CN103243037B - High temperature yeast for brewing msalais, preparation method thereof and brewed msalais - Google Patents

Abstract

The invention discloses a high temperature yeast (Saccharomyces cerevisiae) CGMCC No.7513 for producing msalais through fermentation and msalais obtained by a preparation method through fermentation by utilizing the strain. By virtue of analysis at different temperatures, sugar degrees, alcohol contents and low nitrogen tolerances, metabolism property determination, detection of wine production capacity, flocculability, autolysis, H2S production capacity and biogenic amine production characteristic, determination of pectinase activity and determination test on activity of beta-glucosaccharase, the high temperature msalais yeast strain with excellent brewing performance is screened, and the high temperature msalais yeast strain is widely applied to the fields of light industry production and the like.

Description

Brewageing Musa's Lay of thermotolerant yeast, preparation method and the preparation of Musa's Lay think of thinks

Technical field

The present invention relates to microorganism and fermentation industry field.Specifically, the present invention relates to the drink technical field that a kind of Xinjiang Musa's Lay is thought yeast, preparation method and the acquisition thereof of brewageing.

Background technology

It is the most ancient grape wine in the Western Regions that Musa's Lay is thought, among the people also referred to as " solemn Sales ", " Musailesi ", " Mu Sailaisi ", " wooden Sai Laisi " and " Mei Sailaisi ", " Musa's Lay think of ", " solemn Seles " etc.What " the grape good wine " in Tang Dynasty in China verse " grape good wine luminous wine glass, wish drink plucked instrument Pa urges at once " referred to is exactly solemn Seles." Western Regions delicious wine " paid tribute the Gao Changwangxiang Tang Dynasty is also solemn Seles." grape solely need not be bent " (the LI Shi-Zhen < < of Ming Dynasty Compendium of Materia Medica > > volume 25), Musa's Lay is thought with Sucus Vitis viniferae spontaneous fermentation, to form exactly, do not hook and do not convert, without any " song " class additive, be therefore considered to the Western Regions in ancient times " living fossil " vinous.Among the people always brewage Musa's Lay think very general, " it is busy that cottage house in village's boils wine, the unrestrained farmers' of the fragrance generative forces of heaven and earth ".The masses drink Musa's Lay and think often to take that intoxicated intoxicated rear meaning is thrown off restraint for fast, sing heartily and dance wildly, and enjoy oneself to heart's content and happy, have reproduced the custom left by a preceding generation of Western Regions culture in ancient times, are the remaining threads of Western Regions culture in ancient times.Musa's Lay thinks to have become Xinjiang special product, and main product ground is in Awat County, and in the Awat County in Xinjiang, almost every household is all made wine.In same village, though have upper one hundred houses other, do not have a kind of identical solemn Seles yet.This is relevant with wine brewing people's age, personality, mood etc., they the individual character of oneself melt people solemn Seles suffered, be a kind of grape wine of the delicious sweet-smelling of brewageing, pharmaceutical use is high, is rich in nutritive ingredient and the trace element such as amino acid, multivitamin, glucose, iron of needed by human body.Musa's Lay is thought to belong to warm nature, is a kind of fully natural green drink, is following so far ancestors' making method, makes Musa's Lay think to have preserved in the oldest mode, can be rated as marrow and the soul of cutter youth culture.It is that Xinjiang uighur ' s culture utilization is eaten raw or the grape of the feeding habits of holding concurrently is got a kind of natural alcoholic beverage that juice, infusion, fermentation form that Musa's Lay is thought wine.The making method that Musa's Lay is thought and grape wine craft have very large different.Its basic technology be Uygur by grape extraction juice, first skin slag is added to water infusion (water had not just had skin slag) infusion, filter afterwards, filtrate is infusion again after mixing with squeezing juice, form Musa's Lay and think starting fermentation liquid, naturally cool to room temperature, pack vat into and carry out spontaneous fermentation and form.Brewer can add according to the demand of oneself that some localities produce once in a while rues greatly, white apricot, mulberry fruit, safflower, matrimony vine, pigeon, snow cock, deer blood, or even the roast whole lamb in Xinjiang.As the ecosystem drink with health-care effect and rich cultural inside information; Musa's Lay thinks progressively to become the important component part of local economic development; Musa's Lay is thought rapid expansion and the people's increasing rapidly its consumers demand in market; tradition Musa Lay thinks progressively to expose that it is underproduce; the birth defects such as levels of audit quality is uneven; can not guarantee the mass-producing sustainable development that Musa's Lay is thought, the urgent task that the reform that Musa's Lay is thought and innovation further develop for Musa's Lay think of.

Due to the Original that Musa's Lay is thought, also seriously restricted Musa's Lay and thought industrialized development.In local every household, can brewage Musa's Lay thinks; but the product brewing is uneven; and technique is also very backward; the technician that the deficient real grasp of the talent can be brewageed high-quality Musa's Lay think of is very few; the experience of brewageing of also just having grasped ancestors having, produces and but can not adapt to for the science of mass-producing.The making method of thinking due to Musa's Lay is different from the technique of vin ordinaire, thus for Musa's Lay, think brewage wine making teacher be the field that a slice is strange.

The critical process that tradition Musa Lay is thought brew is infusion and fermentation procedure; wherein fermentation procedure is subject to the impact of the factors such as wild-type strain, natural environmental condition and fermentation equipment; being the important factor that causes Musa's Lay think of quality fluctuation, is the main factor that restriction Musa Lay is thought large-scale production.For example, at Musa's Lay, think in complete spontaneous fermentation process, owing to being subject to Xinjiang significantly temperature difference fluctuation sooner or later, the impact of large number of biological heat etc. in fermenting process, cause karusen product temperature or too high, up to 37 ℃, too low, lowly reach 13 ℃, usually occur to postpone to inspire, stagnate fermentation, finish in advance the phenomenons such as fermentation, make fermentation period by 15d to 45d not etc., same infusion karusen, but final Musa's Lay think quality product as alcohol, acid, puckery, wait bitterly for certain individual event organoleptic feature be projected into various flavours and smell coordination pleasant high-quality not etc.Due under the driving of market interest, people arbitrarily change infusion and fermentation equipment etc. again, make traditional Musa's Lay think making method more complicated, and the development that traditional Musa's Lay is thought has a negative impact.

Prior art research shows, to wine yeast, multifarious formation has vital role to environmental factor, Musa's Lay is thought yeast diversity and genetic diversity and Musa's Lay, and to think unique brew environment relevant, the extreme inland weather of Xinjiang's Tarim Basin, its arid, short of rain, frostless season is long etc. all likely affects the diversity of local yeast.In addition, and between sampling point in material choice, extracting methods, infusion mode and time, in the operations such as spontaneous fermentation container, cycle and making processes centre halfback biological and ecological methods to prevent plant disease, pests, and erosion control be associated.Different juice extracting methods also may cause yeast count diversity difference in Sucus Vitis viniferae, and these all need to adopt the technique means of science studied and tackle key problems.Domestic at present, there is pair Musa's Lay to think the report of wild dominant bacteria in brew, but be suitable for local Musa's Lay, do not think the strain excellent of complicated brew environment and the report of supporting brewing process thereof.

For current Musa's Lay, think development and cross the stage with modern production in tradition processing, traditional technology innovation is the historic task that Musa's Lay is thought development.The principles of science of the brew of thinking according to Musa's Lay, Musa's Lay is thought to brew core technology, be that spontaneous fermentation operation is analysed scientifically, screening development is suitable for the technique that Musa's Lay is thought modern production excellent species and is applicable to stablize suitability for industrialized production, simultaneously again maximum horizontal retain traditional Musa's Lay think the advanced technologies of high-quality qualitative characteristics be to traditional Musa's Lay think improved at all.

Summary of the invention

For not having both at home and abroad at present, leavening property is good, Musa's Lay of better tolerance is thought special yeast, the invention provides a kind of better tolerance, and good thermotolerant yeast bacterial classification, the technique that definite production Musa Lay is thought and the Musa's Lay preparing thereof of leavening property thought.

The natural fermentation broth that the present invention thinks from Aksu, Xinjiang, the different Musa's Lays in Hotan Prefecture and Kaxgar Prefecture Musa's Lay think of producing region, sample, filter out a collection of well-grown yeast strain, therefrom optimize the thermotolerant yeast that a strain is numbered GTGM-E2, through being accredited as yeast, the definite zymotechnique of this bacterial strain can be produced Musa's Lay and think.

The present invention specifically provides a kind of better tolerance, the thermotolerant yeast bacterial classification that leavening property is good, numbering called after GTGM-E2, special with reference to J.A Barney and R.W Penn the is write saccharomycetic feature of < < and identification handbook > >, the < < yeast of writing according to Barnett etc.: feature with identify > >, < < microbial taxonomy > > and the Cavazza(1992 of Zhang Jizhong) etc. the people's such as people and Yang Ying (2007) bibliographical information, GTGM-E2 bacterial strain is carried out to morphology and Physiology and biochemistry evaluation, GTGM-E2 bacterial strain was preserved in the international depositary institution of budapest treaty microorganism before the applying date: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) preservation, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101, preservation date is on 04 23rd, 2013, preserving number is CGMCC No.7513.Through microbiology be accredited as yeast saccharomyces cerevisiae ( saccharomyces cerevisiae).This yeast is cultivated through WL nutrient agar, and colony characteristics is cream-colored, with or without light green, and spherical protuberances, smooth surface, opaque, butteriness, YPD solid culture bacterium colony is oyster white, butteriness, surface smoothing, neat in edge, YPD liquid nutrient medium is cultivated without film or web, and test tube bottom has white consolidation precipitation, cellular form is circular or oval, and multiterminal sprout, and produces spore, and spore is circular, has 1～4 spores in sporocyst, utilizes Methionin substratum to carry out selectivity cultivation, does not grow, can glucose fermentation, synanthrin, lactose, raffinose, maltose, sucrose, assimilable carbon source is: glucose, semi-lactosi, methylglucoside, lactic acid, lactose, sucrose, maltose, cellobiose, wood sugar, pectinose, trehalose, melizitose, raffinose, 2-Acetamido-2-deoxy-D-glucose, melibiose, Xylitol, glycerol, sorbyl alcohol, red fresh alcohol, ring biose amine and the test of inositol citric acid all show negative, can not utilize saltpetre, urease test, DBB experiment, anti-0.01% and 0.1% cycloheximide experiment and all negative without VITAMIN growth experiment, by the above results and through 26S rDNA homology analyze, Phylogenetic Analysis result, will be numbered GTGM-E2 identification of strains and be yeast belong ( saccharomyces) in yeast saccharomyces cerevisiae ( saccharomyces cerevisiae).

Meanwhile, the present invention is providing on the basis of GTGM-E2 yeast strain, the production technique that further provides a kind of Musa's Lay to think, and concrete steps are as follows:

(1) distiller's yeast preparation: by yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) the fresh culture thing of GTGM-E2 CGMCC No.7513 on YPD solid medium, in the grape infusion juice of access 24Brix, cultivate 24h for 28 ℃, standby.

(2) raw material selection with rinse: manually by foreign matters such as stones and go rotten, the sort out from grape material such as Chinese olive, choose clean grape and utilize tap water that silt is rinsed well.

(3) squeeze the juice: utilize the grape of crusher by above-mentioned steps (2) selection and after rinsing to dig up the roots after fragmentation, utilize expeller to squeeze, Sucus Vitis viniferae is pumped into Buffer Pool, carry out quiescent setting, then squeeze into steam cooker.

(4) infusion: add to flood the water yield that skin slag is advisable in the grape skin that step (3) is squeezed out, infusion 2h～6h, enduring well-done skin pulp water filters, Sucus Vitis viniferae after skin pulp water after filtration and squeezing is with 1:3 ~ 1:8(v:v) ratio squeeze into steam oven and boil infusion, regularly detecting pol end of a period pol is 22Brix～25Brix.

(5) cooling: steam off, with water coolant, step (4) infusion juice is carried out coolingly, be cooled to 35 ℃ to squeeze in fermenting container.

(6) fermentation: step (1) is prepared to fresh distiller's yeast, 1% (v/v) inoculum size by total fermented liquid accesses cooled grape infusion juice, inoculation temp is 32 ℃ ~ 35 ℃, 20 ℃-30 ℃ of envrionment temperatures are fermented, product temperature is 25 ℃～37 ℃, optimal temperature is 28 ℃, regularly detects pol, until pol no longer reduces.

(7) after-ripening, sterilization and filling: after fermentation ends, carry out after-ripening; after-ripening temperature must not surpass 25 ℃, and wine and schlempe are placed 40 ~ 45d, and supernatant liquor is imported in clean container; before filling, carry out 65 ℃ ~ 75 ℃ sterilization 30min, cooling and cool the temperature to room temperature, then carry out filling; If filling not in time, container to be filled, the sterilization conditions before filling is the same.

The yeast isolation substratum of selecting in the present invention is as follows:

YPD liquid nutrient medium (g/L): glucose 20 g, peptone 20 g, yeast extract paste 10 g, are dissolved in distilled water and are dissolved to 1000 mL, pH value nature.YPD solid medium adds 20 g agar, 121 ℃ of autoclaving 20 min; WL nutrient agar (g/L): yeast soaks powder 4 g, peptone 5 g, glucose 50 g, potassium primary phosphate 0.55 g, Repone K 0.425 g, calcium chloride 0.125 g, magnesium sulfate 0.125 g, iron(ic) chloride 0.025 g, manganous sulfate 0.025 g, agar 20 g, tetrabromo-mcresolsulfonphthalein 22 mg, 6.5,121 ℃ of sterilizing 20 min of pH.

Bacterial strain yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 preservation protective material: glycerine

(1) yeast saccharomyces cerevisiae of selecting in the present invention is identified substratum and reagent: YPD mushy stage substratum is the same, WL nutrient agar is the same, Gorodkowa substratum: glucose 0.1%, peptone 1%, NaCl0.5%, agar 2%,, pH value nature, 121 ℃ of sterilizing 20 min, Methionin substratum, in 1L, contain: D-Glucose 10g, L-Histidine 1mg, DL-methionine 2 mg, DL-Trp 2mg, Para-Aminobenzoic 200 μ g, vitamin H 20 μ g, folic acid 2 μ g, inositol 10mg, nicotinic acid 400 μ g, pantothenic acid 2mg, pyridoxine hydrochloride 400 μ g, Riboflavin Tetrabutyrate 00 μ g, vitamin 400 μ g, boric acid 500 μ g, crystallization cupric chloride 40 μ g, potassiumiodide 100 μ g, crystallization iron(ic) chloride 200 μ g, crystalline sulfuric acid manganese 400 μ g, crystallization Sodium orthomolybdate 200 μ g, crystalline sulfuric acid zinc 400 μ g, potassium primary phosphate 850 mg, dipotassium hydrogen phosphate 150 mg, crystalline sulfuric acid magnesium 500 mg, sodium-chlor 100 mg, crystallization calcium chloride 100 mg, lysine hydrochloride 2.5 g, agar 20 g, pH value nature, 121 ℃ of sterilizing 20 min,

(2) Physiology and biochemistry is identified substratum: sugar-fermenting substratum: 0.5% yeast extract, 121 ℃ of sterilizing 20min; Base is supported on carbon source basis: (NH4) 2,SO4 0.5%, KH2PO40.1%, and MgSO4.7H2O 0.05%, yeast extract paste 0.02%, 2%, 115 ℃ of sterilizing 15min of washing agar; Nitrogenous source basic medium: every liter contains carbon source (D-Glucose) 10g, amino acid (L-Histidine 1mg, DL-methionine 2mg, DL-Trp 2mg), somatomedin (right-benzaminic acid 200ug, vitamin H 20ug, folic acid 2ug, inositol 10ug, nicotinic acid 400ug, pantothenic acid 2mg, pyridoxine hydrochloride 400ug, Riboflavin Tetrabutyrate 00ug, vitamin 400ug), trace element (H ₃bO ₃500ug, CuSO ₄.5HO ₂40ug), salt (KI 100ug, FeCl ₃.6HO ₂200ug, MnSO ₄.4HO ₂400ug, Na ₂moSO ₄.2HO ₂200ug, ZnSO ₄.7HO ₂400ug), assimilation nitrogenous source, selects saltpetre; Urea element substratum: peptone 0.1%, potassium primary phosphate 0.2%, sodium-chlor 0.5%, phenol red 0.0012%, agar 2%, adds degerming urea soln after filtration after PH6.8 sterilizing, be that the ultimate density of urea reaches 2%; Anti-cycloheximide substratum: in every liter, contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-Trp 20ug), 3.5g ammonium sulfate and 0.01% and 0.1% cycloheximide, all the other compositions are with nitrogenous source basic medium; Without VITAMIN growth test media: in every liter, contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-Trp 20ug), 5g ammonium sulfate,, containing raw somatomedin, all the other are not with nitrogenous source basic medium.

Sequential analysis reagent: Tris(Amresco), SDS(Amresco), EDTANa2(Amresco), DNA Marker DL2000 (Dongsheng bio tech ltd, Guangdong), TE damping fluid, agarose (Spain), 2 * Tag PCR Master Mix is purchased from Novi gloomy (Beijing) bio tech ltd; TAE damping fluid (50 * stock solution pH8.5,242 g Tris alkali, 57.1 mL Glacial acetic acid, 37.2 g Na2EDTA2H2O, add ddH2O to 1 L, used time is diluted to 1 *), by 26S rDNA primer, check order, specifically adopt 26S rDNA primer: NL1(5 '-GCATATCAATAAGCGGAGGAAAAG-3 '); NL4(5 '-GGTCCGTGTTTCAAGACGG-3 '), sequence is specifically referring to sequence subordinate list.

The present invention also further provides the Musa's Lay that utilizes high temperature bacterial strain GTGM-E2 fermentation to prepare to think, and the Musa's Lay that possesses fine quality is thought product.

(1) physical and chemical index: alcoholic strength: 10～13% (V/V); Total reducing sugar: < 6 g/L; Total acid: 6～9g/L.

(2) Oranoleptic indicator: color and luster: there is the typical color and luster feature that Musa's Lay is thought, brown, color and luster is dim, evenly muddy; Smell: have outstanding caramel odor, aroma is strong fragrant, pure, and typicalness is strong; Mouthfeel: mouthfeel is plentiful, Harmony is good, and pleasant impression is long, and typicalness is strong.

The invention provides Musa's Lay and think the method that physical and chemical index test adopts: the mensuration of total reducing sugar: GB/T 15038-2006 direct titrimetric method; The mensuration of alcoholic strength: GB/T 15038-2006 Ebullioscope method; Total acid: GB/T 15038-2006 potentiometric titration; Reducing sugar: GB/T 15038-2006 direct titrimetric method, these methods are all the common methods in this area.

By implementing the concrete technical indicator of the present invention, realize content of the present invention, can reach following beneficial effect:

(1) the invention provides a strain leavening property good, the Thermotolerant yeast of better tolerance ( saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513, having made up current Musa's Lay and thought the present situation that special yeast lacks, the Musa's Lay that is particularly applicable to thermophilic fermentation is thought special yeast.

(2) the present invention thinks on the concrete grasp such as industry, brewing process, qualitative characteristics basis traditional Musa's Lay, carry out large-scale Musa's Lay and think yeast separation and screening, and screening strain is carried out to batch production Musa Lay and think fermenting experiment, the good S. cervisiae of acquisition advantage, completes the development of the high temperature pure breed fermentation process that is suitable for high-end Musa's Lay think of.Obtained good Musa's Lay and thought product, its color and luster is dim, for Musa's Lay is thought distinctive pure brown, evenly muddy, have outstanding caramel odor, aroma is strong fragrant, pure, rich in taste, have good Harmony, pleasant impression is long, has enriched current China fruit wine produce market.

Accompanying drawing explanation

Fig. 1 is shown as Musa's Lay and thinks high-heat fermentation process schema.

Fig. 2 be shown as yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 colonial morphology figure, in figure, first half component is colonial morphology on YPD substratum, Lower Half component is colonial morphology on WL substratum.

Fig. 3 be shown as yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 cellular form and spore shape figure, in figure, first half component is cellular form, Lower Half component is spore shape.

Fig. 4 be shown as yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 phylogenetic evolution tree graph.

Fig. 5 is shown as Musa's Lay and thinks traditional natural fermentation hypoglycemic Logisic fitting of a curve figure.

Fig. 6 be shown as adopt yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 thermophilic fermentation prepares Musa's Lay and think Logisic hypoglycemic fitting of a curve figure.

Fig. 7 be shown as Musa's Lay think to adopt spontaneous fermentation and yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) hypoglycemic (Brix) rate diagram during GTGM-E2 CGMCC No.7513 thermophilic fermentation.

Embodiment

Key instrument and equipment: PL202 electronic balance, plum Teller-Tuo benefit Instrument Ltd.; HPX-9272 digital display electric heating incubator, Shanghai Medical Equipment Plant of Bo Xun Industrial Co., Ltd.; LDZX-40BI autoclave, Shenan Medical Appliances Factory, Shanghai; GZX-9420 electric heating constant-temperature blowing drying box, Shanghai Boxun Industrial Co., Ltd.; SW-CJ-2F Bechtop, Shanghai Boxun Industrial Co., Ltd.; HHW.21.600 electric heating constant-temperature water-bath tank, Beijing is bright Medical Instruments factory forever; Fcycler96 hole PCR reacts instrument, Bio-Rad company; DYY-6C type electrophoresis apparatus, Liuyi Instruments Plant, Beijing; GEL Doc2000 gel image analyser, Bio-Rad company; HPX-9272 MBE digital display electric heating incubator, SW-CJ-2F Bechtop, Medical Equipment Plant of Shanghai Boxun Industrial Co., Ltd.; LHS-250SC fixed temperature and humidity incubator, Changzhou Zhong Jie laboratory apparatus Manufacturing Co., Ltd; LDZX-50KB vertical pressure steam sterilizer, Shenan Medical Appliances Factory, Shanghai; Biolog, U.S. BioTek Instruments company; Vernier callipers, Shanghai measuring tool company limited; WHB 96 microwell plates, Wei Hong bio tech ltd, Shanghai City; 1000 ml liquid-transfering guns, Shanghai Ai Bende biotechnology International Trading Company Ltd; HPX-9272 MBE digital display electric heating incubator, SW-CJ-2F Bechtop, Medical Equipment Plant of Shanghai Boxun Industrial Co., Ltd.; LDZX-50KB vertical pressure steam sterilizer, Shenan Medical Appliances Factory, Shanghai; C21-RT2103 electromagnetic oven, EG720FF1-NR microwave oven, the living electric apparatus Manufacturing Co., Ltd of Guangdong U.S.; G4B20C5E1C6B71 revolves steaming evaporimeter, Japanese Eyela company.BL3100 electronic balance, German Sartorius company; SCW-CA-650 desktop vertical current clean bench, Suzhou grand auspicious purification Science and Technology Ltd..G4B20C5E1C6B71 revolves steaming evaporimeter, Japanese Eyela company.BL3100 electronic balance, German Sartorius company.Hand-held saccharometer, Shanghai Tian Lei instrument company limited; Ebullioscope, Shanghai doctor's joint control temperature instrument plant.PHS-3B type pH meter, Shanghai Hong Yi instrument company limited; HH-2 digital display thermostat water bath, Jintan City Jie Ruier Electrical Appliances Co., Ltd; 25 L fermentor tanks (factory) and ceramic fermentor tank (workshop), commercially available.

The raw material of selecting is hetian red grape, originates from South Sinkiang, Xinjiang Xinjiang's Tarim Basin area.

All bacterial classifications and the raw and auxiliary material in the present invention, selected, and the spawn culture condition of selecting and method be all well known selecting, the % relating in the present invention is generally the ratio of weight, and indivedual differences separately explain.

embodiment mono-: the screening of bacterial classification, separation, Purification and Characterization

strain separation method

1. the collection in yeast separation source: be collected in 8 of Southern Xinjiangs in 9～October in 2010 and there are typical Musa's Lay think of making method workshop and factory's 49 increment liquid.Sample liquid comprise new squeezing contain skin slag or containing the Sucus Vitis viniferae of skin slag, just at Sucus Vitis viniferae, the 0 d(starting fermentation liquid of infusion, i.e. cooled grape infusion juice) fermented liquid and from different times fermented liquid in the porcelain altar of differ in size (50-500 L) or stainless steel fermentor tank (20 t).Sampling is taken out sample liquid to pack immediately in Plastic Bottle (sample liquid rinse 3 times) into and with the syringe of rinse (sample liquid rinse 3 times), inhale 10mL sample liquid extremely in 20 mL phials of sterilization zone plug again by the special-purpose scoops of producer, build bottle stopper and put into 4 ℃ of vacuum flask with sealed membrane sealing, in 12 h, transport sample back laboratory and mix with sterile glycerol 1:1, putting into-20 ℃ of refrigerators and save backup.

2. strain separating and purification process: institute's sample thief is done to 10 dilution gradient, get its 3 suitable serial dilution gradients, respectively get 0.1mL, coat WL and YPD solid medium, in constant temperature, support 28 ℃ of cultivation 2～3 d in case, picking list bacterium colony, after purifying is cultivated on YPD solid medium, carries out ℃ preservation of glycerine pipe-20 standby.Unfermentable sample separation bacterial strain is controlled at 15 ~ 20 strains/sample, and 20 ~ 40 strains/sample is controlled in the sample separation strain of yeast phase.

the isolation and identification method of bacterial classification

1. saccharomycetic Morphological Identification: colonial morphology is observed: yeast is rule on YPD and WL solid medium, cultivate 2～3 d, observe its colonial morphology for 28 ℃; Cellular form is observed: 28 ℃ of cultivations of the liquid inoculation of YPD 2 days, microscopic examination; Observations On The Spore Morphology: 28 ℃ of cultivations of Gorodkowa substratum 7 days, adopt Victoria Green WPB-luxuriant red colouring method that spore is carried out to spore staining, microscopic examination.

Liquid culture observation of characteristics: bacterial classification is inoculated in YPD liquid nutrient medium, cultivates 2～3 d for 28 ℃, observe whether ferment, whether nutrient solution muddy, whether forms the palamas such as Huan Huo island, the how many and degree of tightness situation of precipitation capacity.

2. Methionin selectivity culture identification: inoculation is after YPD liquid nutrient medium activation 24h, inoculum size according to 1% is inoculated into carries out hunger in the sterilized water of 2 mL and processes, after 7d, streak inoculation is to Methionin substratum, after 28 ℃ of cultivation 5d, observe whether there is yeast growth, after cultivating 48h, do not have the continuation that bacterium colony occurs to cultivate, until after 15d still the explanation without colony growth may be yeast saccharomyces cerevisiae.Test result is that not raw elder is yeast saccharomyces cerevisiae on Methionin substratum.

By above-mentioned yeast isolation and morphology test for identification, know.

49 increment liquid are separated to 699 saccharomycetes altogether, in Table 1, form according to yeast on WL substratum and color, it is 20 Cultural types that 699 saccharomycetes that Awat County different fermentations technique Musa Lay can be thought to be separated in sample liquid gather, wherein 482 strain WL cultivation colony characteristicses are by cream color, with or without light green, spherical protuberances, smooth surface, opaque, butteriness, YPD solid culture bacterium colony is oyster white, butteriness, surface smoothing, neat in edge, YPD is liquid to be cultivated without film or web, and test tube bottom has white consolidation precipitation; Then utilize Methionin substratum to carry out selectivity culture identification these bacterial strains, every strain bacterium is cooked three repetitions, and the yeast that screening can not be grown has 436 strains.436 strain typical strains are carried out to cellular form and Observations On The Spore Morphology reinspection, further confirm its classification position.

By above-mentioned identification of morphology and Methionin, select to cultivate, 436 strains in 699 strain isolateds are initially identified as to yeast saccharomyces cerevisiae, comprising being numbered GTGM-E2 bacterial strain, its colonial morphology and microscopic morphology are referring to accompanying drawing 2, accompanying drawing 3.

physiology and biochemistry is identified:

According to form and Methionin selective medium, tentatively determine that the bacterial strain that is numbered GTGM-E2 carries out sugar-fermenting, carbon nitrogen source assimilation, anti-defence line bacterium ketone, without VITAMIN growth, urea decomposition, the experiments such as the blue B of diazo, carry out Physiology and biochemistry evaluation.

Sugar-fermenting experiment: add respectively glucose, synanthrin, lactose at sugar-fermenting substratum, raffinose, maltose, sucrose utilizes Du Shi pipe fermentation method at 28 ℃, cultivate 1 week, whether observe and record in Du Shi pipe gas accumulation therebetween every day and burden, detect whether to testing sugar, there is fermenting power.

Carbon assimilation experiment: growth popularize law, in nitrogenous source basic medium, test glucose, semi-lactosi, lactose, sucrose, maltose, cellobiose, methylglucoside, wood sugar, pectinose, trehalose, melizitose, raffinose, 2-Acetamido-2-deoxy-D-glucose, melibiose, Xylitol, glycerol, sorbyl alcohol, red fresh alcohol, ring biose amine, inositol, lactic acid, whether citric acid, cultivate observed and recorded result after 2～3 days, detect it and grow for 28 ℃.

Nitrate assimilation experiment: growth popularize law, in carbon source basic medium, add saltpetre, 28 ℃, whether observed and recorded result after 2～3 days, detect it and grow.

Urease test: the aseptic technique of urea element liquid nutrient medium, the 0.5mL of take puts into respectively in many test tubes as portion, and deep refrigeration stores six weeks.The Yeast culture of get a ring growth 1 day or 2 days, is seeded in above-mentioned substratum, 37 ℃ of cultivations.Checking the variation of a test tube color per half an hour, the red urease activity that represents. all yeast that are positive can become redness within 4 hours.

The blue B(DBB of diazo) test: cultivation bacterial classification of at least 10 days on YPD solid medium, be placed on 55 ℃ of a few hours, if then soaked, flooding in ice-cold DBB reagent. this culture becomes garnet at room temperature 2 minutes, and this result is registered as the positive so.

Anti-cycloheximide experiment: the test bacterium access of fresh activation is cultivated to 2-3d, observation period upgrowth situation containing carrying out 28 ℃ in 0.01% and 0.1% substratum.

Table 1 Musa Lay is thought yeast isolation source and strain isolated number

Without VITAMIN growth experiment: the test bacterium access of fresh activation is cultivated to 2-3d, observation period upgrowth situation without 28 ℃ of VITAMIN growth test cultures base rows.

Qualification result is as follows: being numbered GTGM-E2 can glucose fermentation, synanthrin, lactose, raffinose, maltose, sucrose, assimilable carbon source is: glucose, semi-lactosi, methylglucoside, lactic acid, all the other carbon source tests all show negative, can not utilize saltpetre, urease test, DBB experiment, anti-0.01% and 0.1% cycloheximide experiment, all negative without VITAMIN growth experiment, be accredited as yeast belong ( saccharomyces) in yeast saccharomyces cerevisiae ( saccharomyces cerevisiae).

Select numbering called after GTGM-E2, special with reference to J.A Barney and R.W Penn the is write saccharomycetic feature of < < and identification handbook > >, the < < yeast of writing according to Barnett etc.: feature with identify > >, < < microbial taxonomy > > and the Cavazza(1992 of Zhang Jizhong) etc. the people's such as people and Yang Ying (2007) bibliographical information, GTGM-E2 bacterial strain is carried out to morphology and Physiology and biochemistry evaluation, GTGM-E2 bacterial strain was preserved in the international depositary institution of budapest treaty microorganism before the applying date: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) preservation, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101, preservation date is on 04 23rd, 2013, preserving number is CGMCC No.7513.Through microbiology be accredited as yeast saccharomyces cerevisiae ( saccharomyces cerevisiae).This yeast is cultivated through WL nutrient agar, and colony characteristics is cream-colored, with or without light green, and spherical protuberances, smooth surface, opaque, butteriness, YPD solid culture bacterium colony is oyster white, butteriness, surface smoothing, neat in edge, YPD liquid nutrient medium is cultivated without film or web, and test tube bottom has white consolidation precipitation, cellular form is circular or oval, and multiterminal sprout, and produces spore, and spore is circular, has 1～4 spores in sporocyst, utilizes Methionin substratum to carry out selectivity cultivation, does not grow, can glucose fermentation, synanthrin, lactose, raffinose, maltose, sucrose, assimilable carbon source is: glucose, semi-lactosi, methylglucoside, lactic acid, lactose, sucrose, maltose, cellobiose, wood sugar, pectinose, trehalose, melizitose, raffinose, 2-Acetamido-2-deoxy-D-glucose, melibiose, Xylitol, glycerol, sorbyl alcohol, red fresh alcohol, ring biose amine and the test of inositol citric acid all show negative, can not utilize saltpetre, urease test, DBB experiment, anti-0.01% and 0.1% cycloheximide experiment and all negative without VITAMIN growth experiment, be numbered GTGM-E2 bacterial strain be initially identified as yeast belong ( saccharomyces) in yeast saccharomyces cerevisiae ( saccharomyces cerevisiae).

sequential analysis is identified:

DNA extracts: according to form and growth characteristics, identify and the tentatively definite bacterial strain that is numbered GTGM-E2 of Methionin selective medium, measure its 26S rDNA sequence, carry out homology comparison with gene order in gene pool, be defined as yeast saccharomyces cerevisiae.On aseptic inoculation ring picking YPD flat board, well-grown single bacterium colony is in 1.5mL sterilized water centrifuge tube, 4 ℃ of 12000 r/min, and centrifugal 6 min, abandon supernatant; Get 200 μ L lysates (100 mmol/L T ris, 30 mmol/L EDTA, 0.5% SDS), fully mix thalline is suspended completely;-80 ℃ of freezing 5 min(fully charges), 95 ℃ of these steps of water-bath 2 min(in triplicate); Add 200 μ L chloroforms: 12000 r/min after primary isoamyl alcohol (24:1), centrifugal 5 min of room temperature, are transferred to supernatant in another aseptic 1.5 mL centrifuge tubes, and ethanol on the rocks is to 1 mL, natural subsidence 5 min under room temperature, 12000 r/min, centrifugal 5 min; Abandon supernatant liquor, add 500 mL 75% ethanol, 12000 r/min, centrifugal 5 min; Abandon supernatant liquor, natural air drying precipitation under room temperature; DNA precipitation is dissolved with 30 μ L TE, and-20 ℃ save backup.26S rDNA PCR amplification: use primer a pair of: NL1(5 '-GCATATCAATAAGCGGAGGAAAAG-3 ') and NL4(5 '-GGTCCGTGTTTCAAGACGG-3 ')

Through the 26S rDNA gene fragment in 26S rDNA pcr amplification yeast genomic dna.PCR reaction system cumulative volume is 25 μ L, and every pipe adds 10 μ L ultrapure waters, 12 μ L 2 * Taq PCR MasterMix(TaqDNA polysaccharase 0.05 units/ul, MgCl2 4 mM, dNTPs 0.4 mM), each 1 μ L of 10 μ mol/L primers, masterplate DNA 1 μ L.PCR reaction conditions is: 95 ℃ of 5 min of denaturation; 94 ℃ of 1 min of sex change, 52 ℃ of 1 min that anneal, extends 72 ℃ of 1 min20 s, circulates 36 times; 72 ℃ of 8 min of total elongation.Expansion reaction is carried out on fcycler96 hole PCR reaction instrument.After finishing, reaction gets 5 μ L reaction product with 1% sepharose, 120 V in TE damping fluid, electrophoresis 30 min, and dyeing 5 min electrophoresis detection, gel imaging system imaging, qualified PCR product carries out sequencing, and concrete sequence is referring to attached sequence table.

Sequencing result is analyzed: sequencing result is carried out to Blast comparison, and selecting homology is more than 99% bacterial strain, and the bacterial strain of other kinds, utilizes Clastal and MEGA 4.0 softwares to set up phylogenetic tree, determines the growth status of identified bacterial strain.

After above-mentioned 436 Accharomyces cerevisiae fermentation character primary dcreening operations, the front 10 strain bacterium of grey relational grade sequence are carried out to 26S rDNA sequential analysis, bacterium numbering is shown in accompanying drawing 4, further identifies its molecules classification position.With reference strain ( saccaromyces cerevisaehM191642) sequence similarity > 99.9%, by N-J method phylogenetic tree construction, further verifies this 10 strain all and Reference Strains saccaromyces cerevisaehM191642 cluster is gang, thus bacterium numbering be GTGM-E2 be accredited as yeast saccharomyces cerevisiae ( saccharomyces cerevisiae), referring to accompanying drawing 4.

The GTGM-E2 yeast isolation substratum that is numbered of selecting in the present invention adopts as follows:

YPD liquid nutrient medium (g/L): glucose 20 g, peptone 20 g, yeast extract paste 10 g, are dissolved in distilled water and are dissolved to 1000 mL, pH value nature.YPD solid medium adds 20 g agar, 121 ℃ of autoclaving 20 min; WL nutrient agar (g/L): yeast soaks powder 4 g, peptone 5 g, glucose 50 g, potassium primary phosphate 0.55 g, Repone K 0.425 g, calcium chloride 0.125 g, magnesium sulfate 0.125 g, iron(ic) chloride 0.025 g, manganous sulfate 0.025 g, agar 20 g, tetrabromo-mcresolsulfonphthalein 22 mg, 6.5,121 ℃ of sterilizing 20 min of pH.

3. bacterial strain preservation protective material: glycerine

The GTGM-E2 that is numbered selecting in the present invention identifies substratum and reagent: YPD mushy stage substratum is the same, WL nutrient agar is the same, Gorodkowa substratum: glucose 0.1%, peptone 1%, NaCl0.5%, agar 2%,, pH value nature, 121 ℃ of sterilizing 20 min, Methionin substratum, in 1L, contain: D-Glucose 10g, L-Histidine 1mg, DL-methionine 2 mg, DL-Trp 2mg, Para-Aminobenzoic 200 μ g, vitamin H 20 μ g, folic acid 2 μ g, inositol 10mg, nicotinic acid 400 μ g, pantothenic acid 2mg, pyridoxine hydrochloride 400 μ g, Riboflavin Tetrabutyrate 00 μ g, vitamin 400 μ g, boric acid 500 μ g, crystallization cupric chloride 40 μ g, potassiumiodide 100 μ g, crystallization iron(ic) chloride 200 μ g, crystalline sulfuric acid manganese 400 μ g, crystallization Sodium orthomolybdate 200 μ g, crystalline sulfuric acid zinc 400 μ g, potassium primary phosphate 850 mg, dipotassium hydrogen phosphate 150 mg, crystalline sulfuric acid magnesium 500 mg, sodium-chlor 100 mg, crystallization calcium chloride 100 mg, lysine hydrochloride 2.5 g, agar 20 g, pH value nature, 121 ℃ of sterilizing 20 min.

Physiology and biochemistry is identified substratum: sugar-fermenting substratum: 0.5% yeast extract, 121 ℃ of sterilizing 20min; Base is supported on carbon source basis: (NH ₄) 2SO ₄0.5%, KH ₂pO ₄0.1%, MgSO ₄.7H ₂o 0.05%, yeast extract paste 0.02%, 2%, 115 ℃ of sterilizing 15min of washing agar; Nitrogenous source basic medium: every liter contains carbon source (D-Glucose) 10g, amino acid (L-Histidine 1mg, DL-methionine 2mg, DL-Trp 2mg), somatomedin (right-benzaminic acid 200ug, vitamin H 20ug, folic acid 2ug, inositol 10ug, nicotinic acid 400ug, pantothenic acid 2mg, pyridoxine hydrochloride 400ug, Riboflavin Tetrabutyrate 00ug, vitamin 400ug), trace element (H ₃bO ₃500ug, CuSO ₄.5HO ₂40ug), salt (KI 100ug, FeCl ₃.6HO ₂200ug, MnSO ₄.4HO ₂400ug, Na ₂moSO ₄.2HO ₂200ug, ZnSO ₄.7HO ₂400ug), assimilation nitrogenous source, selects saltpetre; Urea element substratum: peptone 0.1%, potassium primary phosphate 0.2%, sodium-chlor 0.5%, phenol red 0.0012%, agar 2%, adds degerming urea soln after filtration after PH6.8 sterilizing, be that the ultimate density of urea reaches 2%; Anti-cycloheximide substratum: in every liter, contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-Trp 20ug), 3.5g ammonium sulfate and 0.01% and 0.1% cycloheximide, all the other compositions are with nitrogenous source basic medium; Without VITAMIN growth test media: in every liter, contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-Trp 20ug), 5g ammonium sulfate,, containing raw somatomedin, all the other are not with nitrogenous source basic medium.

embodiment bis-: strain excellent screening experiment

By being numbered the commercial yeast saccharomyces cerevisiae of 436 Accharomyces cerevisiaes of GTGM-E2 and 5 strains comprising of above-mentioned screening and separating and preliminary evaluation, carry out basic fermentation character test analysis, comprise the analyses of differing temps, pol, wine degree and low nitrogen tolerance, rise send out property mensuration, wine output ability, flocculence, from dissolubility, produce H ₂s ability, the detection of producing biogenic amine characteristic, pectinase activity mensuration and activity of beta-glucosidase determination and analysis are as follows:

1. the basic fermentation character test analysis of strain isolated

(1) differing temps, pol, wine degree and low nitrogen tolerance are analyzed: 436 Accharomyces cerevisiaes that are numbered to GTGM-E2 comprising after identifying and 5 strains commercialization yeast saccharomyces cerevisiae carry out under suitable condition (can absorbed nitrogen 300mg/L, 26% sugar, 28 ℃ of substratum), high pol (Musa's Lay is thought synthetic medium its pol is adjusted to 45% and 50%), different wine precision (think to contain 8% in synthetic medium by Musa's Lay, 10%, 14%, 6% ethanol), (Musa's Lay is thought synthetic medium to differing temps, 13 ℃, 37 ℃, 45 ℃), its tolerance behavior of culture assays under low nitrogen (Musa's Lay is thought synthetic medium and can absorbed nitrogen be made as 56mg/L) condition.Wherein 28 ℃ of temperature, can absorb nitrogenous source 300mg/L, 26% sugar tolerates other control conditions in condition test for each.

Fresh culture thing is inoculated in after the above-mentioned nutrient solution of 5ml, gets 300 μ l cultures in 96 microwell plates, surveys its OD under 590 nm ₁value.Culture after cultivating 72 h, 28 ℃ (temperature tolerance is as the criterion with differing temps gradient) is surveyed to its absorbancy OD under 590 nm ₂.In experiment, using do not connect bacterial classification substratum as check sample OD _k.Increase multiple=(OD ₂-OD _k2)/(OD ₁-OD _k1)-1.

(2) rise and send out a property and measure: by bacterial strain access fermentation activate in vitro, shake up, cultivate at 28 ℃, routine observation is inverted the interior gas collection of Du Shi pipe and whether is deposited and burden, every 4 h, records once.From being inoculated into aerogenesis, reaching 0.1 mL required time and send out the time being decided to be, result represents in the following manner: 4 represent from send out the time institute's aerogenesis body within 4h and be full of Du Shi pipe, wherein 4 ⁺the expression time short (about 2h), 4 ^-the expression time long a little (about 4h); 3 represent from send out the time institute's aerogenesis body within 8h and be full of Du Shi pipe; 2 tables not from send out the time institute's aerogenesis body within 12h and be full of Du Shi pipe; 1 represent from send out the time institute's aerogenesis body after 12h and be full of Du Shi pipe.

(3) wine output ability: the bacterial classification having activated is inoculated into TTC lower floor substratum, and 28 ℃ of constant temperature culture 24 h, pour 15 ml TTC upper strata substratum into, cover original bacterium colony, lucifuge insulation 2～3 h, observe colony colour at 28 ℃.Micro-red (wine output ability is weak), represents with 1; Pink (wine output ability is general), represents with 2; Dark red (wine output ability is strong), represents with 3.

(4) flocculence: bacterium to be measured is inoculated in the centrifuge tube that 1.5 mL YPD liquid nutrient mediums are housed, centrifugal collection bacterium mud after 28 ℃ of standing cultivation 48 h, with 250 mmol/L EDTA solution and sterilized water, respectively clean twice, centrifugal collection thalline is also suspended from flocculation damping fluid (50 mmol/L Trisodium Citrates, 20 mmol/L CaCl ₂) in, with Biolog, at wavelength 590 nm places, survey OD ₁value; Then cell suspension is placed in to 25 ℃, 120 r/ min vibrate 2 h to having flocculated, and standing 30 min of room temperature get supernatant liquor and at wavelength 590nm place, survey OD ₂value.Flocculation level (F)=(OD ₁-OD ₂)/OD ₁* 100%.This yeast of the larger expression of F value more easily flocculates.

(5) from dissolubility: the bacterial classification having activated is inoculated in to YPD-BCIP substratum, transfers in 37 ℃ of environment and cultivate after 20 ℃ of cultivation 24 h, observe colony colour after 24 h, the depth that whether changes and change according to it judges its self-dissolving level.

(6) produce H ₂s ability is measured: each test strain is seeded on BIGGY nutrient agar, in 30 ℃ of cultivation 4d ~ 7d, continues to observe colony colour and changes, and investigates each test strain produce H according to shade ₂s ability.1: oyster white; 2: light brown; 3: brown; 4: dark-brown; 5: brownish black.It is stronger that numerical value is higher, color more shows that H2S produces ability.

(7) produce the detection of biogenic amine characteristic: the bacterial classification having activated is inoculated in determination of biogenic amines substratum, 25 ℃ of cultivations, after 3 d, observe periphery of bacterial colonies substratum colour-change, when yeast will make the pH of substratum during to the alkalogenic biogenic amine of amino acid decarboxylase, raising, there is purple circle in periphery of bacterial colonies.

(8) pectinase activity is measured: the bacterial classification having activated is inoculated in to 30 ℃ of polygalacturonic acid nutrient agars and cultivates 5 d.After striking off bacterium colony with the bamboo let of sterilizing, with distilled water, wash down, with the aortic of 0.08 g/100 mL, observe its colour-change after 6 h, according to occurring whether purple circle judges whether it has pectinase activity, it is strong and weak that enzyme is produced in the depth of purple representative.

(9) activity of beta-glucosidase is measured: the bacterial classification having activated is inoculated in to polychrom Glycerin Agar substratum, and 25 ℃ of cultivations, observe periphery of bacterial colonies colour-change after 8d, and periphery of bacterial colonies substratum occurs that Vandyke brown circle illustrates to have activity of beta-glucosidase.With the diameter of the dark brown chromosphere of vernier caliper measurement, according to the size of chocolate loop diameter, judge that it produces enzyme strong and weak.

(10) data analysing method: use Weighted Grey Correlation Analysis to analyze the above-mentioned basic fermentation character of 441 strain yeast (containing the commercial bacterium of 5 strains), filter out front 5 strain strain excellents.

By the basic fermentation character analysis of above-mentioned yeast saccharomyces cerevisiae and strain excellent screening, know.

Adopt different types of synthetic medium and semisynthetic medium, 436 Accharomyces cerevisiaes after identifying and the commercial yeast saccharomyces cerevisiae of 5 strains are carried out to different tolerance (resistance to pol, ethanol-tolerant degree, heatproof degree, low nitrogen etc.), work the property sent out, flocculence, from dissolubility, produces biogenic amine characteristic, qualitative wine output ability, produce the quantitative or qualitative analysis of hydrogen sulfide, produce polygalacturonase and beta-glucosidase aptitude tests, utilize grey relational grade analysis, front 5 strains that filter out grey relational grade sequence are thought the alternative bacterial strain of strain strain excellent as Musa's Lay, in Table 2.

Through basic fermentation character test, the 5 strain preponderant strainses that filter out work the property sent out all higher than rank of the commercial bacterium of 5 strains, and 1 strain wine output ability is medium, and all the other 4 strain wine output abilities are partially strong, the weak hydrogen sulfide that produces, do not produce biogenic amine, all the other indexs show most bacterium better tolerance, flocculence, from dissolubility, and produce polygalacturonase and beta-glucosidase good, part of properties is far away higher than commercial bacterial strain, in Table 3, table 4.

Through above-mentioned measuring, learn and be numbered GTGM-E2 can absorbed nitrogen 300mg/L, pol 26Brix, cultivate under optimal growth conditions for 28 ℃, its energy for growth (its biomass) is apparently higher than the commercial bacterial strain of 5 strains, and in test strain growing ability, be best, resistance to 37 ℃ with 45 ℃ of high temperature tests in its OD ₅₉₀value is still the highest in test strain, in Table 4, proves that this bacterial strain has good growth and breeding ability in high-temperature cultivation, for thermophilic fermentation Musa Lay is thought candidate's strain excellent.This bacterial strain has higher resistance to high sugar simultaneously, and the ability of resistance to low nitrogen and play fast volatility is produced wine moderate, strong flocculence with by force from dissolubility, a little less than sulfite reductase active (producing hydrogen sulfide ability), can produce polygalacturonase and beta-glucosidase, do not produce biogenic amine, in Table 3, table 4.

The commercial bacterium weighted association of the front 5 strain quality yeast bacterium of table 2 and 5 strains degree

Strain number	Weighted association degree	In 441 strain bacterium, strengthen associated order
			GTGM-E2	0.941	1
F1-7d2-04	0.939	2
			C1-AR3-03	0.938	3
LTSM-1	0.933	4
			B3-23d1-02	0.928	5
cy3079	0.908	8
			RZ	0.882	16
L2323	0.871	29
			EC118	0.871	29
R796	0.869	33

The basic leavening property of the commercial bacterial strain of the table 3 good S. cervisiae of 5 strain and 5 strains

Table 3 annotation: rise and send out a property evaluation: 4 represent from send out the time institute's aerogenesis body within 4h and be full of Du Shi pipe, wherein 4 ⁺the expression time short (about 2h), 4 ^-the expression time long a little (about 4h); 3 represent from send out the time institute's aerogenesis body within 8h and be full of Du Shi pipe; 2 tables not from send out the time institute's aerogenesis body within 12h and be full of Du Shi pipe; 1 represent from send out the time institute's aerogenesis body after 12h and be full of Du Shi pipe; From dissolubility evaluation: 1: blueness; 2: light blue; 3: yellowish green; 4: oyster white; Produce polygalacturonase evaluating characteristics: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; Activity of beta-glucosidase is evaluated: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; Wine output ability is evaluated: 1 micro-red (wine output ability is weak); 2: pink (wine output ability is general); 3: dark red (wine output ability is strong); Sulfite reductase is evaluated: 0: white (not producing); 1: oyster white; 2: light brown; 3: brown; 4: dark-brown; 5: brownish black (very strong enzyme is lived); Produce polygalacturonase evaluating characteristics: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; Product activity of beta-glucosidase is evaluated: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; Produce biogenic amine characteristic: test strain to tyrosine, phenylalanine, Histidine, tryptophane, arginine metabolism produces biogenic amine characteristic, and 0 represents not produce.

The commercial bacterial strain resistance characteristics of the table 4 good S. cervisiae of 5 strain and 5 strains

The basic fermentation character substratum of yeast saccharomyces cerevisiae and reagent in the present invention:

1.YPD mushy stage substratum is the same.

2.TTC lower floor substratum: glucose 10.0 g/L, peptone 2.0 g/L, yeast extract 1.5 g/L, KH ₂pO ₄1.0 g/L, MgSO ₄7H ₂o 0.4 g/L, pH value 5.5～5.7 agar 30.0 g/L, 121 ℃ of autoclaving 20min.

3.TTC upper strata substratum: TTC 0. 5 g/L, glucose 5.0 g/L, agar 15 g/L, 121 ℃ of autoclaving 20min; Musa's Lay is thought the preparation (every liter) of synthetic medium: 130 g glucose, 130 g fructose, 6 g citric acids, 6g DL-oxysuccinic acid, 750 mg KH ₂pO ₄, 500 mg KH ₂sO ₄, 250 mg MgSO ₄7H ₂o, 155 mg CaCl ₂2H ₂o, 200 mg NaCl, 4 mg MnSO ₄h ₂o, 4 mg ZnSO ₄, 1 mg CuSO ₄5H ₂o, 1 mg KI, 0.4 mg CoCl ₂6H ₂o, 1 mg H ₃bO ₃, 1 mg NaMoO ₄2H ₂o, 20 mg inositols, 2 mg nicotinic acid, 1.5 mg calcium pantothenate, 0.25 mg VITMAIN B1,0.25 mg vitamin B6, and 0.003 mg vitamin H, 15 mg ergosterols, 5 mg sodium oleates, 0.5 ml tween-80.The composition of nitrogenous source (wt/wt): 2.81% ammonium nitrogen (NH ₄cl), 39.03% L-PROLINE, 4.31%L-glutamine, 23.46% L-arginine, 3.13% L-Trp, 2.58% ALANINE, 2.64% Pidolidone, 2.03% Serine, 1.73% L-threonine, 1.75% L-Leu, 1.12%L-aspartic acid, 1.43% Valine, 2.34%L-phenylalanine, 1.04% ILE, 1.79% L-Histidine, 1.32%L-tyrosine, 1.09%L-glycine, 6.49% 1B, 0.24% methionine(Met).Filtration sterilization.

4. tolerance test media: can be adjusted into respectively 56.03 mg/L and 300 mg/L by absorbed nitrogen in (1) simulation Sucus Vitis viniferae, form low nitrogen tolerance substratum and normal nitrogen growth medium; (2) in simulation Sucus Vitis viniferae, add respectively 26%, 45% and 50% (wt/wt) glucose and fructose (1 ︰ 1), form different pol tolerance substratum; (3) in simulation Sucus Vitis viniferae substratum, add 8%, 10%, 12% and 14%(v/v) dehydrated alcohol, form different wine degree tolerance substratum; (4) temperature tolerance substratum is normal nitrogen growth medium.

5. send out property: packing 10 mL hetian red grape infusion juice in test tube, put into inverted Durham's fermentation tube, with being repeatedly inverted gently test tube after test tube plug sealing, make Durham's fermentation tube fill Sucus Vitis viniferae, 115 ℃ of autoclaving 15 min, standby.

6. from dissolubility, detect substratum: yeast extract paste 1%, peptone 2%, glucose 2%, agar 2%, 0.004%, 121 ℃ of autoclaving 20min of BCIP (the chloro-3-indyl-disodic alkaliine of the bromo-4-of 5-).

7. determination of biogenic amines substratum: glucose 2%, peptone 2%, yeast extract paste 1%, agar 2%, 0.006% purpurum bromocresolis, 1% corresponding amino acid (Histidine, tyrosine, phenylalanine, tryptophane, Methionin and arginine), adjust pH to 6.3,121 ℃ of autoclaving 20min.

8. pectinase activity detects substratum: polygalacturonic acid 1%, and YNB 0.67%, potassium primary phosphate 0.68%, glucose 1%, 3%, 121 ℃ of sterilizing of agar, 20 min(agar separate sterilizing).

9. activity of beta-glucosidase detects substratum: 1% polychrom, 0.03% iron trichloride, 1% caseinhydrolysate, 0.8% glycerine, 2.5% yeast extract paste, 2% agar, adjust pH to 6.0,121 ℃ of autoclaving 20min.

embodiment tri-: utilize yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 high-heat fermentation process prepares Musa's Lay and think

5 strain screening strains and the commercial bacterium of cy3079 (contrast) are carried out to the pilot scale fermentation test of 25L in Awat County, Xinjiang cutter youth Musa Lai Si factory, simulation Musa Lay is thought the growing environment of yeast, with the spontaneous fermentation of not inoculating bacterial classification in contrast, probe into these yeast and Musa's Lay is thought the impact of quality under modern making method, to filter out, be applicable to the strain excellent that Musa's Lay is thought modern making method.

1. adopt high-heat fermentation process flow process and operation as follows, referring to accompanying drawing 1.

(1) distiller's yeast preparation: by yeast saccharomyces cerevisiae ( saccharomyces cerevisiae) fresh culture thing on GTGM-E2 CGMCC No.7513 YPD solid medium, in the grape infusion juice of access 24Brix, cultivate 24h for 28 ℃, standby.

(2) raw material selection with rinse: manually by foreign matters such as stones and go rotten, the sort out from grape material such as Chinese olive, choose clean grape and utilize tap water that silt is rinsed well.

(3) squeeze the juice: utilize the grape of crusher by above-mentioned steps (2) selection and after rinsing to dig up the roots after fragmentation, utilize expeller to squeeze, Sucus Vitis viniferae is pumped into Buffer Pool, carry out quiescent setting, then squeeze into steam cooker.

(4) infusion: add to flood the water yield that skin slag is advisable in the skin slag of squeezing out in step (3), infusion 2h～6h, enduring well-done skin pulp water filters, Sucus Vitis viniferae after skin pulp water after filtration and squeezing is with 1:3 ~ 1:8(v:v) ratio squeeze into steam oven and boil infusion, regularly detecting pol end of a period pol is 22Brix～25Brix.

(5) cooling: steam off, with water coolant, step (4) infusion juice is carried out coolingly, be cooled to 35 ℃ to squeeze in fermenting container.

(6) fermentation: step (1) is prepared to fresh distiller's yeast, by the 1%(v/v of total fermented liquid) inoculum size accesses cooled grape infusion juice, inoculation temp is 32 ℃ ~ 35 ℃, 20 ℃-30 ℃ of envrionment temperatures are fermented, product temperature is 25 ℃～37 ℃, optimal temperature is 28 ℃, regularly detects pol, until pol no longer reduces.

(7) after-ripening, sterilization and filling: after fermentation ends, carry out after-ripening; after-ripening temperature must not surpass 25 ℃, and wine and schlempe are placed 40 ~ 45d, and supernatant liquor is imported in clean container; before filling, carry out 65 ℃ ~ 75 ℃ sterilization 30min, cooling and cool the temperature to room temperature, carry out filling; If filling not in time, container to be filled, the sterilization conditions before filling is the same.

2. fermentation process monitoring: during the fermentation, utilize saccharometer measure the Brix of fermented liquid and utilize temperature and test article temperature every 24h.Until the continuous 2～3d of pol no longer falls, be decided to be fermentation termination, finish fermentation.

3. factory industry fermenting experiment results and analysis: think traditional technology according to Musa's Lay screening strain (take commercial bacterial strain cy3079 and spontaneous fermentation are contrast) is carried out to thermophilic fermentation, its technical process is referring to accompanying drawing 1.Carry out during the fermentation the wine degree of periodic analysis pol and leavened prod, residual sugar, total acid and organoleptic feature, its result is as follows.

No matter be spontaneous fermentation or pure-blood ferment, substrate (in this case sugar) consumption law meets Logistic Changing Pattern, yBrix=A2+(A1-A2)/(1+(xd/x0) ^p)), but parameter A 1, A2 and P and the Logistic fitted figure thereof of screening between strain, contrast strain and spontaneous fermentation all have remarkable difference, in Table 5, see accompanying drawing 5, accompanying drawing 6.With respect to pure-blood ferment, spontaneous fermentation prior fermentation hypoglycemic (Brix) is still in the stuck fermentation stage, and purebred thermophilic fermentation enters rapidly yeast phase, shown in accompanying drawing 5, further explains that pure-blood ferment can significantly shorten the conclusion of fermentation period.With respect to low temperature fermentation, high temperature pure-blood ferment has not only shortened the hypoglycemic lag phase (shortening 10d) of earlier fermentation), and the obvious high spontaneous fermentation of the hypoglycemic speed of yeast phase, referring to accompanying drawing 5, accompanying drawing 6, the soluble thermophilic fermentation cycle is significantly shorter than the low temperature fermentation cycle thus.In 10 strain screening strains, GTGM-E2 ferments first 4 days in, and hypoglycemic (Brix) rate surpasses 50%, and apparently higher than other bacterial strains and spontaneous fermentation, and total Brix amount of falling is for the highest, is finally down to 8.1Brix, referring to accompanying drawing 7.

In thermophilic fermentation process, selected bacterial strain rise the time of sending out with fermentation period far less than spontaneous fermentation in factory (rise and send out a time 5d, fermentation period is 16d), play a time in 1 day, fermentation period is in 6～10 days, and wherein GTGM-E2 fermentation period is the shortest (6d).With natural wine ratio, each physical and chemical index difference is little: wine degree is between 10.9%～12.2%, and wherein GTGM-E2 wine degree is the highest, is 12.2%; Total acid, higher than commercial bacterium 5.36g/L, is 6.34g/L～6.83 g/L, and total reducing sugar and reducing sugar are respectively between 5.50 g/L～6.50g/L and 2.50 g/L～3.10 g/L, in Table 6.

To sum up test knownly, GTGM-E2 is that a applicable thermophilic fermentation dry type Musa Lay is thought desirable strain.

In table 5 traditional natural fermentation (thermophilic fermentation) process, pol (Brix) changes Logistic mathematical model parameter

Bacterium number	A1 value	A1 standard deviation	A2 value	A2 standard deviation	X0 value	X0 standard deviation	P value	P standard deviation	R2	Prob＞F
											Spontaneous fermentation	24.21	0.41	11.70	1.05	6.51	0.26	7.02	1.69	0.9780	0.00
LTSM-A1	163.04	1350.31	-1.80	15.42	0.01	0.39	0.41	0.74	0.9970	0.00
											GTGM-E2	150.48	2611.98	-3.64	43.68	0.01	0.57	0.34	1.52	0.9910	0.00
F1-7d2-04	23.82	0.87	7.98	0.24	2.05	0.11	2.80	0.33	0.9955	0.00
											C1-AR3-03	23.94	2.18	6.12	1.14	2.43	0.31	1.40	0.32	0.9956	0.00
B3-23d1-02	24.82	2.45	6.23	1.52	2.62	0.34	1.39	0.37	0.9940	0.00
											cy3079	31.93	10.27	6.06	1.80	1.45	0.82	1.26	0.53	0.9911	0.00

Table 6 screening strain thermophilic fermentation Musa Lay is thought statistics of features table

Bacterial strain	Rise and send out time d	Fermentation period d	Wine degree %	Total acid g/L	Total reducing sugar g/L	Reducing sugar g/L
							Spontaneous fermentation	5	16	11.8	6.34	6.00	2.90
LTSM-A1	1	8	12.2	6.34	5.80	2.70
							B3-23d1-02	1	10	11.2	6.50	6.30	2.90
C1-AR3-03	1	7	12.1	6.99	5.40	3.10
							GTGM-E2	1	6	12.2	6.77	5.70	2.80
F1-7d2-04	1	10	11.4	6.50	6.00	2.50
							cy3079	1	7	11.8	5.36	5.90	2.70

embodiment tetra-: Musa's Lay is thought subjective appreciation method

Invite 10 to there is Musa's Lay and think the expert of trial test experience and the expert that brew Musa Lay is thought, to Musa's Lay of above-mentioned workshop brew row subjective appreciation of pursuing progress.Because Musa's Lay is thought color and luster, turbidity and camerlsed and raw material have direct relation, 6 strain test strains (containing the commercial bacterium of 1 strain) and natural fermentation broth come from same batch of raw material, fermented wine is at color and luster, opacity, very close between typicalness (camerlsed), according to Musa's Lay, think provincial standard DB65/T 2925-2008, by expert, it is done to unified qualitative description; On being subject to yeast to affect the fragrant feature of larger ferment and flavor characteristics is carried out order minor sort, according to GB GBT/12315-2008/ISO:8578, carry out statistical study, seek the difference between wine brewing product.According to Musa's Lay, think quality characteristic, sequence target setting is that ferment is fragrant, fragrance Harmony, and acidity, sugariness, odor prolongation, comments the person of tasting that the sample of tasting after contrast is sequentially inserted to the sensory evaluation scores table shown in table 7.In test, identical for examination condition, test code number adopts 2 random bit digital, puts at random in face of valuation officer and tastes.

Table 7 Musa Lay is thought sensory evaluation scores table

Index	1	2	3	4	5	6	7
								Sweet-smelling
Sweet
								Acid
Fragrance Harmony
								Odor prolongation

7 parts of high temperature brew Musa Lays of table 8 are thought subjective appreciation F check significance (α=0.05)

Odour characteristics	Sweet-smelling	Fragrance Harmony	Sugariness	Acidity	Odor prolongation
						F value	13.436	2.275	2.524	5.660	13.436
Significance	0.000	0.047	0.030	0.000	0.000

7 parts of high temperature brew Musa Lays of table 9 are thought subjective appreciation T-test two-tailed test (α=0.05)

Known by above-mentioned subjective appreciation, the characteristic feature that Musa's Lay of free bacterial strain, commercial bacterial strain and traditional natural fermented soy is thought sample compares, and obtained wine thereby product are very close, are brown, and color and luster is dark, evenly muddy, gives caramel odor.7 parts of Musa's Lays are thought test sample, sweet-smelling, sugariness, acidity, fragrance Harmony and persistence have the significance difference opposite sex, in Table 8, and GTGM-E2 all there were significant differences between Musa's Lay of sweet-smelling, fragrance Harmony and commercial bacterium cy3079 and the brew of spontaneous fermentation institute is thought property wherein, aspect sugariness, think significant difference with spontaneous fermentation Musa Lay, aspect odor prolongation, there is significant difference with commercial bacterium, in Table 9, aspect acidity and with reference to no significant difference (data do not show).Aspect sweet-smelling and between spontaneous fermentation and commercial bacterium, there is significant difference in LTSM-A1, F1-7d2-04 makes Musa's Lay and thinks there is being remarkable difference with spontaneous fermentation and commercial bacterium aspect fragrance Harmony, and C1-AR3-03 has significant difference with two with reference to product on odor prolongation, B3-23d1-01 has significant difference with commercial bacterium cy3079 in sweet-smelling and fragrance Harmony, in Table 9, investigate sense organ product determine rank with, in 7 duplicate samples, GTGM-E2 tests sample in sweet-smelling and fragrance Harmony rank sum higher than other, wherein sweet-smelling sum of ranks 60, test sample in for the highest, acidity sum of ranks 24, in test specimens, sum of ranks is minimum, in Table 10, odor prolongation and sugariness are moderate, be respectively 34 and 36, test index sum of ranks is sequentially: sweet-smelling > fragrance Harmony > odor prolongation > sugariness > acidity, Musa's Lay think of feature that bacterial strain GTGM-E2 makes is that aroma is strong fragrant, pure, mouthfeel is plentiful, there is good fragrance Harmony and persistence.

As can be seen here, be numbered GTGM-E2 bacterial classification can absorbed nitrogen 300mg/L, pol 26Brix, under the optimal growth conditions of 28 ℃ of cultivations, its energy for growth (its biomass) is apparently higher than the commercial bacterial strain of 5 strains and free bacterial strain, and resistance to 37 ℃ and 45 ℃ of high temperature capabilities the strongest, the high sugar of ability, the ability of resistance to low nitrogen and play fast volatility, product wine is moderate, strong flocculence with by force from dissolubility, a little less than sulfite reductase active (producing hydrogen sulfide ability), can produce polygalacturonase and beta-glucosidase, not produce biogenic amine.In thermophilic fermentation process, can enter rapidly yeast phase, high hypoglycemic speed characteristic, worked the time of sending out in 1 day, and fermentation period is short, is only 6 days.Musa's Lay of institute's brew is thought wine degree 12.2%, total acid 6.77g/L, total reducing sugar 5.50 g/L, reducing sugar 2.50 g/L.There is Musa's Lay and think the characteristic feature of sample, brown, color and luster is dark, evenly muddy, give caramel odor, aroma is strong fragrant, pure, there is good Harmony and persistence moderate, sour and sweet palatability, in sum, shows that bacterium numbering is that GTGM-E2 bacterial classification is that a kind of applicable thermophilic fermentation dry type Musa Lay is thought desirable strain.

Table 10 thermophilic fermentation Musa Lay is thought subjective appreciation cartogram

SEQUENCE LISTING 1

The Zhu Lixia of <110> Tarim University

<120> 26S rDNA primer

<130> NL1

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

<213> primer NL1

<400> 1

gcatatcaataagcggaggaaaag 24

SEQUENCE LISTING 2

The Zhu Lixia of <110> Tarim University

<120> 26S rDNA primer

<130> NL4

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

<213> primer NL4

<400> 1

ggtccgtgtttcaagacgg 19

SEQUENCE LISTING 3

The Zhu Lixia of <110> Tarim University

<120> Musa's Lay is thought Thermotolerant yeast

<130> GTGM-E2

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 583

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

cacgggatgc ttagtacggc gagtgagcgg caaaagctca aatttgaaat ctggtacctt 60

cggtgcccga gttgtaattt ggagagggca actttggggc cgttccttgt ctatgttcct 120

tggaacagga cgtcatagag ggtgagaatc ccgtgtggcg aggagtgcgg ttctttgtaa 180

agtgccttcg aagagtcgag ttgtttggga atgcagctct aagtgggtgg taaattccat 240

ctaaagctaa atattggcga gagaccgata gcgaacaagt acagtgatgg aaagatgaaa 300

agaactttga aaagagagtg aaaaagtacg tgaaattgtt gaaagggaag ggcatttgat 360

cagacatggt gttttgtgcc ctctgctcct tgtgggtagg ggaatctcgc atttcactgg 420

gccagcatca gttttggtgg caggataaat ccataggaat gtagcttgcc tcggtaagta 480

ttatagcctg tgggaatact gccagctggg actgaggact gcgacgtaag tcaaggatgc 540

tggcataatg gttatatgcc gcccgtcttg aaacacggac caa 583

Claims (3)

1. can produce Thermotolerant yeast (Saccharomyces cerevisiae) GTGM-E2 that Musa's Lay is thought, the preserving number of this yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) GTGM-E2 is CGMCC No.7513.

2. one kind is utilized yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) GTGM-E2 described in claim 1 to produce the method that Musa's Lay is thought, it is characterized in that, be suitable for carrying out purebred thermophilic fermentation Musa Lay at 28 ℃ and think, the highest product temperature can be up to 37 ℃, and described method concrete steps comprise:

(1) distiller's yeast preparation: by the fresh culture thing of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) GTGM-E2 CGMCCNo.7513 on YPD solid medium, in the grape infusion juice of access 24Brix, cultivate 24h for 28 ℃, standby;

(2) raw material selection with rinse: manually by foreign matters such as stones and go rotten, the sort out from grape material such as Chinese olive, choose clean grape to utilize tap water that silt is rinsed well;

(3) squeeze the juice: utilize the grape of crusher by above-mentioned steps (2) selection and after rinsing to dig up the roots after fragmentation, utilize expeller to squeeze, Sucus Vitis viniferae is pumped into Buffer Pool, carry out quiescent setting, then squeeze into steam cooker;

(4) infusion: add to flood the water yield that skin slag is advisable in the grape skin of squeezing out in step (3), infusion 2h～6h, enduring well-done skin pulp water filters, Sucus Vitis viniferae after skin pulp water after filtration and squeezing is squeezed into steam oven with the ratio of 1:3～1:8 (v:v) and is boiled infusion, and regularly detecting pol end of a period pol is 22Brix～25Brix;

(5) cooling: steam off, with water coolant, step (4) infusion juice is carried out coolingly, be cooled to 35 ℃ to squeeze in fermenting container;

(6) fermentation: fresh distiller's yeast prepared by step (1), 1% (v/:v) inoculum size by total fermented liquid accesses cooled grape infusion juice, inoculation temp is 32 ℃～35 ℃, 20 ℃-30 ℃ of envrionment temperatures are fermented, product temperature is 25 ℃～37 ℃, optimal temperature is 28 ℃, regularly detects pol, until pol no longer reduces;

(7) after-ripening, sterilization and filling: after fermentation ends, carry out after-ripening, after-ripening temperature must not surpass 25 ℃, and wine and schlempe are placed 40～45d, and supernatant liquor is imported in clean container, before filling, carry out 65 ℃～75 ℃ sterilization 30min, cooling and cool the temperature to room temperature, carry out filling; If filling not in time, container to be filled, the sterilization conditions before filling is the same.

3. one kind is utilized yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) GTGM-E2 described in claim 1 to produce Musa's Lay that Musa's Lay think of method prepares to think.