CN105331687A - Bladder cancer screening detection kit - Google Patents

Bladder cancer screening detection kit Download PDF

Info

Publication number
CN105331687A
CN105331687A CN201510691235.4A CN201510691235A CN105331687A CN 105331687 A CN105331687 A CN 105331687A CN 201510691235 A CN201510691235 A CN 201510691235A CN 105331687 A CN105331687 A CN 105331687A
Authority
CN
China
Prior art keywords
pvt1
bladder cancer
cell
pvt1shrna
bladder
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510691235.4A
Other languages
Chinese (zh)
Inventor
蔡志明
庄成乐
刘宇辰
黄卫人
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Second Peoples Hospital
Original Assignee
Shenzhen Second Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Second Peoples Hospital filed Critical Shenzhen Second Peoples Hospital
Priority to CN201510691235.4A priority Critical patent/CN105331687A/en
Publication of CN105331687A publication Critical patent/CN105331687A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Hospice & Palliative Care (AREA)
  • Animal Behavior & Ethology (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a bladder cancer screening detection kit which is capable of recognizing PVT1 genes specifically. The bladder cancer screening detection kit has the advantages that PVT1 is highly expressed in bladder cancer cells, and by means of detecting the PVT1 genes, early screening of the bladder cancer can be achieved; tetracycline-induced PVT1 shRNA (short hairpin ribonucleic acid) is capable of knocking out PVT1 expression effectively, inhibiting bladder cancer cell multiplication and promoting bladder cancer cell apoptosis so as to make bladder cancer diagnosis and treatment possible.

Description

Bladder cancer selective mechanisms test kit
Technical field
The application relates to bladder cancer and detects treatment field.
Background technology
Some scientific researches show, and the long-chain non-coding RNA (lncRNA) being greater than 200 Nucleotide take part in the progress of various human diseases especially tumour.PVT1 is star member in long-chain non-coding family and plays an important role in the cancers such as prostate cancer, ovarian cancer, cancer of the stomach, liver cancer, but contacting of this gene and bladder cancer is still unintelligible.Tetracycline-inducible is current most popular regulator control system, and is the instrument of playing a great role in a kind of epoch of rising at medical science synthetic biology.This system can be used to the expression of controlling gene, for we providing the new approaches for the treatment of bladder cancer.
Summary of the invention
The invention provides a kind of new bladder cancer selective mechanisms test kit.
The invention provides a kind of bladder cancer selective mechanisms test kit, can specific recognition PVT1 gene.
PVT1 is high expression level in transitional cell bladder carcinoma cell line, by detecting this gene, can realize the selective mechanisms to bladder cancer.
A kind of transitional cell bladder carcinoma cell line selective mechanisms test kit, can specific recognition PVT1 gene, and described transitional cell bladder carcinoma cell line is T24 and 5637.
A kind of application of PVT1shRNA in the medicine of preparation treatment bladder cancer of tsiklomitsin induction.
A kind of PVT1shRNA of tsiklomitsin induction suppresses the application in the reagent of PVT1 genetic expression in transitional cell bladder carcinoma cell line in preparation.Transitional cell bladder carcinoma cell line is as T24 and 5637.
A kind of PVT1shRNA of tsiklomitsin induction promotes the application in the medicine of apoptosis in bladder in preparation.
A kind of PVT1shRNA of tsiklomitsin induction regulates and controls the application of PVT1 genetic expression in transitional cell bladder carcinoma cell line.This shRNA can strike the expression of low PVT1 in transitional cell bladder carcinoma cell line usually.
A PVT1shRNA for tsiklomitsin induction, its nucleotide sequence is as shown in SEQNO:1.
The invention has the beneficial effects as follows: PVT1 is high expression level in transitional cell bladder carcinoma cell line, by detecting this gene, the initial stage examination to bladder cancer can be realized; The PVT1shRNA of tsiklomitsin induction effectively can strike the expression of low PVT1, suppresses proliferation of human bladder cancer cells, promotes apoptosis in bladder, thus provides possibility for the diagnoses and treatment of bladder cancer.
Accompanying drawing explanation
Fig. 1 is the result figure of display PVT1 high expression level in Bladder Cancer and cell; Wherein, part A represents the relative market concentration using quantifying PCR method to detect PVT1 in Bladder Cancer; Part B represents compared with cancer beside organism, and PVT1 is significance high expression level (P<0.01) in cancerous tissue; C, D part represents and SV-HUC-1 clone contrasts, and PVT1 is at T24 (C part) and 5637 (D parts) all significance high expression levels (two p are all less than 0.01); Data means standard deviation display (* P<0.05, * * P<0.01);
Fig. 2 is the result figure that after display transfection siRNA or tsiklomitsin induction shRNA, PVT1 expression level significance declines; Wherein, A, part B represent and to contrast with si-NC group, and PVT1 expression level expression level significance in si-PVT1 group declines (T24 and 5637 is P<0.01 all); C, D part represents and control group contrasts, and after adding different concns doxycycline, the PVT1 expression level of tsiklomitsin induction group declines; 1 μ g/ml doxycycline farthest can suppress the expression level of PVT1 (T24,5637 equal P<0.01); Data means standard deviation display (* P<0.05, * * P<0.01); Wherein, for C, D part, corresponding each concentration, four square columns from left to right represent PVT1shPVT1+DOX, NCshRNA+DOX, PVT1shRNA-DOX and NCshRNA-DOX respectively;
Fig. 3 be display transfection siRNA or tsiklomitsin inducing plasmid after, the repressed result figure of cell proliferation; Wherein, CCK8 method is for detecting cell proliferation; In A, part B, contrast with si-NC group, in si-PVT1 group, the propagation of T24 cell (part A) and 5637 cells (part B) is suppressed (P<0.01) by significance; In C, D part, compared with control group, in the shRNA group adding the induction of 1ug/ml doxycycline, the propagation of T24 cell (C part) and 5637 cells (D part) is significantly suppressed (P<0.01); Data means standard deviation display (* P<0.05, * * P<0.01); Wherein, for A, part B, solid line represents si-NC, and dotted line represents si-PVT1; For C, D part, broken line G, H, I and J represent NC-DOX, NC+DOX, PVT1shRNA-DOX and PVT1shRNA+DOX respectively;
Fig. 4 is after display transfection siRNA or tsiklomitsin inducing plasmid, the result figure that is significantly suppressed of cell proliferation; In part A, after transfection siRNA, EdU positive cell declines (P<0.05) in the si-PVT1 group significance of T24 and 5637; In part B, after transfection tsiklomitsin induction shRNA, EdU positive cell declines (P<0.05) in the si-PVT1 group significance of T24 and 5637; In C, D, E and F part, EdU cell rate is EdU positive cell number and the ratio of Hoechst33342 staining cell number; Data means standard deviation display (* P<0.05, * * P<0.01); Wherein, in C, D part, left and right square column represents si-NC, si-PVT1 respectively; In E, F part, four square columns represent NCshRNA-DOX, NCshRNA+DOX, PVT1shRNA-DOX, PVT1shPVT1+DOX respectively from left to right;
Fig. 5 is that display uses ELISA and Hoechst33258 staining to detect the result figure of transfection siRNA or tsiklomitsin induction shRNA apoptosis situation; In part A, after transfection si-PVT1, Caspase-3 is in T24 and 5637 all significancees raising (P<0.05); In part B, Hoechst33258 staining detects the cell of apoptosis; After transfection si-PVT1, apoptosis cell is in T24 and 5637 all significancees raising (P<0.05); In C, D part, after transfection tsiklomitsin induction shRNA, Caspase-3 is in T24 (C part) and 5637 (D parts) all significancees raising (P<0.05); In E, F part, after transfection tsiklomitsin induction shRNA, apoptosis cell is in T24 (E part) and 5637 (F parts) all significancees raising (P<0.05); G, H, I part is apoptotic representative picture after transfection siRNA and tsiklomitsin induction shRNA; Data means standard deviation display (* P<0.05, * * P<0.01); Wherein, in A, part B, left and right square column represents si-NC, si-PVT1 respectively; In C, D, E, F part, four square columns represent NCshRNA-DOX, NCshRNA+DOX, PVT1shRNA-DOX, PVT1shPVT1+DOX respectively from left to right;
Fig. 6 is the result figure of display Apoptosis by Flow Cytometry level; In A, part B, contrast with si-NC group, visible more apoptotic cell (T24 and 5637 is P<0.05 all) in si-PVT1 group; In C, D part, contrast with control group, visible more apoptotic cell (T24 and 5637 is P<0.05 all) in tsiklomitsin induction shRNA group; Data means standard deviation display (* P<0.05, * * P<0.01).
Embodiment
By reference to the accompanying drawings the present invention is described in further detail below by embodiment.
Technology and method
1. cell cultures
Transitional cell bladder carcinoma cell line T24,5637 is purchased from AmericanTypeCultureCollection (ATCC, Manassas, USA).Bladder normal epithelial immortalized cells SV-HUC-1 is purchased from Shanghai cell research institute.T24 by 90% DMEM (Invitrogen, CA), the foetal calf serum (Invitrogen) of 10%, cultivates in the cell culture fluid of the glutamine of 1%-2% and the dual anti-composition of 0.5%-1%.5637 by 90% 1640 (Invitrogen, CA), the foetal calf serum (Invitrogen) of 10%, cultivates in the cell culture fluid of the glutamine of 1%-2% and the dual anti-composition of 0.5%-1%.SV-HUC-1 by 90% F-12K (Invitrogen, CA), the foetal calf serum (Invitrogen) of 10%, cultivates in the cell culture fluid of the glutamine of 1%-2% and the dual anti-composition of 0.5%-1%.Three kinds of clones are all placed on 37 DEG C, 5%CO 2incubator cultivate.
2. collection of specimens
This research comprises 32 are diagnosed as bladder cancer patient at First Attached Hospital, Anhui Medical Univ.'s Urology Surgery.Informed patient or families of patients before experiment, next step operation is carried out at rear of getting the permission.Sample is put into liquid nitrogen immediately and is preserved after taking out.
3. the short hairpin RNA for PVT1 (shRNA) plasmid construction of tsiklomitsin induction
Tetracycline-inducible plasmid origin is in Guangzhou Fu Neng genome company (FulenGen, Guangzhou, China), and this system is CS-SH3024-LVRInU6TGP at the catalog number (Cat.No.) of the said firm, and plasmid designations is psi-LVRInU6TGP.And the shRNA sequence for PVT1 is inserted into the lower end of tetracycline-inducible.Tetracycline-inducible shRNA sequence is GATCCGCAGCCATCATGATGGTACTTCAAGAGAGTACCATCATGATGGCTGTTTTT TGGAATT (SEQNO:1).ShRNA sequence is CAGCCATCATGATGGTACT (SEQNO:2)
4. cell transfecting
Day before transfection, is inoculated on corresponding culture plate according to the cell count of Lipofectamin2000 transfection specification sheets, adds substratum, be placed on 37 DEG C, 5%CO 2in incubator.According to Lipofectamin2000 (Invitrogen, CA) transfection specification sheets, the plasmid adding small molecules interference RNA or build in serum free medium, soft mixing.In serum free medium, add Lipofectamin2000 reagent, mix gently, room temperature places 5min.The tetracycline-inducible plasmid being inserted with shRNA diluted and Lipofectamin2000 are softly mixed, room temperature places 20 minutes, to form siRNA/Lipofectamin or plasmid/Lipofectamin mixture.SiRNA/Lipofectamin or plasmid/Lipofectamin mixture are added in corresponding culture plate, softly rock.Put into incubator, change without dual anti-substratum after 4-6 hour, prepare next step experiment.
5. tissue and the extraction of cell RNA and real-time fluorescent quantitative RT-PCR (qRT-PCR)
According to process specifications, with RNA lysate cracking tissue and cell, and extract RNA.Use the Reverse Transcriptase kit of Takara, according to reverse transcription Operating Guideline, RNA reverse transcription is that cDNA treats that next step carries out quantitative PCR again.Quantitative PVT1 primer: upstream 5 '-GCCCCTTCTATGGGAATCACTA-3 ' (SEQNO:3), downstream 5 '-GGGGCAGAGATGAAATCGTAAT-3 ' ((SEQNO:4); GAPDH upstream primer 5 '-CGCTCTCTGCTCCTCCTGTTC-3 ' (SEQNO:5), downstream primer: 5 ’ – ATCCGTTGACTCCGACCTTCAC-3 ' (SEQNO:6).According to reagent specification sheets, run quantitative PCR experiment at ABI7500 (AppliedBiosystems, FosterCity, CA, USA).Get three independent repeated trials to add up.Experimental data is with comparing Δ Ct method statistic.
6. cell proliferation detects
Be made into individual cells suspension with the antibiotic-free nutrient solution containing 10% tire calf serum, be inoculated into 96 orifice plates with 3000, every hole cell, every pore volume 100 μ l.CCK8 is used to detect Growth of Cells.Respectively at after transfection 24,48 and 72h, get corresponding hole and detect.3 multiple holes established by each sample.Every hole adds CCK8 solution 10 μ l.Hatch 1h, select 450nm wavelength microplate reader (Bio-Rad, the U.S.) to measure each hole light absorption value, record result take time as X-coordinate, and light absorption value is that ordinate zou draws cell growth curve.Get 3 independent repeated trials to add up.In order to detect the impact of interference or plasmid on cell proliferation further, sensitiveer EdU staining is used for cell proliferation and detects.EdU working method is according to previous bibliographical information.Get 3 independent repeated trials to add up.
7. apoptosis detects
Before transfection, every hole 1 × 10 5cell seeding is in 12 orifice plates.When cell grows to the degrees of fusion of 60%, transfected plasmids to specifications.After 48 hours, old substratum is abandoned in suction, wash cell twice with PBS, survey the activity of apoptosis index Caspase-3 with thecaspase3enzyme-linkedimmunosorbentassay (ELISA) assay and Caspase-3 enzyme-linked immunosorbent assay.Hoechst33258stainingassay and Hoechst33258 dyeing process detects apoptosis number.After 500 μ l paraformaldehyde every hole fixed cell 15min, staining agent Hoechst33258 dyes 5min, and counts the cell of apoptosis with fluorescence microscope.In order to detect further interference or plasmid on apoptotic impact, flow cytometry be used to detect apoptosis.After the two dye of transfection 48 hours later cell (AI, PI), detect getting up early apoptotic cell at machine (EPICS, XL-4, Beckman, CA, USA).Get 3 independent repeated trials to add up.
8. statistical analysis
Data analysis uses SPSS20.0 statistical software, and the data acquisition of normal distribution represents with x ± s.PVT1 at sample cancerous tissue and cancer beside organism's differential expression situation paired-sample t test, cck8 cell proliferation data ANOVA, other data acquisition independent samples t test.P<0.05 is inspection level, and represents that difference has statistical significance.
Experimental result
1.PVT1 is high expression level in Bladder Cancer and cell, simultaneously relevant to clinical pathological factors
In 32 pairs of bladder cancer samples, use quantifying PCR method, detect the expression level of PVT1 in Bladder Cancer and cell.The A of Fig. 1, part B display, relative Carcinoma side normal tissue, PVT1 is high expression level (P<0.01) in the cancerous tissue of 62.5%.Compare with SV-HUC-1, PVT1 is high expression level in T24 (P<0.01) and 5637 (P<0.001) cell.Table 2 shows, and the PVT1 of high expression level and the case of bladder cancer are by stages and TNM height correlation (P<0.01) by stages; But contact without significance with sex, age, tumor size and lymphoglandula; These data hint PVT1 may be an oncogene in bladder cancer.Table 1 is that patients clinical data gathers.
Table 1 patients clinical data summary sheet
Table1Summaryof clinicopathologicalfeaturesoftissuesofbladdercancer
PtNo.patientnumber；Mmale；Ffemale；GradetheWorldHelthCrganization2004classification；Hhigh；Llow；StagetheAmericanJointCommitteeonCancerTNMclassification
Table 2PVT1 expresses and bladder cancer's clinical case feature association table
Table2CorrelationbetweenPVT1expressionand clinicopathologicalcharacteristicsofbladdercancerpatients
*P＜0.05wasconsideredsignificant(Chi-squaretestbetween2groups).
2, PVT1 promotes proliferation of human bladder cancer cells
In order to explore the biological action of PVT1 at transitional cell bladder carcinoma cell line, quantifying PCR method after transfection siRNA48 hour, is used to detect the expression level of PVT1 in transitional cell bladder carcinoma cell line.The A of Fig. 2, part B display, after transfection si-PVT1, PVT1 significantly declines (P<0.01) at the expression level of T24 and 5637.CCK8 result display si-PVT1 can reduce the propagation (P<0.01) of transitional cell bladder carcinoma cell line significantly.The part A display of Fig. 4, EdU methods and results shows, and in si-PVT1 group, the cell count of the EdU positive is obviously less than si-NC group (P<0.01 of T24 and 5637).40% (T24) (P<0.01) and 50% (5637) (P<0.01) (C, D part of Fig. 4) is decreased at the EdU positive cell number of si-PVT1 group.These results show that PVT1 promotes proliferation of human bladder cancer cells.
3.PVT1 suppresses apoptosis in bladder
Whether apoptosis in bladder is suppressed, the apoptosis situation of cell after use ELISA, Hoechst33258 and Flow cytometry transfection siRNA in order to study PVT1.Relative comparison group, Caspase-3 activity and apoptosis rate significantly improve (all P<0.01) (A, B and G part of Fig. 5 in si-PVT1 group; The A of Fig. 6 and part B).These results show, and PVT1 suppresses apoptosis in bladder really.
4. the PVT1shRNA of tsiklomitsin induction strikes the expression of low PVT1
When after the doxycycline adding different concns, the PVT1shRNA of tsiklomitsin induction can reduce the expression (all p<0.01) (Fig. 2 C and Fig. 2 D) of PVT1 at T24 and 5637 significantly.After the doxycycline of 1 μ g/ml adds the PVT1shRNA plasmid proceeding to tsiklomitsin induction, relative to control group, in T24 cell, PVT1 expression level have dropped 58% (P<0.01); 60% (P<0.01) is have dropped in 5637 cells.These results show that PVT1shRNA that tsiklomitsin is induced can reduce the expression of PVT1, and relevant to the add-on of doxycycline.Because the doxycycline of 1 μ g/ml farthest can suppress the expression of PVT1, so this 1 μ g/ml concentration can be selected to make further research.
5. the PVT1shRNA antiproliferative effect of tsiklomitsin induction
In order to whether the PVT1shRNA detecting tsiklomitsin induction can antiproliferative effect, CCK8 and EdU method is used to detect cell proliferation level.The display of CCK8 result is when after the doxycycline adding 1 μ g/ml, relative to control group, the PVT1shRNA of tsiklomitsin induction can antiproliferative effect (P<0.001 of T24 and 5637) (C and the D part of Fig. 3) significantly.EdU method shows, and relative to control group, the EdU positive cell number of the PVT1shRNA group of transfection tsiklomitsin induction obviously reduces (part B of Fig. 4).EdU positive cell decreases 37% in T24, in 5637, decrease 46%.(all P<0.01) (E and F part of Fig. 4).
6. the PVT1shRNA of tsiklomitsin induction promotes apoptosis
ELISA method is used to detect cell Caspase-3 active.Use Hoechst33358 staining and Apoptosis by Flow Cytometry rate.When after the doxycycline adding 1 μ g/ml, relative to control group, the PVT1shRNA of tsiklomitsin induction can improve Caspase-3 activity (in T24 and 5637, P<0.01) (C and the D part of Fig. 5) significantly.Hoechst33258 staining and the display of Flow Cytometry methods result, compared with control group, the PVT1shRNA of tsiklomitsin induction can increase apoptotic cell total quantity and viable apoptotic cell (in T24 and 5637, P<0.01) (E, F, H and I part of Fig. 5 significantly; C and the D part of Fig. 6).
Above content is in conjunction with concrete embodiment further description made for the present invention, can not assert that specific embodiment of the invention is confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, some simple deduction or replace can also be made.

Claims (7)

1. a bladder cancer selective mechanisms test kit, is characterized in that, can specific recognition PVT1 gene.
2. a transitional cell bladder carcinoma cell line selective mechanisms test kit, is characterized in that, can specific recognition PVT1 gene, and described transitional cell bladder carcinoma cell line is T24 and 5637.
3. the application of the PVT1shRNA of a tsiklomitsin induction in the medicine of preparation treatment bladder cancer.
4. the PVT1shRNA of a tsiklomitsin induction suppresses the application in the reagent of PVT1 genetic expression in transitional cell bladder carcinoma cell line in preparation.
5. the PVT1shRNA of a tsiklomitsin induction promotes the application in the medicine of apoptosis in bladder in preparation.
6. the PVT1shRNA of a tsiklomitsin induction regulates and controls the application of PVT1 genetic expression in transitional cell bladder carcinoma cell line.
7. a PVT1shRNA for tsiklomitsin induction, it is characterized in that, nucleotide sequence is as shown in SEQNO:1.
CN201510691235.4A 2015-10-22 2015-10-22 Bladder cancer screening detection kit Pending CN105331687A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510691235.4A CN105331687A (en) 2015-10-22 2015-10-22 Bladder cancer screening detection kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510691235.4A CN105331687A (en) 2015-10-22 2015-10-22 Bladder cancer screening detection kit

Publications (1)

Publication Number Publication Date
CN105331687A true CN105331687A (en) 2016-02-17

Family

ID=55282450

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510691235.4A Pending CN105331687A (en) 2015-10-22 2015-10-22 Bladder cancer screening detection kit

Country Status (1)

Country Link
CN (1) CN105331687A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106047880A (en) * 2016-08-18 2016-10-26 暨南大学 PVT1 siRNA-1055 for inhibiting blood tumor cell proliferation and application thereof
CN106520767A (en) * 2016-10-12 2017-03-22 深圳市第二人民医院 Nucleotide sequence used for knocking down gene relevant to bladder cancer as well as kit comprising sequence and medicine comprising sequence
CN107267606A (en) * 2017-04-20 2017-10-20 浙江理工大学 A kind of lncRNA and its application in lung cancer detection label or prognosis recurrence label is merged as breast cancer
CN107937544A (en) * 2018-01-02 2018-04-20 中南大学 Application of the reagent of in situ hybridization detection long-chain non-coding RNA PVT1 expression quantity in nasopharyngeal carcinoma diagnosis reagent is prepared
CN109825578A (en) * 2018-11-30 2019-05-31 徐州市中心医院 Expression of the P3H4 gene in bladder cancer cell and its impact analysis method to apoptosis of bladder cancer

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006081158A3 (en) * 2005-01-25 2007-02-01 Univ California Predictive and therapeutic markers in overian cancer
CN105331616A (en) * 2015-10-22 2016-02-17 深圳市第二人民医院 Tetracycline-induced artificial MicroRNA element

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006081158A3 (en) * 2005-01-25 2007-02-01 Univ California Predictive and therapeutic markers in overian cancer
CN105331616A (en) * 2015-10-22 2016-02-17 深圳市第二人民医院 Tetracycline-induced artificial MicroRNA element

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
CHENGLE ZHUANG等: "Tetracycline-inducible shRNA targeting long non-coding RNA PVT1 inhibits cell growth and induces apoptosis in bladder cancer cells", 《ONCOTARGET》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106047880A (en) * 2016-08-18 2016-10-26 暨南大学 PVT1 siRNA-1055 for inhibiting blood tumor cell proliferation and application thereof
CN106520767A (en) * 2016-10-12 2017-03-22 深圳市第二人民医院 Nucleotide sequence used for knocking down gene relevant to bladder cancer as well as kit comprising sequence and medicine comprising sequence
CN106520767B (en) * 2016-10-12 2019-03-05 深圳市第二人民医院 For striking the nucleotide sequence of low gene relevant to bladder cancer and kit and drug containing the sequence
CN107267606A (en) * 2017-04-20 2017-10-20 浙江理工大学 A kind of lncRNA and its application in lung cancer detection label or prognosis recurrence label is merged as breast cancer
CN107937544A (en) * 2018-01-02 2018-04-20 中南大学 Application of the reagent of in situ hybridization detection long-chain non-coding RNA PVT1 expression quantity in nasopharyngeal carcinoma diagnosis reagent is prepared
CN107937544B (en) * 2018-01-02 2020-03-31 中南大学 Application of reagent for detecting long-chain non-coding RNA PVT1 expression quantity by in situ hybridization in preparation of nasopharyngeal carcinoma diagnostic reagent
CN109825578A (en) * 2018-11-30 2019-05-31 徐州市中心医院 Expression of the P3H4 gene in bladder cancer cell and its impact analysis method to apoptosis of bladder cancer

Similar Documents

Publication Publication Date Title
CN105331687A (en) Bladder cancer screening detection kit
Deng et al. Long non-coding RNA HOTTIP promotes tumor growth and inhibits cell apoptosis in lung cancer
Gao et al. RETRACTED ARTICLE: Long noncoding RNA MAGI1-IT1 promoted invasion and metastasis of epithelial ovarian cancer via the miR-200a/ZEB axis
Zhou et al. RETRACTED ARTICLE: MicroRNA-145 inhibits the activation of the mTOR signaling pathway to suppress the proliferation and invasion of invasive pituitary adenoma cells by targeting AKT3 in vivo and in vitro
Xue et al. Overexpression of FYN suppresses the epithelial-to-mesenchymal transition through down-regulating PI3K/AKT pathway in lung adenocarcinoma
Li et al. miR-597-5p inhibits cell growth and promotes cell apoptosis by targeting ELK1 in pancreatic cancer
Tian et al. lncRNA NR_120420 promotes SH-SY5Y cells apoptosis by regulating NF-κB after oxygen and glucose deprivation
Bai et al. Up-regulation of long non-coding RNA LOXL1-AS1 functions as an oncogene in cervical squamous cell carcinoma by sponging miR-21
CN110229901A (en) Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application
CN104774929A (en) Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer
CN110251529A (en) MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament
CN110496221A (en) Inhibit application of the substance of DPPA3 expression in the product that preparation prevents and treats cancer
Lv et al. Anti-angiogenic role of microRNA-23b in melanoma by disturbing NF-κB signaling pathway via targeted inhibition of NAMPT
CN111096962A (en) Application of fatty acid oxidation inhibitor in preparation of medicine for treating colorectal cancer
CN107190005A (en) Applications of the lncRNA as biomarker in adenocarcinoma of lung diagnosis and treatment
CN113549697B (en) Gastric cancer heat chemotherapy sensitive marker and application thereof
Huang et al. Effects of hTERT antisense oligodeoxynucleotide on cell apoptosis and expression of hTERT and bcl-2 mRNA in keloid fibroblasts.
CN110628791B (en) Application of tRNA (transfer RNA) modified enzyme gene in non-small cell lung cancer
CN106282385A (en) Long-chain non-coding RNA XLOC_000090 qualification in pulmonary carcinoma and purposes
Wang et al. GSTO1 regards as a meritorious regulator in cutaneous malignant melanoma cells
CN110257522A (en) Gene hsa_circ_0045881 relevant to breast cancer diagnosis and treatment and its application
Cheng et al. MicroRNA-294 Promotes Cell Proliferation, Migration and Invasion in SMMC-7721 Hepatoma Carcinoma Cells by Activating the JNK/ERK Signaling Pathway
CN106860879B (en) The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer
CN101787368B (en) siRNA for restraining Z38 gene expression of human being and application thereof in preparing breast-tumor resisting medicine
CN108642176A (en) Applications of the PART1 as breast cancer diagnosis, treatment and prognostic marker

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160217

RJ01 Rejection of invention patent application after publication