CN105296369A - Ageing-type saccharomyces cerevisiae and its use in wine making - Google Patents
Ageing-type saccharomyces cerevisiae and its use in wine making Download PDFInfo
- Publication number
- CN105296369A CN105296369A CN201510799787.7A CN201510799787A CN105296369A CN 105296369 A CN105296369 A CN 105296369A CN 201510799787 A CN201510799787 A CN 201510799787A CN 105296369 A CN105296369 A CN 105296369A
- Authority
- CN
- China
- Prior art keywords
- wine
- saccharomyces cerevisiae
- ageing
- yeast
- yeast saccharomyces
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to the technical field of microbes and concretely relates to ageing-type saccharomyces cerevisiae and its use in wine making. The ageing-type saccharomyces cerevisiae and its use in wine making gradually change the passive situation of long-term import of wine saccharomyces cerevisiae in China and solve the problem of domestic wine quality homogenization. The saccharomyces cerevisiae NX11424 is preserved in the China general microbiological culture collection center (CGMCC), has a preservation number of CGMCC NO. 10050, has an excellent color and fragrance extraction capability, fully performs typical characteristics of grapes, provides a perfect skeleton feel and a structure feel for wine, and provides unique baking, barbecue and coffee ageing characteristics for new wine after alcoholic fermentation. Dry red wine prepared by the saccharomyces cerevisiae NX11424 is very suitable for ageing in an oak barrel and has obvious ageing potential and thus the saccharomyces cerevisiae NX11424 is an excellent ageing-type saccharomyces cerevisiae of dry red wine.
Description
One, technical field:
The present invention relates to microbial technology field, be specifically related to a kind of to there is the yeast saccharomyces cerevisiae of ageing style and the application in wine making thereof.
Two, background technology:
Grape wine is the second largest alcoholic beverage being only second to beer in the world, in world region economy and international trade, occupy important proportion.In recent years, China's wine industry is with the speed increase of annual 15-20%, but its quality and international most advanced level also also exist larger gap.In the factors affecting wine quality, except ecological condition, grape variety and processing unit, organism of fermentation plays decisive role to quality vinous and sense organ style.
The biological fermentation process that wine making is carried out in fact exactly under microbial process, yeast is the microorganism playing main effect in wine making.But, winery of current China ferments the grape wine commercial yeast of yeast used almost all external seed selections of import, the grape variety of adding various places wine brewing concentrates on a few eurytropy kind mostly, as Cabernet Sauvignon, Cabernet Franc, Chardonney, Riesling etc., its cultivation management and wine-making technology, Brewing equipment are all quite similar, wine kind is single, causes China's wine quality unification to be on the rise! If this situation does not change as early as possible, just likely detrimentally affect without redemption is caused to the wine industry that China is flourish, makes China's wine industry thoroughly lose international competitiveness!
Generally speaking, industrial production district obviously reduces (Ganga & Martines, 2004) than the yeast diversity in traditional mode of production district; Commercial yeast and local spontaneous fermentation yeast are at war with, and a lot of commercial yeast is with killing ability (Rogeretal, 2001), continuously and the single commercial yeast strain fermentation of life-time service, the diversity of yeast and importance (Gangaetal, 2004 of native country yeast effect can be reduced; Blancoetal, 2008), making inoculation yeast replace native country yeast becomes the dominant bacteria of brewery surface and environment and completes spontaneous fermentation, thus affects validity (Cianietal, 2004 of brewery by spontaneous fermentation selecting yeast bacterium; Mercadoetal, 2007).Use import commercial yeast, can cause determining that the material of Wine Aroma feature loses (Mendesetal, 2001 under specific ecological condition; Romanoetal, 2003), make grape wine lack typicalness and style (DiMaroetal, 2007).Abroad also find, the leavening property of the excellent fungus strain selected from the yeast of native country is obviously better than from the external commercial yeast (Lopesetal, 2007Lopandic) introduced.Carry out inoculation fermentation with import commercial yeast, make China's wine industry that foreign exchange need be spent every year up to 5,000,000 U.S. dollars, and also can strengthen further along with the increase of vintage.In other words, the development of Chinese Wine Industry, owing to lacking the yeast saccharomyces cerevisiae of independent intellectual property right, all is being the huge tuition fee of foreign payment always! Therefore, excavate Chinese producing region characteristic wine-related yeast resource, for China's grape wine spontaneous fermentation and yeast sreen kind provide species resource deposit, change the passive situation of the long-term dependence on import of China's vinify yeast gradually, the for a change homogeneity of domestic wine quality, improves China's grape wine international competitiveness and lays the foundation.
Three, summary of the invention
Object of the present invention, in order to change the passive situation of the long-term dependence on import of China's vinify yeast gradually, solves the homogeneity problem of domestic wine quality, provides a kind of and has the yeast saccharomyces cerevisiae of ageing style and the application in wine making thereof.
For achieving the above object, the technical solution used in the present invention is: an Accharomyces cerevisiae NX11424, be preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms " center "; address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; preservation date: on November 25th, 2014; deposit number is CGMCCNO.10050, Classification And Nomenclature: Saccharomyces Cerevisiae in S accharomycescerevisiae.
Described yeast saccharomyces cerevisiae NX11424, is characterized in that: from the cabernet sauvignon grape spontaneous fermentation later stage in vineyard, Guang Xiasan base, Ningxia, the pure growth being through screening, being separated.
The described application of yeast saccharomyces cerevisiae NX11424 in red wine is brewageed.
Compared with prior art, tool of the present invention has the following advantages and effect:
Yeast saccharomyces cerevisiae NX11424 of the present invention (is preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms " center ", address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, preservation date: on November 25th, 2014, deposit number is CGMCCNO.10050, Classification And Nomenclature: Saccharomyces Cerevisiae in S accharomycescerevisiae) there is outstanding color and fragrance lixiviate ability, can fully excavate and represent the characteristic feature of grape variety reality, the more perfect skeleton sense of grape wine and structure sense can be given, after zymamsis, namely allow stum present unique curing, the ageing features such as barbecue and coffee.In addition, the dry red winew that yeast saccharomyces cerevisiae NX11424 brewages very is applicable to oak barrel during aging, and shows obvious ageing potentiality, is the very outstanding dry red winew yeast saccharomyces cerevisiae with ageing style of a strain.
Four, accompanying drawing illustrates:
Fig. 1 is the colony characteristics of yeast saccharomyces cerevisiae NX11424 on YPD substratum;
Fig. 2 extra dry red wine zymotechnique general flow chart;
Five, embodiment
Simulation Sucus Vitis viniferae culture medium prescription in following embodiment is as follows:
Table 1 simulates Sucus Vitis viniferae and preparation thereof
In following embodiment, YEPD culture medium prescription is as follows:
Peptone 2.0%, yeast leaching powder 1.0%, glucose 2.0% (natural ph, 121 DEG C of sterilizing 20min can add 100mg/L paraxin with bacteria growing inhibiting, and solid medium adds agar 2.0%).
In following embodiment, WLN culture medium prescription is as follows:
Peptone 0.5%, yeast leaching powder 0.4%, glucose 5.0%, agar 2.0%; Liquid storage A:40mL/L, liquid storage B:1mL/L, liquid storage C:1mL/L, adjust pH to 6.2.Inorganic salts liquid storage configures: liquid storage A (potassium primary phosphate 0.0550%, Repone K 0.0425%, calcium chloride 0.0125%, magnesium sulfate 0.0125%, 4 DEG C of preservations after autoclaving); Liquid storage B (iron(ic) chloride 0.0025%, manganous sulfate 0.00025%, 4 DEG C of preservations after autoclaving); Liquid storage C (tetrabromo-mcresolsulfonphthalein 22mg/L, is dissolved in 50% alcohol, and obtain solution vessel used and distilled water all need through 121 DEG C of autoclavings).During preparation substratum in aseptic operating platform, add liquid storage A and liquid storage B and other nutrient media componentses in proportion, add distilled water to target volume, regulate pH to 6.2.Be cooled to 65 DEG C after 121 DEG C of sterilizing 20min and add liquid storage C, mix, preparation dull and stereotyped (every plate 15mL ~ 20mL).
The control strain of following embodiment is the commercial activated dry yeast ZymafloraF15 (all write a Chinese character in simplified form below and make F15) of French LAFFORT company production
The separation of embodiment 1, yeast saccharomyces cerevisiae NX11424 (be preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms " center ", deposit number is CGMCCNO.10050), purifying and qualification thereof
Pluck vineyard, Guang Xiasan base, Ningxia cabernet sauvignon grape, fermented liquid is got in spontaneous fermentation process, in 1mL fermentation broth sample, add 9mL sterilized water carry out gradient dilution, coating WLN solid medium is dull and stereotyped, 5d is cultivated at temperature is 28 DEG C, according to the colony characteristics of yeast saccharomyces cerevisiae on WLN substratum (with reference to Fig. 1): select smooth surface cream-colored, central authorities' pyramidal projections, surrounding has dark yellow or light green colour circle, opaque, butyraceous single bacterium colony, picking yeast saccharomyces cerevisiae list bacterium colony is rule purifying further on WLN substratum, then picking yeast saccharomyces cerevisiae list bacterium colony is transferred in YEPD liquid nutrient medium on WLN substratum after purification, cultivate 2d at temperature is 28 DEG C after, adopted by Wine brewing yeast strain the preservation of Freezing Glycerine method for subsequent use.Simultaneously, with transfering loop, YEPD nutrient solution is rule on YEPD solid medium, after cultivating 3d at 28 DEG C, extract yeast colony DNA, polymerase chain reaction (PCR) amplification is carried out to the 26SD1/D2 district of rRNA gene, pcr amplification product (i.e. the 26SD1/D2 district of rRNA gene) is checked order, Nucleotidecollection (nr/nt) database on sequencing result and NCBI carries out sequence alignment, be accredited as Wine brewing yeast strain, obtain Wine brewing yeast strain.Wine brewing yeast strain for subsequent use for preservation is carried out activate in rear access simulation Sucus Vitis viniferae, filter out the yeast saccharomyces cerevisiae that fast, thoroughly can complete fermentation.By the yeast saccharomyces cerevisiae after the screening of simulation Sucus Vitis viniferae, then through 2L Sucus Vitis viniferae fermentation lab scale, and by sensory evaluation, finishing screen selects yeast saccharomyces cerevisiae NX11424.
Through repeated screening, checking and wine making lab scale, pilot scale research, be separated from the cabernet sauvignon grape spontaneous fermentation later stage in vineyard, Guang Xiasan base, Ningxia the yeast saccharomyces cerevisiae NX11424 obtained, there is reliable Wine-making quality, comprise and open ferment fast, fermenting process is steadily thorough, volatile acid is low, and low yield steeps, high flocculation, low yield hydrogen sulfide, and there is good self-dissolving ability, have the stronger complete fermentation capacity of height sugar, fermented wine degree can more than 16%.
The 26SrRNA qualification result of yeast saccharomyces cerevisiae NX11424 (be preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms " center ", deposit number is CGMCCNO.10050) is as follows:
26SD1-D2 region sequence (580bp):
CCCACAACGGGGATTGCTTAGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTGAAA
With associative mode strain Saccharomyces cerevisiae NL64 similarity: 99.6%, be accredited as Saccharomyces Cerevisiae in S accharomycescerevisiae.
The 5.8S-ITS qualification result of yeast saccharomyces cerevisiae NX11424 (be preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms " center ", deposit number is CGMCCNO.10050) is as follows:
5.8S-ITS partial sequence (816bp):
CAAAAAACATCAATATTTTGAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAAGCGGGAGGAAGG
With associative mode strain Saccharomyces cerevisiae MUCL51208 similarity: 99.5%, be accredited as Saccharomyces Cerevisiae in S accharomycescerevisiae.
Embodiment 2, yeast saccharomyces cerevisiae NX11424 and commercial yeast F15 pilot scale wine brewing comparative experiments
Fig. 2 is shown in the technical process of following embodiment.
By broken for the fresh cabernet sauvignon grape destemming picking up from Ningxia Florian, add 50mg/L sulfurous gas, after 30min, add 20mg/L polygalacturonase, after mixing, measure the total acid of Sucus Vitis viniferae, total reducing sugar amount.Adopt fresh Sucus Vitis viniferae to carry out bacterial strain activation, test strain is linked in appropriate Sucus Vitis viniferae with 3% inoculum size, after cultivating 24h in 28 DEG C of constant incubators, by the test strain that activated with 10
6the inoculum size of cfu/mL joins in fermentor tank, bacterial strain establish 2 parallel.Leavening temperature is controlled at 22-25 DEG C, after fermentation 3d, again temperature is adjusted to 28-30 DEG C of every bu that carries out fermenting and early, middle and late three times pressure cap is carried out to fermentor tank, and the gentle proportion of the product sampling monitor fermentation liquid after pressure cap, when proportion is to 0.990-0.996, carry out the separation of skin slag, and survey reducing sugar, when reducing sugar content is less than 2g/L, adds 60mg/L sulfurous gas and terminate fermentation (with reference to Fig. 2). detect wine degree, total reducing sugar, total acid, volatile acid and sugar-free extract by GB/T15038-2006 after zymamsis terminates.The results are shown in Table 2.
The physical and chemical index * of grape wine sample after the zymamsis of table 2 test strain
Note: the detection of * physical and chemical index all operates according to GB/T15038-2006
Find that the brewing character of NX11424 is stablized by fermentation test, wine degree >=11% (v/v) of wine sample, difference≤2 of total reducing sugar (not higher than 9g/L) and total acid (tartrate meter), volatile acid≤1.2g/L, meets the requirement of GB15037-2006 to dry type grape wine index of correlation.
Within 2.12013 years, analytical results tasted by test strain sample that pilot scale is made wine
Followingly to be represented with F15# by F15 the made grape wine that ferments, represented with NX11424# by the yeast saccharomyces cerevisiae NX11424 grape wine made that ferments.
Through 21 members of Wine College, Xibei Univ. of Agriculture & Forestry Science & Technology TastingPanel of strict special training, carry out judging marking (table 3) to sample that test strain is made wine in 2013.
Table 3 test strain the trial test result of the sample TastingPanel that makes wine
Note: alphabetic flag represents significant difference, conspicuous level is 5%.
Two wine is significant difference in marking.Two wine is not remarkable in elegant fragrance degree, strong degree and Harmony, qualitatively difference, and in acidity, wine body, strong degree and state, difference is not remarkable, and there were significant differences in roundness degree, tannin intensity, texture, balance, level aftertaste.
The organoleptic feature of two wine is in table 4.
Table 4 test strain make the organoleptic feature of dry red winew
In mouthfeel, NX11424# is better than F15#, and the wine body of two wine is thick and heavy, and tannin structure is strong, and ductility is good.In fragrance, F15# has strong green pepper taste, and NX11424# mainly contains the taste of sootiness, Ribes nigrum L. and blackberry, blueberry.Generally, the aspect such as NX11424# tannin intensity, tannin texture, balance, Harmony, extensibility, gradation sense is significantly better than F15#.
Through physical and chemical index analysis and the subjective appreciation to test strain pilot scale wine sample, can draw, namely the grape wine that yeast saccharomyces cerevisiae NX11424 ferments have the ageing features such as sootiness without the oak barrel during aging in later stage, be the bacterial strain that a strain can be used for high-quality dry red winew and brewages, there is extremely strong application potential.
Test strain pilot scale in 2.22013 years sample oak barrel during aging of making wine tasted analysis after 4 months
(1) marking (table 5) is tasted
Table 52013 year test strain pilot scale sample oak barrel during aging of making wine tasted score after 4 months
By the Cabernet Sauvignon Claret brewageed by preferably saccharomyces cerevisiae NX11424 and contrast yeast saccharomyces cerevisiae F15, use Dai Pusi oak barrel, Vicard oak barrel and Sheng Gean oak barrel during aging 4 months respectively.Taste expert group to judge above-mentioned 6 wine samples respectively, score is in table 5.Result shows, the Cabernet Sauvignon Claret brewageed by preferred strain NX11424, and in three kinds of oak barrel, ageing is after 4 months, judges score and is all significantly better than contrasting F15, and wherein, the wine sample performance of ageing in Sheng Gean oak barrel is outstanding.
(2) local flavor analysis
Degree of giving off a strong fragrance, the fragrance Harmony of F15# are higher, and wine degree is higher, but are slightly short of in the elegance etc. of fragrance.NX11424# roundness degree is high, and stronger tannin intensity, tannin texture is better.In general, through the oak barrel during aging of 4 months, the yeast saccharomyces cerevisiae NX11424 overall local flavor of the Cabernet Sauvignon Claret that ferments is better than F15, in the roundness degree, tannin intensity etc. of wine body, especially all obviously will be better than the wine sample of F15, have stronger old potentiality.
(3) comment is tasted
A table 62013 year test strain pilot scale make wine sample oak barrel during aging after 4 months wine comment
Test strain pilot scale in 2.32013 years sample oak barrel during aging of making wine tasted analysis after 10 months
The trial test marking record of Florian ageing in 2013 the wine sample of 10 months is in table 7.
Table 72013 year test strain pilot scale sample oak barrel during aging of making wine tasted score after 10 months
2013 test strain pilot scales sample oak barrel during aging of making wine tastes record in table 8 after 10 months.
A table 82013 year test strain pilot scale make wine sample oak barrel during aging after 10 months wine comment
As can be seen from table 7-8, through the oak barrel during aging of 10 months, the Cabernet Sauvignon Claret brewageed by yeast saccharomyces cerevisiae F15, presented the fragrance of medium cloves, sootiness, vanilla, is attended by Ribes nigrum L., the fruital of the black berries such as blackberry, blueberry.Dry type, peracid, the very high tannin being paved with oral cavity, heavy wine body.The Cabernet Sauvignon Claret brewageed by native country yeast saccharomyces cerevisiae NX11424, presents the fragrance of strong vanilla, sootiness, dark chocolate, is attended by the fruital of Ribes nigrum L., the very high tannin having convergence sense being paved with oral cavity, heavy wine body, good old potentiality.The local flavor of two wine is different, and from the marking analysis of sensory evaluation, the score of NX11424# is higher than F15#, NX11424# the behaving oneself best of ageing in Sheng Gean oak barrel.
In sum, preferred strain NX11424 is brewageing in dry red winew process, shows good brewing character, and namely institute's vintage wine has the ageing features such as sootiness without the oak barrel during aging in later stage, has excellent ageing potentiality.Through the oak barrel during aging of 4 months and 10 months, obtain grape wine present the strong vanilla of organoleptic quality, sootiness, dark chocolate fragrance along with the fruital of Ribes nigrum L., the very high tannin having convergence sense being paved with oral cavity, heavy wine body, has good old potentiality.Therefore, yeast saccharomyces cerevisiae NX11424 is the native country Wine brewing yeast strain that a strain can be used for production high-quality dry red winew, has extremely strong application potential.
SEQUENCELISTING
<110> Xibei Univ. of Agricultural & Forest Science & Technology
<120> mono-strain has the yeast saccharomyces cerevisiae of ageing style and the application in wine making thereof
<130>2015
<160>2
<170>PatentInversion3.3
<210>1
<211>580
<212>DNA
<213> yeast saccharomyces cerevisiae NX11424
<400>1
CCCACAACGGGGATTGCTTAGTACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCT60
GGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCT120
ATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTT180
CTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTA240
AATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAA300
AGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGG360
CATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCAT420
TTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTC480
GGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTC540
AAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTGAAA580
<210>2
<211>816
<212>DNA
<213> yeast saccharomyces cerevisiae NX11424
<400>2
CAAAAAACATCAATATTTTGAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTT60
ACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCT120
TGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTG180
TTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAA240
CTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTAT300
CTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTA360
AAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGA420
TACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCC480
CTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTG540
GTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTT600
TTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGG660
TTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGA720
AGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCC780
GCTGAACTTAAGCATATCAATAAAGCGGGAGGAAGG816
Claims (3)
1. an Accharomyces cerevisiae NX11424, be preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms " center "; address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; preservation date: on November 25th, 2014; deposit number is CGMCCNO.10050, Classification And Nomenclature: Saccharomyces Cerevisiae in S accharomycescerevisiae.
2. yeast saccharomyces cerevisiae NX11424 as claimed in claim 1, is characterized in that: from the cabernet sauvignon grape spontaneous fermentation later stage in vineyard, Guang Xiasan base, Ningxia, the pure growth being through screening, being separated.
3. the application of yeast saccharomyces cerevisiae NX11424 in red wine is brewageed as described in 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510799787.7A CN105296369A (en) | 2015-11-19 | 2015-11-19 | Ageing-type saccharomyces cerevisiae and its use in wine making |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510799787.7A CN105296369A (en) | 2015-11-19 | 2015-11-19 | Ageing-type saccharomyces cerevisiae and its use in wine making |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105296369A true CN105296369A (en) | 2016-02-03 |
Family
ID=55194206
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510799787.7A Pending CN105296369A (en) | 2015-11-19 | 2015-11-19 | Ageing-type saccharomyces cerevisiae and its use in wine making |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105296369A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107916233A (en) * | 2018-01-09 | 2018-04-17 | 中国农业大学 | One Accharomyces cerevisiae and its application in the wine production of Beijing area |
| CN109402014A (en) * | 2018-11-20 | 2019-03-01 | 江南大学 | A kind of bacillus of cellulase-producing and its application |
| CN112280695A (en) * | 2020-11-18 | 2021-01-29 | 中国农业大学 | Native saccharomyces cerevisiae YT28 and application thereof in Matherland wine brewing |
| CN115558611A (en) * | 2022-10-24 | 2023-01-03 | 贵州大学 | Schizosaccharomyces japonicus strain with high flocculation property and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6012966A (en) * | 1983-07-05 | 1985-01-23 | Taiyo Hakko Kk | Honey grape wine |
| CN104480029A (en) * | 2014-11-20 | 2015-04-01 | 西北农林科技大学 | Wine yeast capable of low-yielding hydrogen sulfide and ethyl carbamate as well as screening method and application of wine yeast |
-
2015
- 2015-11-19 CN CN201510799787.7A patent/CN105296369A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6012966A (en) * | 1983-07-05 | 1985-01-23 | Taiyo Hakko Kk | Honey grape wine |
| CN104480029A (en) * | 2014-11-20 | 2015-04-01 | 西北农林科技大学 | Wine yeast capable of low-yielding hydrogen sulfide and ethyl carbamate as well as screening method and application of wine yeast |
Non-Patent Citations (4)
| Title |
|---|
| JEAN-LUC LEGRAS ET AL.: "Bread, beer and wine: Saccharomyces cerevisiae diversity reflects human history", 《MOLECULAR ECOLOGY》 * |
| KATE S. HOWELL ET AL.: "Genetic Determinants of Volatile-Thiol Release by Saccharomyces cerevisiae during Wine Fermentation", 《AEM》 * |
| 南博: "活性酿酒酵母的真空干燥技术研究", 《中国优秀硕士学位论文全文数据库 工程科技辑I辑》 * |
| 程仕伟等: "赤霞珠葡萄自然发酵过程中的酿酒酵母筛选及其发酵特性", 《酿酒科技》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107916233A (en) * | 2018-01-09 | 2018-04-17 | 中国农业大学 | One Accharomyces cerevisiae and its application in the wine production of Beijing area |
| CN109402014A (en) * | 2018-11-20 | 2019-03-01 | 江南大学 | A kind of bacillus of cellulase-producing and its application |
| CN112280695A (en) * | 2020-11-18 | 2021-01-29 | 中国农业大学 | Native saccharomyces cerevisiae YT28 and application thereof in Matherland wine brewing |
| CN115558611A (en) * | 2022-10-24 | 2023-01-03 | 贵州大学 | Schizosaccharomyces japonicus strain with high flocculation property and application thereof |
| CN115558611B (en) * | 2022-10-24 | 2024-02-23 | 贵州大学 | High flocculation property schizosaccharomyces japonica strain and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101792719B (en) | Saccharomyces cerevisiae and application thereof in wine brewing | |
| Bellon et al. | Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae | |
| CN109810910B (en) | High-yield ethanol yeast and method for improving quality of traditional fermented food by symbiotic fermentation of high-yield ethanol yeast and ester-producing yeast | |
| CN106701519B (en) | Method for improving content of total acid esters and reducing sugar in table vinegar by using high-ester-yield indigenous aroma-producing yeast enhanced Daqu | |
| Li et al. | Yeast species associated with spontaneous wine fermentation of Cabernet Sauvignon from Ningxia, China | |
| CN106753994B (en) | Method for improving alcohol content of alcohol fermentation liquor and reducing isoamyl alcohol content by using high-ester-yield indigenous aroma-producing yeast enhanced yeast | |
| CN105802865B (en) | One plant height fermentation activity and the fragrant characteristic of production ice brewer yeast outstanding and its application | |
| CN105296369A (en) | Ageing-type saccharomyces cerevisiae and its use in wine making | |
| CN101838615B (en) | Saccharomyces cerevisiae and application thereof in reducing acidity in process of producing wine | |
| Zhao et al. | Biodiversity of non-Saccharomyces yeasts associated with spontaneous fermentation of Cabernet Sauvignon wines from Shangri-La wine region, China | |
| CN108624518A (en) | Yeast strain and its application | |
| CN108410745B (en) | Saccharomyces cerevisiae and application thereof in wine brewing | |
| CN103243037B (en) | High temperature yeast for brewing msalais, preparation method thereof and brewed msalais | |
| CN106434397B (en) | One Accharomyces cerevisiae and its application | |
| CN104911114A (en) | High-throughput screening method for grape wine brewing microorganisms | |
| Sumby et al. | Ethanol‐tolerant lactic acid bacteria strains as a basis for efficient malolactic fermentation in wine: evaluation of experimentally evolved lactic acid bacteria and winery isolates | |
| CN116515654B (en) | Saccharomyces cerevisiae and application thereof in longan wine brewing | |
| CN110029070B (en) | Indigenous saccharomyces cerevisiae strain, screening method and application | |
| CN104357342B (en) | A kind of high-quality yeast of Xinjiang local characteristic crusty pancake dough and its application in system is cramed food into one's mouth | |
| CN114854609B (en) | Hansenula polymorpha serving as grape juice capable of increasing fermentation aroma of red date lactobacillus beverage and application of Hansenula polymorpha | |
| CN115895925A (en) | Saccharomyces cerevisiae Y28 and application thereof | |
| CN113773977B (en) | Yeast strain with low ethanol yield and high aroma yield and application thereof | |
| CN112522123B (en) | Acid-resistant saccharomyces cerevisiae and application thereof in high-acidity fruit fermented wine | |
| CN107937293A (en) | One plant of Fruity type saccharomyces cerevisiae and its application in the wine production of Beijing area | |
| CN112877226A (en) | Alcohol-resistant Issatchenkia terricola produced by ultraviolet mutation breeding and application thereof in wine brewing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160203 |
|
| RJ01 | Rejection of invention patent application after publication |