinant Saccharomyces cerevisiae bacterium at normal temperature by C20:4^Δ5,8,11,14 Catalysis is C20:5^{Δ5,8,11,14,17}, catalytic efficiency reaches To 65%.