CN105368715A - Penicillium pinophilum degrading cellulose and application of penicillium pinophilum in straw fermentation - Google Patents
Penicillium pinophilum degrading cellulose and application of penicillium pinophilum in straw fermentation Download PDFInfo
- Publication number
- CN105368715A CN105368715A CN201510591081.1A CN201510591081A CN105368715A CN 105368715 A CN105368715 A CN 105368715A CN 201510591081 A CN201510591081 A CN 201510591081A CN 105368715 A CN105368715 A CN 105368715A
- Authority
- CN
- China
- Prior art keywords
- application
- penicillium pinophilum
- addicted
- fungi
- fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a fungus degrading cellulose efficiently and application of the fungus in straw fermentation, and belongs to the field of microbial technologies. The fungus DF13102 is separated from rotten banana straw and authenticated to be penicillium pinophilum, the strain is preserved in the China General Microbiological Culture Collection Center on July 9, 2015, and the preservation number is CGMCC No.11062. Straw degradation can be effectively promoted by using penicillium pinophilum DF13102 for degrading cellulose, and penicillium pinophilum DF13102 can be widely applied to the field of straw fermentation.
Description
Technical field
The present invention relates to a high-efficiency degradation cellulosic addicted to loose mould (Penicilliumpinophilum), and its application in stalk fermentation, belong to microbial technology field.
Background technology
Mierocrystalline cellulose is the basal component of plant tissue, is compound of polysaccharide the abundantest on the earth, is also cheap, the abundantest renewable resources of occurring in nature.At present except cotton, fiber crops, paper and timber, most of Mierocrystalline cellulose is still processed with the form of burning or refuse, not only causes the waste of ample resources also to cause environmental pollution.Therefore, cellulosic utilization is of great significance for problem tools such as solving energy dilemma, food shortage, environmental pollution with conversion.
At present, to the research of cellulosic saccharifying more be acid-hydrolysis method and enzyme hydrolysis method.Adopt enzymatic conversion method comparatively easy, under normal temperature, condition of normal pressure.Cellulase, as the cellulolytic enzyme of specificity, is widely used in multiple field such as food and environment.Microorganism can produce different enzymes according to different substrates, participates in the DeR of substrate, thus reaches the object of process waste pollutant.If the microbial host fungi of cellulase-producing, bacterium, actinomycetes and some protozoons, microorganism for the production of cellulase derives from fungi mostly, to the most study of mould in fungi, mould is when degraded cellulose, mycelia crosses secondary wall and enters cell, and constantly grow, degraded cellulose from inside to outside, fiber is progressively destroyed.Microorganism at present for the production of cellulase belongs to fungi mostly, and studying more has Trichoderma, Aspergillus, Penicillium, Rhizopus and the mould genus of paint spot etc.
Summary of the invention
The object of the present invention is to provide a high-efficiency degradation cellulosic addicted to loose mould and its application in stalk fermentation.
For achieving the above object, the present invention is by the following technical solutions:
It is provided by the present invention that to have efficient degradation cellulosic addicted to loose mould DF13102, carry out culture presevation on July 9th, 2015 at China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), and proving survival, preservation registration number is CGMCCNo.11062.Preservation address is: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica.
Of the present invention addicted to loose mould DF13102, there is following microbiological property:
On murphy juice flat board (PDA), gas silk is cotton-shaped, and juvenile gas silk white, conidium is grayish green to sap green, and base silk is dark red to red-purple, produces red water colo(u)r.Conidiophore is smooth, and penicillus is that symmetry two takes turns mould group, and arrangement closely; Conidium subsphaeroidal (Fig. 1).ITS gene order is see sequence table.Identify that bacterial strain DF13102 is addicted to loose mould (Penicilliumpinophilum) according to colony characteristics and micro-structural feature, belong to deuteromycetes, Moniliales, Moniliaceae, Penicillium.
The present invention can cellulase-producing addicted to loose mould DF13102, can efficient degradation Mierocrystalline cellulose, is conducive to biological process degraded and the application of stalk.
Of the present invention addicted to loose mould DF13102, be separated the banana stalk from rotting.Experiment proves, effectively can promote the degraded of stalk after this inoculation stalk, be the bacterial strain that a strain has applications well prospect.
Below in conjunction with specification drawings and specific embodiments, the invention will be further described.
Accompanying drawing explanation
Fig. 1 is the fibrillae of spores morphological specificity of bacterial strain DF13102 of the present invention, × 1000.
Fig. 2 is bacterial strain DF13102 of the present invention and the related strain phylogenetic tree based on ITS sequence.
Embodiment
Below in conjunction with specific embodiment, the invention will be further described:
Embodiment 1: the screening of bacterial strain DF13102CGMCCNo.11062
Gather on forest soil, agricultural land soil, vegetable garden, rot the samples such as stalk.Take 5g sample, add in the triangular flask that 45ml sterilized water is housed, 30 DEG C, 180r/min vibrate 20min make abundant dispersion.Get supernatant, carry out 10
-1~ 10
-5gradient dilution, draws each concentration samples solution 0.1ml respectively and coats Xylo-Mucine plate culture medium.Media Components is: Xylo-Mucine (CMC-Na) 20.0g, (NH
4)
2sO
42.0g, MgSO
47H
2o0.5g, KH
2pO
41.0g, NaCl0.5g, pH7.2, agar 20.0g, water 1000ml, add penicillin, Streptomycin sulphate make final concentration be 100U/ml, with bacteria growing inhibiting, is convenient to fungi and is separated.28 DEG C of constant temperature are inverted and are cultivated, and after having bacterium colony to grow, according to single bacterium colony of the picking different shape such as the speed of growth, hypha form, product spore situation, spore color of bacterium colony, PDA flat board carry out line purifying.At 30 DEG C after constant temperature culture 72h, filter out the larger bacterium colony of transparent circle by congo red staining method, obtain bacterial strain DF13102, preserve.
Embodiment 2: bacterial strain DF13102CGMCCNo.11062 cellulase-producing enzyme activity determination
By bacterial strain DF13102 with 1% inoculum size access liquid fermentation medium (substratum consists of: rice straw powder 30g, wheat bran 10g, KH
2pO
42g, MgSO
47H
2o0.3g, FeSO
47H
2o5mg, CaCl
21.7mg, ZnCl
21.7mg, CoCl
21.7mg, MnSO
41.6mg, distilled water 1000mL, pH7.2-7.4), 28 DEG C, 180r/min shaking table cultivation 7d, get the centrifugal 10min of fermented liquid 4000r/min, get supernatant as crude enzyme liquid, measures carboxymethylcelluloenzyme enzyme (CMC enzyme) activity and Filter paperlyase activity.Make standard with glucose, measure OD by DNS method
540.The substrate enzyme amount produced needed for 1 μm of ol reducing sugar (with glucose meter) is made to be a Ge Meihuo unit (U/ml) in definition 1min.Experimental result shows, and the CMC enzyme of bacterial strain DF13102 is lived and filter paper enzyme activity is respectively 1.8U/ml and 4.2U/ml.
Embodiment 3: the Species estimation of bacterial strain DF13102CGMCCNo.11062
(1) form and cultural characters
Bacterial strain DF13102 gas silk on PDA substratum is cotton-shaped, and juvenile gas silk white, conidium is grayish green to sap green, and base silk is dark red to red-purple, produces red water colo(u)r.Conidiophore is smooth, and penicillus is that symmetry two takes turns mould group, and arrangement closely; Conidium subsphaeroidal (as shown in Figure 1).
(2) ITS sequence measures and Phylogenetic Analysis
The ITS sequence 520bp (see sequence table) of bacterial strain DF13102 is obtained by order-checking.GenBank ITS sequence is submitted to carry out the display of BLAST analytical results, the bacterial strain higher with this bacterial strain homology mostly is Penicillium, select related strain in MEGA5.0, utilize Neighbor-joining method phylogenetic tree construction (as shown in Figure 2), it is a Ge great branch that DF13102 and Penicilliumpinophilum, Penicilliumverruculosum, Talaromycespinophilus, Talaromycesverruculosus, Trichodermaviride, Acremoniumcellulolyticus gather.
Compare form and the cultural characteristic of bacterial strain, find colony colour and the plesiomorphism of bacterial strain DF13102 and Penicilliumpinophilum, produce water-soluble redness pigment, sporophore broom shape branch, takes turns symmetry in typical two.And there is notable difference with other strain morphology feature.Analyze according to colony characteristics, micro-structural feature and ITS phylogenetic tree, identify that bacterial strain DF13102 is addicted to loose mould (Penicilliumpinophilum).
The bacterial strain DF13102 (CGMCCNo.11062) that the present invention relates to, through taxonomic identification, belong to deuteromycetes, Moniliales, Moniliaceae, Penicillium, called after is addicted to loose mould (Penicilliumpinophilum), culture presevation has been carried out at China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) on July 9th, 2015, and proving survival, its preservation registration number is CGMCCNo.11062.Preservation address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica.
Embodiment 4: bacterial strain DF13102CGMCCNo.11062 degraded banana stalk effect
The liquid fermentation medium that to be inoculated in banana stalk by bacterial strain DF13102 be sole carbon source, substratum consists of: banana straw powder 30g, (NH
4)
2sO
41.4g, KH
2pO
42.0g, (H
2n
2) CO0.3g, CaCl
20.3g, MgSO
47H
2o0.3g, FeSO
47H
2o5.0mg, ZnSO
47H
2o1.4mg, MnSO
4h
2o1.6mg, CoCl
22.0mg, water 1000ml, pH7.2.Inoculum size 2%, shake-flask culture 16d, measures the rate of weight loss of banana stalk dry weight.Rate of weight loss (%)=(m1-m2)/m1 × 100, wherein m1 is banana stalk dry weight (g) before fermentation, and m2 is banana stalk dry weight (g) after fermentation.
Experimental result shows, during fermentation 16d, the banana stalk amount of fungus degrading is 36.7%.
Sequence table
Sequence table (522bp)
Claims (5)
1. the fungi of a strain degraded cellulose, it is characterized in that the fungi of degraded cellulose is addicted to loose mould (Penicilliumpinophilum) DF13102, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, preserving number is CGMCCNo.11062.
2. described in claim 1, the feature of fungi is, the sequence of its ITS is:
GAGGTCACCGTGGTAAAAAAAACATGGTGGTGACCAACCCCCGCAGGTCCCTCCCGAGCGAGTGACAGAGCCCCATACGCTCGAGGACCAGACGGACGTCGCCGCTGCCTTTCGGGCAGGTCCCCGGGGGGACCACACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACAATTTTCATAGTACTCAGACAGCCCATCTTCATCAGGGTTCACAGAGCGCTTCGGCGGGCGCGGGCCCGGGGACGTGCGTCCCCCGGCGACCAGGTGGCCCCGGTGGGCCCGCCAAAGCAACAGGTGTATAGAGACAAGGGTGGGAGGTTGGGCCGCGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGC。
3. the application of fungi described in claim 1, is characterized in that and filter paper enzyme activity alive addicted to CMC enzyme in loose mould (Penicilliumpinophilum) DF13102 strain fermentating liquid is respectively 1.8U/ml and 4.2U/ml.
4. the application of fungi described in claim 1, is characterized in that addicted to the application of loose mould (Penicilliumpinophilum) DF13102 in stalk fermentation.
5. described in claim 4 addicted to the application of loose mould DF13102 in stalk fermentation, it is characterized in that, have obvious Degradation to banana stalk fibre, during fermentation 16d, the banana stalk amount of degrading is 36.7%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510591081.1A CN105368715B (en) | 2015-09-09 | 2015-09-09 | A kind of thermophilic loose mould of degraded cellulose and its application in stalk fermentation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510591081.1A CN105368715B (en) | 2015-09-09 | 2015-09-09 | A kind of thermophilic loose mould of degraded cellulose and its application in stalk fermentation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105368715A true CN105368715A (en) | 2016-03-02 |
| CN105368715B CN105368715B (en) | 2019-04-23 |
Family
ID=55371354
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510591081.1A Active CN105368715B (en) | 2015-09-09 | 2015-09-09 | A kind of thermophilic loose mould of degraded cellulose and its application in stalk fermentation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105368715B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110157596A (en) * | 2019-05-25 | 2019-08-23 | 哈尔滨工业大学 | It is a kind of can efficient long-term preservation cellulose decomposition flora method and device |
| CN111876335A (en) * | 2020-07-31 | 2020-11-03 | 深圳市顺盛农业科技发展有限公司 | Fungus capable of degrading cellulose and separation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1944628A (en) * | 2006-11-01 | 2007-04-11 | 沈阳农业大学 | Penicillium fungus with nematocidal activity and its preparing method and use |
| CN102925370A (en) * | 2012-11-19 | 2013-02-13 | 南京师范大学 | Penicillium pinophilum and application thereof |
| CN103114043A (en) * | 2013-01-30 | 2013-05-22 | 南京林业大学 | High-efficiency phosphate-solubilizing penicillium and application thereof in promoting growth of Chinese red pines |
-
2015
- 2015-09-09 CN CN201510591081.1A patent/CN105368715B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1944628A (en) * | 2006-11-01 | 2007-04-11 | 沈阳农业大学 | Penicillium fungus with nematocidal activity and its preparing method and use |
| CN102925370A (en) * | 2012-11-19 | 2013-02-13 | 南京师范大学 | Penicillium pinophilum and application thereof |
| CN103114043A (en) * | 2013-01-30 | 2013-05-22 | 南京林业大学 | High-efficiency phosphate-solubilizing penicillium and application thereof in promoting growth of Chinese red pines |
Non-Patent Citations (1)
| Title |
|---|
| ASHIS MAITY 等: "Penicillium pinophilum—A novel microorganism for nutrient management in pomegranate (Punica granatum L.)", 《SCIENTIA HORTICULTURAE》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110157596A (en) * | 2019-05-25 | 2019-08-23 | 哈尔滨工业大学 | It is a kind of can efficient long-term preservation cellulose decomposition flora method and device |
| CN111876335A (en) * | 2020-07-31 | 2020-11-03 | 深圳市顺盛农业科技发展有限公司 | Fungus capable of degrading cellulose and separation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105368715B (en) | 2019-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107858296B (en) | Aspergillus niger capable of dissolving phosphorus, potassium and degrading cellulose and preparation and application of microbial inoculum thereof | |
| CN103602592B (en) | Cellulose-degradation fungus and preparation of inoculum and application thereof | |
| CN102559506A (en) | Penicillium oxalicum and application thereof | |
| Han et al. | Solid-state fermentation on poplar sawdust and corncob wastes for lignocellulolytic enzymes by different Pleurotus ostreatus strains | |
| CN101717728B (en) | Penicillium and application thereof in catalyzing and hydrolyzing lignocellulose | |
| CN103740600B (en) | A kind of bacterial strain of cellulase-producing | |
| Chinedu et al. | Assessment of growth and cellulase production of wild-type microfungi isolated from Ota, Nigeria | |
| CN114381378B (en) | Penicillium chrysogenum for degrading lignin and application thereof | |
| WO2021196693A1 (en) | Penicillium oxalicum sdf-25 and use thereof | |
| CN102559508B (en) | Trichodermaviride used for producing cellulose degrading enzyme and its application in urban landscaping waste degradation | |
| CN107365718A (en) | Bacillus megaterium MYB3 and its application in straw fermented feed | |
| CN104988077A (en) | Eupenicillium parvum producing high temperature cellulase and xylanase and application thereof | |
| CN101864366B (en) | Penicillium citrinum bacterial strain and application thereof | |
| CN102061270B (en) | Streptomyces thermocarboxydus strain and cultivating method thereof | |
| CN103468582B (en) | Pectinase preparation producing Aspergillus japonicus PJ01 and enzyme production method | |
| CN103740680B (en) | The method of Trichodermareesei fermentative production cellulase and bacterial strain application thereof | |
| CN103361282B (en) | A kind of Low temperature resistant cellulose degradation bacteria and application thereof | |
| CN104593269A (en) | Cladosporium cladosporioides and lignocellulolyticenzyme preparation | |
| CN103468583B (en) | Penicillium oxalicum WX-209 strain with high cellulase yield and enzyme producing method | |
| CN105368715B (en) | A kind of thermophilic loose mould of degraded cellulose and its application in stalk fermentation | |
| CN105543106B (en) | One plant comes from Wite red-rooted salvia root plant endogenesis epiphyte and its application | |
| CN104860401A (en) | Application of Rhizopus oryzae strain JHSW01 to the fermentation of organic waste liquid and forestry and agricultural waste | |
| CN103131639B (en) | Trichoderma longibrachiatum strain and application thereof | |
| CN103484381B (en) | Thermophilic Aspergillus funigatus strain and application thereof in production of cellulase | |
| CN110527634A (en) | One plant of Tibet source produces trichoderma harzianum strain and its application of cellulase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |