CN103243037A - High temperature yeast for brewing msalais, preparation method thereof and brewed msalais - Google Patents

Abstract

The invention discloses a high temperature yeast (Saccharomyces cerevisiae) CGMCC No.7513 for producing msalais through fermentation and msalais obtained by a preparation method through fermentation by utilizing the strain. By virtue of analysis at different temperatures, sugar degrees, alcohol contents and low nitrogen tolerances, metabolism property determination, detection of wine production capacity, flocculability, autolysis, H2S production capacity and biogenic amine production characteristic, determination of pectinase activity and determination test on activity of beta-glucosaccharase, the high temperature msalais yeast strain with excellent brewing performance is screened, and the high temperature msalais yeast strain is widely applied to the fields of light industry production and the like.

Description

Brewageing Musa's Lay of thermotolerant yeast, preparation method and the preparation of Musa's Lay think of thinks

Technical field

The present invention relates to microorganism and fermentation industry field.Specifically, the present invention relates to the drink technical field that a kind of Xinjiang Musa's Lay is thought yeast, preparation method and the acquisition thereof of brewageing.

Background technology

It is the most ancient grape wine in the Western Regions that Musa's Lay is thought, among the people being also referred to as " solemn Sales ", " Musailesi ", " Mu Sailaisi ", " wooden Sai Laisi " and " Mei Sailaisi ", " Musa's Lay think of ", " solemn Seles " etc.What " the grape good wine " in the Tang Dynasty in China verse " grape good wine luminous wine glass, desire drink plucked instrument Pa urges at once " referred to is exactly solemn Seles.High prosperous king also is solemn Seles to " Western Regions delicious wine " paid tribute the Tang Dynasty." grape solely need not be bent " (Ming Dynasty's LI Shi-Zhen Compendium of Material Medica rolls up 25), Musa's Lay is thought to form with Sucus Vitis viniferae spontaneous fermentation exactly, does not collude and does not convert, and therefore no any " song " class additive is considered to the Western Regions in ancient times " living fossil " vinous.Among the people always brewage Musa's Lay think very general, " it is busy that cottage house in village's boils wine, the fragrance generative forces of heaven and earth overflow farmers' ".It often be fast with intoxicated that the masses drink that Musa's Lay thinks, and intoxicated back meaning is thrown off restraint, and sings heartily and dances wildly, and enjoys oneself to heart's content and happy, has reproduced the custom left by a preceding generation of Western Regions culture in ancient times, is the surplus thread of Western Regions culture in ancient times.Musa's Lay is thought to have become the Xinjiang special product, and main product ground is in the Awat County, and in the Awat County in Xinjiang, almost every household is all made wine.In the same village, though have last one hundred houses other, do not have a kind of identical solemn Seles yet.These ages, personality, mood etc. with the wine brewing people are relevant, they the individual character of oneself melt the people solemn Seles suffered, be a kind of grape wine of the delicious sweet-smelling of brewageing, the pharmaceutical use height is rich in nutritive ingredient and the trace element such as amino acid, multivitamin, glucose, iron of needed by human body.Musa's Lay is thought to belong to warm nature, is a kind of fully natural green drink, is following ancestors' making method so far, makes Musa's Lay think to have preserved in the oldest mode, can be rated as marrow and the soul of cutter youth culture.It is that Xinjiang uighur ' s culture utilization is eaten raw or the grape of the feeding habits of holding concurrently is got a kind of natural alcoholic beverage that juice, infusion, fermentation form that Musa's Lay is thought wine.The making method that Musa's Lay is thought and grape wine craft have very big different.Its basic technology be the Uygur with grape extraction juice, earlier the skin slag is added water infusion (water had not just had the skin slag) infusion, filter afterwards, filtrate and infusion again after squeezing juice mixes, form Musa's Lay and think starting fermentation liquid, naturally cool to room temperature, the vat of packing into carries out spontaneous fermentation and forms.The brewer is according to the demand of oneself ruing greatly of can adding that some localities produce, white apricot, mulberry fruit, safflower, matrimony vine, pigeon, snow cock, deer blood once in a while, or even the roast whole lamb in Xinjiang.As the ecosystem drink with health-care effect and rich cultural inside information; Musa's Lay thinks progressively to become the important component part of local economic development; Musa's Lay is thought rapid expansion and the people's increasing rapidly its consumers demand in market; tradition Musa Lay thinks progressively to expose that it is underproduce; birth defects such as levels of audit quality is uneven; can not guarantee the mass-producing sustainable development that Musa's Lay is thought, the urgent task that the reform that Musa's Lay is thought and innovation further develop for Musa's Lay think of.

Because the primary state property that Musa's Lay is thought has also seriously restricted Musa's Lay and has thought industrialized development.Can brewage Musa's Lay thinks in local every household; but the product that brews is uneven; and technology is also very backward; the technician that the deficient real grasp of the talent can be brewageed high-quality Musa's Lay think of is very few; the experience of brewageing of also just having grasped ancestors that has is produced for the science of mass-producing and but can not be adapted to.Because the making method that Musa's Lay is thought is different from the technology of vin ordinaire, thus for Musa's Lay think brewage wine making teacher be the strange field of a slice.

The critical process that tradition Musa Lay is thought brew is infusion and fermentation procedure; wherein fermentation procedure is subjected to the influence of factors such as wild-type strain, natural environmental condition and fermentation equipment; being the important factor that causes Musa's Lay think of quality fluctuation, is the main factor that restriction Musa Lay is thought large-scale production.For example, think in the complete spontaneous fermentation process at Musa's Lay, owing to be subjected to Xinjiang temperature difference fluctuation significantly sooner or later, the influence of large number of biological heat etc. in the fermenting process, cause karusen product temperature or too high, up to 37 ℃, cross low, hang down and reach 13 ℃, usually take place to postpone to inspire, stagnate and ferment, finish phenomenons such as fermentation in advance, make fermentation period do not waited to 45d by 15d, same infusion karusen, but final Musa's Lay think quality product such as alcohol, acid, puckery, wait bitterly for certain individual event organoleptic feature and be projected into pleasant high-quality of various flavours and smell coordination and do not wait.Because under the driving of market interest, people arbitrarily change infusion and fermentation equipment etc., it is more complicated to make traditional Musa's Lay think making method again, and the development that traditional Musa's Lay is thought has a negative impact.

Prior art studies show that, multifarious formation has vital role to environmental factor to wine yeast, Musa's Lay think of yeast diversity and genetic diversity are relevant with the brew environment that Musa's Lay is thought uniqueness, the extreme landlocked weather of ring Tarim Basin, its arid, short of rain, frostless season are long etc. all might influence the diversity of local yeast.In addition, and between the sampling point in material choice, get the juice mode, infusion mode and time, on the operations such as spontaneous fermentation container, cycle and making processes centre halfback biological and ecological methods to prevent plant disease, pests, and erosion control be associated.Different juice extracting methods also may cause yeast count diversity difference in the Sucus Vitis viniferae, and these all need to adopt the technique means of science to be studied and tackle key problems.Domestic at present, there is pair Musa's Lay to think the report of wild dominant bacteria in the brew, do not think the strain excellent of complicated brew environment and the report of supporting brewing process thereof but be suitable for local Musa's Lay.

Think development at present Musa's Lay and be in tradition processing and cross the stage with modern production, the traditional technology innovation is the historic task that Musa's Lay is thought development.The principles of science of the brew of thinking according to Musa's Lay, Musa's Lay is thought the brew core technology, be that the spontaneous fermentation operation is analysed scientifically, screening development is suitable for the technology that Musa's Lay is thought the modern production excellent species and is fit to stablize suitability for industrialized production, simultaneously again maximum horizontal keep traditional Musa's Lay think the advanced technologies of high-quality qualitative characteristics be to traditional Musa's Lay think improved at all.

Summary of the invention

Leavening property is good at not having both at home and abroad at present, Musa's Lay of better tolerance is thought special yeast, the invention provides a kind of better tolerance, and the technology that leavening property excellent high-temperature barms, definite production Musa Lay are thought and the Musa's Lay for preparing thereof are thought.

The present invention takes a sample from the natural fermentation broth that Xinjiang Aksu Prefecture, the different Musa's Lays in Hotan Prefecture and Kaxgar Prefecture Musa Lay think of producing region are thought, filter out a collection of well-grown yeast strain, therefrom optimize a strain and be numbered the thermotolerant yeast bacterial strain of GTGM-E2, through being accredited as yeast, the zymotechnique that this bacterial strain is determined can be produced Musa's Lay and think.

The present invention specifically provides a kind of better tolerance, leavening property excellent high-temperature barms, numbering called after GTGM-E2, " saccharomycetic feature and the identification handbook " special with reference to J.A Barney and the R.W Penn is write, " yeast: feature and evaluation " write according to Barnett etc., " microbial taxonomy " of Zhang Jizhong and people and Yang Ying people's such as (2007) bibliographical information such as Cavazza(1992), the GTGM-E2 bacterial strain is carried out morphology and Physiology and biochemistry evaluation, the GTGM-E2 bacterial strain was preserved in the international depositary institution of budapest treaty microorganism before the applying date: China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) preservation, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101, preservation date is on 04 23rd, 2013, and preserving number is CGMCC No.7513.Through microbiology be accredited as yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae).This yeast is cultivated through the WL nutrient agar, and colony characteristics is cream-colored, with or without light green, and spherical protuberances, smooth surface, opaque, butteriness; YPD solid culture bacterium colony is oyster white, butteriness, surface smoothing, neat in edge; The YPD liquid nutrient medium is cultivated no film or web, and the test tube bottom has white consolidation precipitation; Cellular form is circular or oval, and multiterminal sprout, and produces spore, and spore is circular, and 1～4 spores are arranged in the sporocyst, utilizes the Methionin substratum to carry out selectivity and cultivates, and does not grow; But glucose fermentation, synanthrin, lactose, raffinose, maltose, sucrose, assimilable carbon source is: glucose, semi-lactosi, methylglucoside, lactic acid, lactose, sucrose, maltose, cellobiose, wood sugar, pectinose, trehalose, melizitose, raffinose, the N-acetylglucosamine, melibiose, Xylitol, glycerol, sorbyl alcohol, red bright alcohol, ring biose amine and the test of inositol citric acid all show negative, can not utilize saltpetre, urease test, the DBB experiment, resist the experiment of 0.01% and 0.1% cycloheximide and do not have the VITAMIN growth experiment all negative; By The above results and through 26S rDNA homology analyze, Phylogenetic Analysis result, will be numbered the GTGM-E2 identification of strains and be yeast belong ( Saccharomyces) in yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae).

Simultaneously, the present invention further provides a kind of production technique of Musa's Lay think of on the basis that the GTGM-E2 yeast strain is provided, and concrete steps are as follows:

(1) distiller's yeast preparation: with yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) the fresh culture thing of GTGM-E2 CGMCC No.7513 on the YPD solid medium, insert in the grape infusion juice of 24Brix, cultivate 24h for 28 ℃, standby.

(2) raw material selection and flushing: manually with foreign matters such as stones and go rotten, sort out from grape material such as Chinese olive, choose clean grape and utilize tap water that silt is rinsed well.

(3) squeeze the juice: utilize crusher that the grape after above-mentioned steps (2) selection and the flushing is dug up the roots after the fragmentation, utilize expeller to squeeze, Sucus Vitis viniferae is pumped into Buffer Pool, carry out quiescent setting, then squeeze into steam cooker.

(4) infusion: add to flood the water yield that the skin slag is advisable in the grape skin that step (3) is squeezed out, infusion 2h～6h, enduring well-done skin pulp water filters, Sucus Vitis viniferae after skin pulp water after the filtration and the squeezing is squeezed into steam oven with the ratio of 1:3 ~ 1:8(v:v) and is boiled infusion, and regularly detecting pol end of a period pol is 22Brix～25Brix.

(5) cooling: steam off, with water coolant step (4) infusion juice is cooled off, be cooled to 35 ℃ and squeeze in the fermenting container.

(6) fermentation: with the fresh distiller's yeast of step (1) preparation, 1% (v/v) inoculum size by total fermented liquid inserts cooled grape infusion juice, inoculation temp is 32 ℃ ~ 35 ℃, envrionment temperature is fermented for 20 ℃-30 ℃, the product temperature is 25 ℃～37 ℃, optimal temperature is 28 ℃, regularly detects pol, till pol no longer reduces.

(7) after-ripening, sterilization and can: after the fermentation ends, carry out after-ripening, the after-ripening temperature must not surpass 25 ℃, and wine and schlempe are placed 40 ~ 45d, and supernatant liquor is imported in the clean container, before can, carry out 65 ℃ ~ 75 ℃ sterilization 30min, cool off and cool the temperature to room temperature, then carry out can; If container is filled in untimely can, the sterilization conditions before can is the same.

The yeast isolation medium of selecting for use among the present invention is as follows:

The YPD liquid nutrient medium (g/L): glucose 20 g, peptone 20 g, yeast extract paste 10 g are dissolved in distilled water and fixed molten to 1000 mL, pH value nature.The YPD solid medium adds 20 g agar, 121 ℃ of autoclaving 20 min; The WL nutrient agar (g/L): yeast soaks powder 4 g, peptone 5 g, glucose 50 g, potassium primary phosphate 0.55 g, Repone K 0.425 g, calcium chloride 0.125 g, sal epsom 0.125 g, iron(ic) chloride 0.025 g, manganous sulfate 0.025 g, agar 20 g, tetrabromo-mcresolsulfonphthalein 22 mg, 6.5,121 ℃ of sterilizations of pH, 20 min.

The bacterial strain yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 preservation protective material: glycerine

(1) yeast saccharomyces cerevisiae of selecting for use among the present invention is identified substratum and reagent: YPD mushy stage substratum is the same; The WL nutrient agar is the same; The Gorodkowa substratum: glucose 0.1%, peptone 1%, NaCl0.5%, agar 2%,, pH value nature, 121 ℃ of sterilization 20 min; The Methionin substratum contains among the 1L: D-glucose 10g, L-Histidine 1mg, DL-methionine 2 mg, DL-tryptophane 2mg, Para-Aminobenzoic 200 μ g, vitamin H 20 μ g, folic acid 2 μ g, inositol 10mg, nicotinic acid 400 μ g, pantothenic acid 2mg, pyridoxine hydrochloride 400 μ g, Riboflavin Tetrabutyrate 00 μ g, vitamin 400 μ g, boric acid 500 μ g, crystallization cupric chloride 40 μ g, potassiumiodide 100 μ g, crystallization iron(ic) chloride 200 μ g, crystalline sulfuric acid manganese 400 μ g, crystallization Sodium orthomolybdate 200 μ g, crystalline sulfuric acid zinc 400 μ g, potassium primary phosphate 850 mg, dipotassium hydrogen phosphate 150 mg, crystalline sulfuric acid magnesium 500 mg, sodium-chlor 100 mg, crystallization calcium chloride 100 mg, lysine hydrochloride 2.5 g, agar 20 g, pH value nature, 121 ℃ of sterilization 20 min;

(2) Physiology and biochemistry is identified substratum: the sugar-fermenting substratum: 0.5% yeast extract, 121 ℃ of sterilization 20min; Base is supported on the carbon source basis: (NH4) 2,SO4 0.5%, KH2PO40.1%, and MgSO4.7H2O 0.05%, yeast extract paste 0.02%, 2%, 115 ℃ of sterilization of washing agar 15min; The nitrogenous source basic medium: every liter contains carbon source (D-glucose) 10g, amino acid (L-Histidine 1mg, DL-methionine 2mg, DL-tryptophane 2mg), and somatomedin (right-benzaminic acid 200ug, vitamin H 20ug, folic acid 2ug, inositol 10ug, nicotinic acid 400ug, pantothenic acid 2mg, pyridoxine hydrochloride 400ug, Riboflavin Tetrabutyrate 00ug, vitamin 400ug), trace element (H ₃BO ₃500ug, CuSO ₄.5HO ₂40ug), salt (KI 100ug, FeCl ₃.6HO ₂200ug, MnSO ₄.4HO ₂400ug, Na ₂MoSO ₄.2HO ₂200ug, ZnSO ₄.7HO ₂400ug), the assimilation nitrogenous source is selected saltpetre; The plain substratum of urea: peptone 0.1%, potassium primary phosphate 0.2%, sodium-chlor 0.5%, phenol red 0.0012%, agar 2% adds degerming urea soln after filtration after the PH6.8 sterilization, is that the ultimate density of urea reaches 2%; Anti-cycloheximide substratum: contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-tryptophane 20ug) in every liter, 3.5g ammonium sulfate and 0.01% and 0.1% cycloheximide, all the other compositions are with the nitrogenous source basic medium; No VITAMIN growth test media: contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-tryptophane 20ug) in every liter, 5g ammonium sulfate does not contain living somatomedin, and all the other are with the nitrogenous source basic medium.

Sequential analysis reagent: Tris(Amresco), SDS(Amresco), EDTANa2(Amresco), DNA Marker DL2000 (bio tech ltd is contained in east, Guangdong), the TE damping fluid, agarose (Spain), 2 * Tag PCR Master Mix is available from Novi gloomy (Beijing) bio tech ltd; TAE damping fluid (50 * stock solution pH8.5,242 g Tris alkali, 57.1 mL Glacial acetic acid, 37.2 g Na2EDTA2H2O, add ddH2O to 1 L, time spent is diluted to 1 *), by the order-checking of 26S rDNA primer, specifically adopt 26S rDNA primer: NL1(5 '-GCATATCAATAAGCGGAGGAAAAG-3 '); NL4(5 '-GGTCCGTGTTTCAAGACGG-3 '), sequence is specifically referring to the sequence subordinate list.

The present invention also further provides the Musa's Lay that utilizes high temperature bacterial strain GTGM-E2 fermentative preparation to obtain to think, and the Musa's Lay that possesses fine quality is thought product.

(1) physical and chemical index: alcoholic strength: 10～13% (V/V); Total reducing sugar:＜6 g/L; Total acid: 6～9g/L.

(2) Oranoleptic indicator: color and luster: have the typical color and luster feature that Musa's Lay is thought, brown, color and luster is dim, and is evenly muddy; Smell: have outstanding caramel odor, aroma strong fragrance, pure, typicalness is strong; Mouthfeel: mouthfeel is plentiful, and Harmony is good, and pleasant impression is long, and typicalness is strong.

The invention provides Musa's Lay and think the method that the physical and chemical index test is adopted: the mensuration of total reducing sugar: GB/T 15038-2006 direct titrimetric method; The mensuration of alcoholic strength: GB/T 15038-2006 Ebullioscope method; Total acid: GB/T 15038-2006 potentiometric titration; Reducing sugar: GB/T 15038-2006 direct titrimetric method, these methods all are the common methods in this area.

By implementing the concrete technical indicator of the present invention, realize content of the present invention, can reach following beneficial effect:

(1) it is good to the invention provides a strain leavening property, the high temperature yeast saccharomyces cerevisiae of better tolerance ( Saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513, having remedied present Musa's Lay and thought the present situation that special yeast lacks, the Musa's Lay that particularly is fit to thermophilic fermentation is thought special yeast.

(2) the present invention thinks on concrete grasp such as industry, brewing process, the qualitative characteristics basis traditional Musa's Lay, carry out large-scale Musa's Lay and think yeast separation and screening, and batch production Musa Lay is carried out in the screening strain think fermenting experiment, the good S. cervisiae of acquisition advantage is finished the development of the high temperature pure breed fermentation process that is suitable for high-end Musa's Lay think of.Obtained good Musa's Lay and thought product, its color and luster is dim, and is for Musa's Lay is thought distinctive pure brown, evenly muddy, has outstanding caramel odor, aroma strong fragrance, pure, rich in taste, have good Harmony, pleasant impression is long, has enriched present China fruit wine produce market.

Description of drawings

Fig. 1 is shown as Musa's Lay and thinks the high-heat fermentation process schema.

Fig. 2 be shown as yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 colonial morphology figure, among the figure, first half component is colonial morphology on the YPD substratum, the Lower Half component is colonial morphology on the WL substratum.

Fig. 3 be shown as yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 cellular form and spore shape figure, among the figure, first half component is cellular form, the Lower Half component is spore shape.

Fig. 4 be shown as yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 phylogenetic evolution tree graph.

Fig. 5 is shown as Musa's Lay and thinks traditional spontaneous fermentation hypoglycemic Logisic fitting of a curve figure.

Fig. 6 be shown as adopt yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 thermophilic fermentation prepares Musa's Lay and think Logisic hypoglycemic fitting of a curve figure.

Fig. 7 be shown as Musa's Lay think to adopt spontaneous fermentation and yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) hypoglycemic (Brix) rate diagram during GTGM-E2 CGMCC No.7513 thermophilic fermentation.

Embodiment

Key instrument and equipment: PL202 electronic balance, plum Teller-Tuo benefit Instr Ltd.; HPX-9272 digital display electric heating incubator, the rich Medical Equipment Plant of industry company limited that proves to be true after interrogation in Shanghai; The LDZX-40BI autoclave, Shenan Medical Appliances Factory, Shanghai; GZX-9420 electric heating constant temperature air dry oven, Shanghai Boxun Industrial Co., Ltd.; The SW-CJ-2F Bechtop, Shanghai Boxun Industrial Co., Ltd.; HHW.21.600 electric heating constant temperature water bath, Beijing be bright Medical Instruments factory forever; Fcycler96 hole PCR reacts instrument, Bio-Rad company; DYY-6C type electrophoresis apparatus, Liuyi Instruments Plant, Beijing; GEL Doc2000 gel imaging analysis instrument, Bio-Rad company; HPX-9272 MBE digital display electric heating incubator, SW-CJ-2F Bechtop, Medical Equipment Plant of Shanghai Boxun Industrial Co., Ltd.; LHS-250SC fixed temperature and humidity incubator, prompt laboratory apparatus Manufacturing Co., Ltd in Changzhou; LDZX-50KB vertical pressure steam sterilizer, Shenan Medical Appliances Factory, Shanghai; Biolog, U.S. BioTek Instruments company; Vernier callipers, Shanghai measuring tool company limited; WHB 96 microwell plates, the luxuriant grand bio tech ltd in Shanghai City; 1000 ml liquid-transfering guns, Shanghai Ai Bende biotechnology International Trading Company Ltd; HPX-9272 MBE digital display electric heating incubator, SW-CJ-2F Bechtop, Medical Equipment Plant of Shanghai Boxun Industrial Co., Ltd.; LDZX-50KB vertical pressure steam sterilizer, Shenan Medical Appliances Factory, Shanghai; C21-RT2103 electromagnetic oven, EG720FF1-NR microwave oven, the living electric apparatus Manufacturing Co., Ltd of Guangdong U.S.; G4B20C5E1C6B71 revolves the steaming evaporimeter, Japanese Eyela company.The BL3100 electronic balance, German Sartorius company; SCW-CA-650 desktop vertical current clean bench, the grand auspicious purification in Suzhou Science and Technology Ltd..G4B20C5E1C6B71 revolves the steaming evaporimeter, Japanese Eyela company.The BL3100 electronic balance, German Sartorius company.Hand-held saccharometer, instrument company limited is built in the sky, Shanghai; Ebullioscope, Shanghai doctor's joint control temperature instrument plant.PHS-3B type pH meter, the red beneficial instrument in Shanghai company limited; HH-2 digital display thermostat water bath, the Jie Ruier of Jintan City Electrical Appliances Co., Ltd; 25 L fermentor tanks (factory) and ceramic fermentor tank (workshop), commercially available.

The raw material of selecting for use is and the field red grape to originate from ring area, Tarim Basin, South Sinkiang, Xinjiang.

All bacterial classifications and the raw and auxiliary material selected for use among the present invention, and the spawn culture condition of selecting for use and method all be well known selecting for use, the % that relates among the present invention is generally the ratio of weight, and indivedual differences explain in addition.

Embodiment one: the screening of bacterial classification, separation, purifying and evaluation

Strain separation method

1. the collection in yeast separation source: be collected in 8 in area, South Sinkiang in 9～October in 2010 and have typical Musa's Lay think of making method workshop and factory's 49 increment liquid.Sample liquid comprise new squeezing contain the skin slag or do not contain the Sucus Vitis viniferae of skin slag, just at Sucus Vitis viniferae, the 0 d(starting fermentation liquid of infusion, i.e. cooled grape infusion juice) fermented liquid and from different times fermented liquid in the porcelain altar of differ in size (50-500 L) or the stainless steel fermentor tank (20 t).Sampling is taken out in the Plastic Bottle of packing into immediately (sample liquid rinse 3 times) with the special-purpose scoops of producer with sample liquid and is inhaled 10mL sample liquid extremely in the 20 mL phials of sterilization zone plug with the syringe of rinse (sample liquid rinse 3 times) again, build bottle stopper and put into 4 ℃ of vacuum flask with sealing film phonograph seal, transport sample back laboratory in 12 h and mixes with sterile glycerol 1:1, it is standby to put into-20 ℃ of refrigerators preservations.

2. strain separating and purification process: institute's sample thief done 10 dilution gradient, get its 3 suitable serial dilution gradients, respectively get 0.1mL, coat WL and YPD solid medium, support 28 ℃ of cultivation 2～3 d in the case in constant temperature, picking list bacterium colony, after purifying on the YPD solid medium was cultivated, it was standby to carry out glycerine pipe-20 ℃ preservation.Unfermentable sample separation bacterial strain control is at 15 ~ 20 strains/sample, and 20 ~ 40 strains/sample is controlled in the sample separation strain of yeast phase.

The isolation and identification method of bacterial classification

1. saccharomycetic morphology is identified: colonial morphology is observed: yeast is rule at YPD and WL solid medium, cultivate 2～3 d, observe its colonial morphology for 28 ℃; Cellular form is observed: the liquid inoculation of YPD was cultivated microscopic examination 2 days for 28 ℃; Spore shape is observed: the Gorodkowa substratum was cultivated 7 days for 28 ℃, adopted Victoria Green WPB-luxuriant red colouring method that spore is carried out spore staining, microscopic examination.

The liquid culture observation of characteristics: bacterial classification inoculation in the YPD liquid nutrient medium, is cultivated 2～3 d for 28 ℃, and whether observation ferments, whether nutrient solution is muddy, whether forms palamas such as ring or island, precipitation capacity what and degree of tightness situation.

2. Methionin selectivity culture identification: inoculation is behind YPD liquid nutrient medium activation 24h, inoculum size according to 1% is inoculated into carries out hunger and handles in the sterilized water of 2 mL, behind the 7d, streak inoculation is to the Methionin substratum, observe whether yeast growth is arranged behind 28 ℃ of cultivation 5d, cultivate the continuation that does not have bacterium colony to occur behind the 48h and cultivate, still the aseptic long explanation of being born may be yeast saccharomyces cerevisiae behind 15d.Test result is that not living elder is yeast saccharomyces cerevisiae on the Methionin substratum.

Know by above-mentioned yeast separation and morphology test evaluation.

49 increment liquid are separated to 699 saccharomycetes altogether, see Table 1, according to form and the color of yeast on the WL substratum, it is 20 cultivation types that 699 saccharomycetes that Awat County different fermentations technology Musa Lay can be thought be separated in the sample liquid gather, wherein 482 strain WL cultivation colony characteristics is with cream color, with or without light green, spherical protuberances, smooth surface, opaque, butteriness, YPD solid culture bacterium colony is oyster white, butteriness, surface smoothing, neat in edge, liquid no film or the web cultivated of YPD, the test tube bottom has white consolidation precipitation; Then utilize the Methionin substratum to carry out the selectivity culture identification these bacterial strains, every strain bacterium is cooked three repetitions, and the yeast that screening can not be grown has 436 strains.436 strain typical strains are carried out cellular form and spore shape observation reinspection, further confirm its classification position.

Selecting to cultivate by above-mentioned identification of morphology and Methionin, is yeast saccharomyces cerevisiae with 436 strain preliminary evaluation in 699 strain isolateds, and comprising being numbered the GTGM-E2 bacterial strain, its colonial morphology and microscopic morphology are referring to accompanying drawing 2, accompanying drawing 3.

Physiology and biochemistry is identified:

Determine tentatively that according to form and Methionin selective medium the bacterial strain that is numbered GTGM-E2 carries out sugar-fermenting, carbon nitrogen source assimilation, anti-defence line bacterium ketone, no VITAMIN growth, urea decomposition, experiments such as the blue B of diazo are carried out Physiology and biochemistry and are identified.

Sugar-fermenting experiment: add glucose, synanthrin, lactose respectively at the sugar-fermenting substratum, raffinose, maltose, sucrose utilize Du Shi pipe fermentation method at 28 ℃, cultivated for 1 week, observe every day therebetween and record Du Shi pipe in gas accumulation whether and burden, detect whether have fermenting power to testing sugar.

The carbon assimilation experiment: the growth popularize law, in the nitrogenous source basic medium, test glucose, semi-lactosi, lactose, sucrose, maltose, cellobiose, methylglucoside, wood sugar, pectinose, trehalose, melizitose, raffinose, the N-acetylglucosamine, melibiose, Xylitol, glycerol, sorbyl alcohol, red bright alcohol, ring biose amine, inositol, lactic acid, whether citric acid is cultivated observed and recorded result after 2～3 days, is detected it and grow for 28 ℃.

The nitrate assimilation experiment: the growth popularize law, in the carbon source basic medium, add saltpetre, 28 ℃, whether observed and recorded result after 2～3 days detects it and grows.

Urease test: the plain liquid nutrient medium aseptic technique of urea, be that portion is put into respectively in many test tubes with 0.5mL, and deep refrigeration stored for six weeks.The yeast culture of get a ring growth 1 day or 2 days is seeded in the above-mentioned substratum, 37 ℃ of cultivations.Checking the test tube change in color per half an hour one time, red expression urease activity. all yeast that are positive can both become redness within 4 hours.

The blue B(DBB of diazo) test: cultivation bacterial classification of at least 10 days on the YPD solid medium, be placed on 55 ℃ of a few hours, flooding in ice-cold DBB reagent if soak then. this culture becomes garnet at room temperature 2 minutes, and this result is registered as the positive so.

Anti-cycloheximide experiment: the test bacterium of fresh activation inserted to contain carry out 28 ℃ in 0.01% and 0.1% the substratum and cultivate 2-3d, observation period upgrowth situation.

Table 1 Musa Lay is thought yeast separation source and strain isolated number

No VITAMIN growth experiment: the test bacterium of fresh activation is inserted no VITAMIN growth test cultures base row cultivate 2-3d, observation period upgrowth situation for 28 ℃.

Qualification result is as follows: but be numbered GTGM-E2 glucose fermentation, synanthrin, lactose, raffinose, maltose, sucrose, assimilable carbon source is: glucose, semi-lactosi, methylglucoside, lactic acid, all the other carbon source tests all show negative, can not utilize saltpetre, urease test, DBB experiment, anti-0.01% and 0.1% cycloheximide experiment, no VITAMIN growth experiment is all negative, be accredited as yeast belong ( Saccharomyces) in yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae).

Select numbering called after GTGM-E2 for use, " saccharomycetic feature and the identification handbook " special with reference to J.A Barney and the R.W Penn is write, " yeast: feature and evaluation " write according to Barnett etc., " microbial taxonomy " of Zhang Jizhong and people and Yang Ying people's such as (2007) bibliographical information such as Cavazza(1992), the GTGM-E2 bacterial strain is carried out morphology and Physiology and biochemistry evaluation, the GTGM-E2 bacterial strain was preserved in the international depositary institution of budapest treaty microorganism before the applying date: China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) preservation, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode: 100101, preservation date is on 04 23rd, 2013, and preserving number is CGMCC No.7513.Through microbiology be accredited as yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae).This yeast is cultivated through the WL nutrient agar, and colony characteristics is cream-colored, with or without light green, and spherical protuberances, smooth surface, opaque, butteriness; YPD solid culture bacterium colony is oyster white, butteriness, surface smoothing, neat in edge; The YPD liquid nutrient medium is cultivated no film or web, and the test tube bottom has white consolidation precipitation; Cellular form is circular or oval, and multiterminal sprout, and produces spore, and spore is circular, and 1～4 spores are arranged in the sporocyst, utilizes the Methionin substratum to carry out selectivity and cultivates, and does not grow; But glucose fermentation, synanthrin, lactose, raffinose, maltose, sucrose, assimilable carbon source is: glucose, semi-lactosi, methylglucoside, lactic acid, lactose, sucrose, maltose, cellobiose, wood sugar, pectinose, trehalose, melizitose, raffinose, the N-acetylglucosamine, melibiose, Xylitol, glycerol, sorbyl alcohol, red bright alcohol, ring biose amine and the test of inositol citric acid all show negative, can not utilize saltpetre, urease test, the DBB experiment, resist the experiment of 0.01% and 0.1% cycloheximide and do not have the VITAMIN growth experiment all negative; Be numbered GTGM-E2 bacterial strain preliminary evaluation and be yeast belong ( Saccharomyces) in yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae).

Sequential analysis is identified:

DNA extracts: identify and the Methionin selective medium tentatively determines to be numbered the bacterial strain of GTGM-E2 according to form and growth characteristics, measure its 26S rDNA sequence, carry out the homology comparison with gene order in the gene pool, be defined as yeast saccharomyces cerevisiae.Well-grown single bacterium colony is in 1.5mL sterilized water centrifuge tube on the aseptic inoculation ring picking YPD flat board, 4 ℃ of 12000 r/min, and centrifugal 6 min abandon supernatant; Get 200 μ L lysates (100 mmol/L T ris, 30 mmol/L EDTA, 0.5% SDS), fully mixing suspends thalline fully;-80 ℃ of freezing 5 min(freeze fully), 95 ℃ of these step triplicates of water-bath 2 min(); Add 200 μ L chloroforms: primary isoamyl alcohol (24:1) back 12000 r/min, centrifugal 5 min of room temperature are transferred to supernatant in another aseptic 1.5 mL centrifuge tubes, and ethanol on the rocks is to 1 mL, natural subsidence 5 min under the room temperature, 12000 r/min, centrifugal 5 min; Abandon supernatant liquor, add 500 mL, 75% ethanol, 12000 r/min, centrifugal 5 min; Abandon supernatant liquor, natural air drying precipitation under the room temperature; The DNA precipitation is dissolved with 30 μ L TE, and-20 ℃ of preservations are standby.26S rDNA PCR amplification: use primer a pair of: NL1(5 '-GCATATCAATAAGCGGAGGAAAAG-3 ') and NL4(5 '-GGTCCGTGTTTCAAGACGG-3 ')

Through the 26S rDNA gene fragment in the 26S rDNA pcr amplification yeast genomic dna.PCR reaction system cumulative volume is 25 μ L, and every pipe adds 10 μ L ultrapure waters, 12 μ L, 2 * Taq PCR MasterMix(TaqDNA polysaccharase, 0.05 units/ul, MgCl2 4 mM, dNTPs 0.4 mM), each 1 μ L of 10 μ mol/L primers, masterplate DNA 1 μ L.The PCR reaction conditions is: pre-95 ℃ of 5 min of sex change; 94 ℃ of 1 min of sex change, 52 ℃ of 1 min that anneal extends 72 ℃ of 1 min20 s, circulates 36 times; 72 ℃ of 8 min of total elongation.Expansion is reflected on the fcycler96 hole PCR reaction instrument to be carried out.Reaction is got 5 μ L reaction product with 1% sepharose, 120 V in the TE damping fluid after finishing, electrophoresis 30 min, and the 5 min electrophoresis detection that dye, the gel imaging system imaging, qualified PCR product carries out sequencing, and concrete sequence is referring to attached sequence table.

Sequencing result is analyzed: sequencing result carried out the Blast comparison, selects homology and be the bacterial strain 99% or more, and the bacterial strain of other kinds, utilize Clastal and MEGA 4.0 softwares to set up phylogenetic tree, determine by the growth status of evaluation bacterial strain.

Behind above-mentioned 436 Accharomyces cerevisiae fermentation character primary dcreening operations, the preceding 10 strain bacterium of grey relational grade ordering are carried out 26S rDNA sequential analysis, bacterium numbering is seen in the accompanying drawing 4, further identifies its molecules classification position.With reference strain ( Saccaromyces cerevisaeHM191642) sequence similarity＞99.9% is grown tree by N-J method constructing system, further verify this 10 strain all with reference to strain Saccaromyces cerevisaeThe HM191642 cluster is gang, thus bacterium numbering be GTGM-E2 be accredited as yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae), referring to accompanying drawing 4.

The GTGM-E2 yeast isolation medium of selecting for use among the present invention that is numbered adopts as follows:

The YPD liquid nutrient medium (g/L): glucose 20 g, peptone 20 g, yeast extract paste 10 g are dissolved in distilled water and fixed molten to 1000 mL, pH value nature.The YPD solid medium adds 20 g agar, 121 ℃ of autoclaving 20 min; The WL nutrient agar (g/L): yeast soaks powder 4 g, peptone 5 g, glucose 50 g, potassium primary phosphate 0.55 g, Repone K 0.425 g, calcium chloride 0.125 g, sal epsom 0.125 g, iron(ic) chloride 0.025 g, manganous sulfate 0.025 g, agar 20 g, tetrabromo-mcresolsulfonphthalein 22 mg, 6.5,121 ℃ of sterilizations of pH, 20 min.

3. bacterial strain preservation protective material: glycerine

The GTGM-E2 that is numbered that selects for use among the present invention identifies substratum and reagent: YPD mushy stage substratum is the same; The WL nutrient agar is the same; The Gorodkowa substratum: glucose 0.1%, peptone 1%, NaCl0.5%, agar 2%,, pH value nature, 121 ℃ of sterilization 20 min; The Methionin substratum contains among the 1L: D-glucose 10g, L-Histidine 1mg, DL-methionine 2 mg, DL-tryptophane 2mg, Para-Aminobenzoic 200 μ g, vitamin H 20 μ g, folic acid 2 μ g, inositol 10mg, nicotinic acid 400 μ g, pantothenic acid 2mg, pyridoxine hydrochloride 400 μ g, Riboflavin Tetrabutyrate 00 μ g, vitamin 400 μ g, boric acid 500 μ g, crystallization cupric chloride 40 μ g, potassiumiodide 100 μ g, crystallization iron(ic) chloride 200 μ g, crystalline sulfuric acid manganese 400 μ g, crystallization Sodium orthomolybdate 200 μ g, crystalline sulfuric acid zinc 400 μ g, potassium primary phosphate 850 mg, dipotassium hydrogen phosphate 150 mg, crystalline sulfuric acid magnesium 500 mg, sodium-chlor 100 mg, crystallization calcium chloride 100 mg, lysine hydrochloride 2.5 g, agar 20 g, pH value nature, 121 ℃ of sterilization 20 min.

Physiology and biochemistry is identified substratum: the sugar-fermenting substratum: 0.5% yeast extract, 121 ℃ of sterilization 20min; Base is supported on the carbon source basis: (NH ₄) 2SO ₄0.5%, KH ₂PO ₄0.1%, MgSO ₄.7H ₂O 0.05%, yeast extract paste 0.02%, 2%, 115 ℃ of sterilization of washing agar 15min; The nitrogenous source basic medium: every liter contains carbon source (D-glucose) 10g, amino acid (L-Histidine 1mg, DL-methionine 2mg, DL-tryptophane 2mg), and somatomedin (right-benzaminic acid 200ug, vitamin H 20ug, folic acid 2ug, inositol 10ug, nicotinic acid 400ug, pantothenic acid 2mg, pyridoxine hydrochloride 400ug, Riboflavin Tetrabutyrate 00ug, vitamin 400ug), trace element (H ₃BO ₃500ug, CuSO ₄.5HO ₂40ug), salt (KI 100ug, FeCl ₃.6HO ₂200ug, MnSO ₄.4HO ₂400ug, Na ₂MoSO ₄.2HO ₂200ug, ZnSO ₄.7HO ₂400ug), the assimilation nitrogenous source is selected saltpetre; The plain substratum of urea: peptone 0.1%, potassium primary phosphate 0.2%, sodium-chlor 0.5%, phenol red 0.0012%, agar 2% adds degerming urea soln after filtration after the PH6.8 sterilization, is that the ultimate density of urea reaches 2%; Anti-cycloheximide substratum: contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-tryptophane 20ug) in every liter, 3.5g ammonium sulfate and 0.01% and 0.1% cycloheximide, all the other compositions are with the nitrogenous source basic medium; No VITAMIN growth test media: contain amino acid (L-Histidine 10ug, DL-methionine 20ug, DL-tryptophane 20ug) in every liter, 5g ammonium sulfate does not contain living somatomedin, and all the other are with the nitrogenous source basic medium.

Embodiment two: the strain excellent screening experiment

Carry out basic fermentation character test analysis with being numbered the commercial yeast saccharomyces cerevisiae of 436 Accharomyces cerevisiaes of GTGM-E2 and 5 strains comprising of above-mentioned screening and separating and preliminary evaluation, comprise differing temps, pol, wine degree and low nitrogen tolerance analyze, rise send out property mensuration, wine output ability, flocculence, from dissolubility, produce H ₂S ability, the detection of producing the biogenic amine characteristic, pectinase activity mensuration and activity of beta-glucosidase determination and analysis are as follows:

1. the basic fermentation character test analysis of strain isolated

(1) differing temps, pol, wine degree and low nitrogen tolerance are analyzed: 436 Accharomyces cerevisiaes and the commercial yeast saccharomyces cerevisiae of 5 strains that are numbered GTGM-E2 comprising after will identifying carry out (but absorbed nitrogen 300mg/L under the suitable condition, 26% sugar, 28 ℃ of substratum), high pol (Musa's Lay is thought synthetic medium its pol is adjusted to 45% and 50%), the different wine precision (think to contain 8% in the synthetic medium by Musa's Lay, 10%, 14%, 6% ethanol), (Musa's Lay is thought synthetic medium to differing temps, 13 ℃, 37 ℃, 45 ℃), its tolerance behavior of culture assays under low nitrogen (but Musa's Lay think of synthetic medium is made as 56mg/L with the absorbed nitrogen) condition.Wherein 28 ℃ of temperature, can absorb nitrogenous source 300mg/L, 26% sugar and tolerate other control conditions in condition test for each.

After the fresh culture thing is inoculated in the above-mentioned nutrient solution of 5ml, get 300 μ l cultures in 96 microwell plates, survey its OD under 590 nm ₁Value.Culture after cultivating 72 h, 28 ℃ (temperature tolerance is as the criterion with the differing temps gradient) is surveyed its absorbancy OD under 590 nm ₂In the experiment not connect the culture of strains base as check sample OD _kIncrease multiple=(OD ₂-OD _K2)/(OD ₁-OD _K1)-1.

(2) work the property sent out mensuration: will activate bacterial strain well and insert fermentation in vitro, and shake up, and cultivate down for 28 ℃, whether the gas collection is deposited and burden in the routine observation inversion Du Shi pipe, every 4 h record once.Reach 0.1 mL required time and be decided to be the time of sending out from being inoculated into aerogenesis, the result represents in the following manner: 4 expressions are full of Du Shi and manage from sending out within the time 4h institute's aerogenesis body, and wherein 4 ⁺The expression time short (about 2h), 4 ^-The expression time long a little (about 4h); Institute's aerogenesis body is full of the Du Shi pipe within the time 8h from sending out in 3 expressions; Institute's aerogenesis body is not full of the Du Shi pipe to 2 tables within the time 12h from sending out; 1 expression is full of Du Shi and manages from sending out after the time 12h institute's aerogenesis body.

(3) wine output ability: will activate good bacterial classification inoculation to TTC lower floor substratum, 28 ℃ of constant temperature culture 24 h pour 15 ml TTC upper strata substratum into, cover original bacterium colony, and 28 ℃ of following lucifuge insulation 2～3 h observe colony colour.Little red (wine output ability is weak) represented with 1; Pink (wine output ability is general) represented with 2; Dark red (wine output ability is strong) represented with 3.

(4) flocculence: bacterium to be measured is inoculated in the centrifuge tube that 1.5 mL YPD liquid nutrient mediums are housed, 28 ℃ leave standstill and cultivate centrifugal collection bacterium mud behind 48 h, respectively clean twice with 250 mmol/L EDTA solution and sterilized water, centrifugal collection thalline also is suspended from flocculation damping fluid (50 mmol/L Trisodium Citrates, 20 mmol/L CaCl ₂) in, survey OD at wavelength 590 nm places with Biolog ₁Value; Cell suspension is placed 25 ℃ then, 120 r/ min, 2 h that vibrate finish to flocculation, and room temperature leaves standstill 30 min, gets supernatant liquor at wavelength 590nm place survey OD ₂Value.Flocculation level (F)=(OD ₁-OD ₂)/OD ₁* 100%.The more easy flocculation of more big this yeast of expression of F value.

(5) from dissolubility: will activate good bacterial classification inoculation in the YPD-BCIP substratum, and transfer to behind 20 ℃ of cultivation 24 h and cultivate in 37 ℃ of environment, and observe colony colour behind 24 h, and judge its self-dissolving level according to its depth that whether changes and change.

(6) produce H ₂The S ability is measured: each test strain is seeded on the BIGGY nutrient agar, in 30 ℃ of cultivation 4d ~ 7d, continues to observe colony colour and changes, and investigates each test strain according to shade and produces H ₂The S ability.1: oyster white; 2: light brown; 3: brown; 4: dark-brown; 5: brownish black.Numerical value is more high, color is more dark shows that then H2S generation ability is more strong.

(7) detection of product biogenic amine characteristic: will activate good bacterial classification inoculation and detect in the substratum to biogenic amine, 25 ℃ of cultivations, observe periphery of bacterial colonies substratum colour-change behind 3 d, raise when yeast will make the pH of substratum during to the alkalogenic biogenic amine of amino acid decarboxylase, the purple circle appears in periphery of bacterial colonies.

(8) pectinase activity is measured: will activate good bacterial classification inoculation and cultivate 5 d for 30 ℃ in the polygalacturonic acid nutrient agar.Bamboo let with sterilization washes down with distilled water after striking off bacterium colony, with the ammoniated ruthenium oxychloride dyeing of 0.08 g/100 mL, observes its colour-change behind 6 h, whether judges according to the purple circle occurring whether it has pectinase activity, the depth representative product enzyme power of purple.

(9) activity of beta-glucosidase is measured: will activate good bacterial classification inoculation in polychrom Glycerin Agar substratum, the periphery of bacterial colonies colour-change is observed in 25 ℃ of cultivations behind the 8d, and the periphery of bacterial colonies substratum Vandyke brown circle occurs and then illustrates to have activity of beta-glucosidase.With the diameter of the dark brown chromosphere of vernier caliper measurement, judge that according to the size of chocolate loop diameter it produces the enzyme power.

(10) data analysing method: use the grey association analytical method that the above-mentioned basic fermentation character of 441 strain yeast (containing the commercial bacterium of 5 strains) is analyzed, filter out preceding 5 strain strain excellents.

Know by the basic fermentation character analysis of above-mentioned yeast saccharomyces cerevisiae and strain excellent screening.

Adopt different types of synthetic medium and semisynthetic medium, 436 Accharomyces cerevisiaes after identifying and the commercial yeast saccharomyces cerevisiae of 5 strains are carried out different tolerance (anti-pol, the ethanol-tolerant degree, the heatproof degree, low nitrogen etc.), work the property sent out, flocculence from dissolubility, is produced the biogenic amine characteristic, qualitative wine output ability, produce the quantitative or qualitative analysis of hydrogen sulfide, produce polygalacturonase and beta-glucosidase aptitude tests, utilize grey relational grade analysis, preceding 5 strains that filter out the grey relational grade ordering are thought the alternative bacterial strain of strain strain excellent as Musa's Lay, see Table 2.

Through basic fermentation character test, the 5 strain preponderant strainses that filter out work the property sent out and all are higher than rank of the commercial bacterium of 5 strains, and 1 strain wine output ability is medium, and all the other 4 strain wine output abilities are strong partially, the weak hydrogen sulfide that produces, do not produce biogenic amine, all the other indexs show most bacterium better tolerance, flocculence, from dissolubility, and produce polygalacturonase and beta-glucosidase good, the part characteristic is higher than commercial bacterial strain far away, sees Table 3, table 4.

But the above-mentioned measuring of process is learnt and is numbered GTGM-E2 at absorbed nitrogen 300mg/L, pol 26Brix, cultivate under the suitable growth condition for 28 ℃, its energy for growth (its biomass) is apparently higher than the commercial bacterial strain of 5 strains, and be best in the test strain growing ability, anti-37 ℃ with 45 ℃ of high temperature tests in its OD ₅₉₀Value still is the highest in the test strain, sees Table 4, proves that this bacterial strain has good growth and breeding ability in high-temperature cultivation, for thermophilic fermentation Musa Lay is thought candidate's strain excellent.This bacterial strain has higher anti-high sugar simultaneously, the ability of anti-low nitrogen and the quick volatility that rises, and it is moderate to produce wine, strong flocculence with by force from dissolubility, a little less than the sulfite reductase activity (producing the hydrogen sulfide ability), can produce polygalacturonase and beta-glucosidase, do not produce biogenic amine, see Table 3, table 4.

The commercial bacterium weighted association of the preceding 5 strain quality yeast bacterium of table 2 and 5 strains degree

Strain number	The weighted association degree	In 441 strain bacterium, strengthen related order
			GTGM-E2	0.941	1
F1-7d2-04	0.939	2
			C1-AR3-03	0.938	3
LTSM-1	0.933	4
			B3-23d1-02	0.928	5
cy3079	0.908	8
			RZ	0.882	16
L2323	0.871	29
			EC118	0.871	29
R796	0.869	33

The basic leavening property of the commercial bacterial strain of the good S. cervisiae of table 35 strains and 5 strains

Table 3 note: rise to send out a property evaluation: 4 expressions are full of Du Shi and manage from sending out within the time 4h institute's aerogenesis body, and wherein 4 ⁺The expression time short (about 2h), 4 ^-The expression time long a little (about 4h); Institute's aerogenesis body is full of the Du Shi pipe within the time 8h from sending out in 3 expressions; Institute's aerogenesis body is not full of the Du Shi pipe to 2 tables within the time 12h from sending out; 1 expression is full of Du Shi and manages from sending out after the time 12h institute's aerogenesis body; From the dissolubility evaluation: 1: blueness; 2: light blue; 3: yellowish green; 4: oyster white; Produce the polygalacturonase evaluating characteristics: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; Activity of beta-glucosidase is estimated: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; Wine output ability is estimated: 1 little red (wine output ability is weak); 2: pink (wine output ability is general); 3: dark red (wine output ability is strong); Sulfite reductase is estimated: 0: white (not producing); 1: oyster white; 2: light brown; 3: brown; 4: dark-brown; 5: brownish black (very strong enzyme is lived); Produce the polygalacturonase evaluating characteristics: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; The product activity of beta-glucosidase is estimated: 0: do not produce; 1: activity a little less than; 2: produce, active general; 3: produce, activity is stronger; Produce the biogenic amine characteristic: test strain to tyrosine, phenylalanine, Histidine, tryptophane, the biogenic amine characteristic is produced in the arginine metabolism, and 0 expression is not produced.

The commercial bacterial strain resistance characteristics of the good S. cervisiae of table 45 strains and 5 strains

The basic fermentation character substratum of yeast saccharomyces cerevisiae and reagent among the present invention:

1.YPD the mushy stage substratum is the same.

2.TTC lower floor's substratum: glucose 10.0 g/L, peptone 2.0 g/L, yeast extract 1.5 g/L, KH ₂PO ₄1.0 g/L, MgSO ₄7H ₂O 0.4 g/L, pH value 5.5～5.7 agar 30.0 g/L, 121 ℃ of autoclaving 20min.

3.TTC upper strata substratum: TTC 0. 5 g/L, glucose 5.0 g/L, agar 15 g/L, 121 ℃ of autoclaving 20min; Musa's Lay is thought the preparation (every liter) of synthetic medium: 130 g glucose, 130 g fructose, 6 g citric acids, 6g DL-oxysuccinic acid, 750 mg KH ₂PO ₄, 500 mg KH ₂SO ₄, 250 mg MgSO ₄7H ₂O, 155 mg CaCl ₂2H ₂O, 200 mg NaCl, 4 mg MnSO ₄H ₂O, 4 mg ZnSO ₄, 1 mg CuSO ₄5H ₂O, 1 mg KI, 0.4 mg CoCl ₂6H ₂O, 1 mg H ₃BO ₃, 1 mg NaMoO ₄2H ₂O, 20 mg inositols, 2 mg nicotinic acid, 1.5 mg calcium pantothenate, 0.25 mg VITMAIN B1,0.25 mg vitamin B6, and 0.003 mg vitamin H, 15 mg ergosterols, 5 mg sodium oleates, 0.5 ml tween-80.The composition of nitrogenous source (wt/wt): 2.81% ammonium nitrogen (NH ₄Cl), 39.03% L-proline(Pro), 4.31%L-glutamine, 23.46% L-arginine, 3.13% L-tryptophane, 2.58% L-L-Ala, 2.64% L-L-glutamic acid, 2.03% L-Serine, 1.73% L-Threonine, 1.75% L-leucine, the 1.12%L-aspartic acid, 1.43% L-Xie Ansuan, 2.34%L-phenylalanine, 1.04% L-Isoleucine, 1.79% L-Histidine, 1.32%L-tyrosine, the 1.09%L-glycine, 6.49% L-Methionin, 0.24% methionine(Met).Filtration sterilization.

4. tolerance test media: (1) but in the simulation Sucus Vitis viniferae absorbed nitrogen be adjusted into 56.03 mg/L and 300 mg/L respectively, form low nitrogen tolerance substratum and normal nitrogen growth medium; (2) add 26%, 45% and 50% (wt/wt) glucose and fructose (1 ︰ 1) respectively in the simulation Sucus Vitis viniferae, form different pol tolerance substratum; (3) add in the simulation Sucus Vitis viniferae substratum 8%, 10%, 12% and 14%(v/v) dehydrated alcohol, form different wine degree tolerance substratum; (4) the temperature tolerance substratum is normal nitrogen growth medium.

5. work the property sent out: packing 10 mL and field red grape infusion juice in test tube, put into inverted Durham's fermentation tube, be inverted test tube after sealing with the test tube plug gently repeatedly, make Durham's fermentation tube fill Sucus Vitis viniferae, 115 ℃ of autoclaving 15 min, standby.

6. detect substratum from dissolubility: yeast extract paste 1%, peptone 2%, glucose 2%, agar 2%, 0.004%, 121 ℃ of autoclaving 20min of BCIP (5-bromo-4-chloro-3-indyl-disodic alkaliine).

7. biogenic amine detects substratum: glucose 2%, peptone 2%, yeast extract paste 1%, agar 2%, 0.006% purpurum bromocresolis, 1% corresponding amino acid (Histidine, tyrosine, phenylalanine, tryptophane, Methionin and arginine), adjust pH to 6.3,121 ℃ of autoclaving 20min.

8. pectinase activity detects substratum: polygalacturonic acid 1%, YNB 0.67%, potassium primary phosphate 0.68%, glucose 1%, the separately sterilization of 3%, 121 ℃ of sterilization of agar, 20 min(agar).

9. activity of beta-glucosidase detects substratum: 1% polychrom, 0.03% iron trichloride, 1% caseinhydrolysate, 0.8% glycerine, 2.5% yeast extract paste, 2% agar, adjust pH to 6.0,121 ℃ of autoclaving 20min.

Embodiment three: utilize yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) GTGM-E2 CGMCC No.7513 high-heat fermentation process prepares Musa's Lay and think

The pilot scale fermentation test of 25L is carried out in 5 strains screening strain and the commercial bacterium of cy3079 (contrast) in Awat County, Xinjiang cutter youth Musa Lai Si factory, simulation Musa Lay is thought the growing environment of yeast, with the spontaneous fermentation of not inoculating bacterial classification in contrast, probe into these yeast and under modern making method, Musa's Lay is thought the influence of quality, be fit to the strain excellent that Musa's Lay is thought modern making method to filter out.

1. adopt the high-heat fermentation process flow process and operate as follows, referring to accompanying drawing 1.

(1) distiller's yeast preparation: with yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) fresh culture thing on the GTGM-E2 CGMCC No.7513 YPD solid medium, insert in the grape infusion juice of 24Brix, cultivate 24h for 28 ℃, standby.

(2) raw material selection and flushing: manually with foreign matters such as stones and go rotten, sort out from grape material such as Chinese olive, choose clean grape and utilize tap water that silt is rinsed well.

(3) squeeze the juice: utilize crusher that the grape after above-mentioned steps (2) selection and the flushing is dug up the roots after the fragmentation, utilize expeller to squeeze, Sucus Vitis viniferae is pumped into Buffer Pool, carry out quiescent setting, then squeeze into steam cooker.

(4) infusion: in the skin slag that step (3) is squeezed out, add to flood the water yield that the skin slag is advisable, infusion 2h～6h, enduring well-done skin pulp water filters, Sucus Vitis viniferae after skin pulp water after the filtration and the squeezing is squeezed into steam oven with the ratio of 1:3 ~ 1:8(v:v) and is boiled infusion, and regularly detecting pol end of a period pol is 22Brix～25Brix.

(5) cooling: steam off, with water coolant step (4) infusion juice is cooled off, be cooled to 35 ℃ and squeeze in the fermenting container.

(6) fermentation: with the fresh distiller's yeast of step (1) preparation, 1%(v/v by total fermented liquid) inoculum size inserts cooled grape infusion juice, inoculation temp is 32 ℃ ~ 35 ℃, envrionment temperature is fermented for 20 ℃-30 ℃, the product temperature is 25 ℃～37 ℃, optimal temperature is 28 ℃, regularly detects pol, till pol no longer reduces.

(7) after-ripening, sterilization and can: after the fermentation ends, carry out after-ripening, the after-ripening temperature must not surpass 25 ℃, and wine and schlempe are placed 40 ~ 45d, and supernatant liquor is imported in the clean container, before can, carry out 65 ℃ ~ 75 ℃ sterilization 30min, cool off and cool the temperature to room temperature, carry out can; If container is filled in untimely can, the sterilization conditions before can is the same.

2. fermentation process monitoring: during the fermentation, utilize saccharometer to measure the Brix of fermented liquid and utilize temperature and the test article temperature every 24h.Continuous 2～3d no longer falls up to pol, is decided to be fermentation termination, finishes fermentation.

3. factory industry fermenting experiment result and analysis: think traditional technology according to Musa's Lay thermophilic fermentation is carried out in screening strain (be contrast with commercial bacterial strain cy3079 and spontaneous fermentation), its technical process is referring to accompanying drawing 1.Carry out the wine degree of periodic analysis pol and leavened prod during the fermentation, residual sugar, total acid and organoleptic feature, its result is as follows.

No matter be spontaneous fermentation or pure-blood ferment, substrate (being sugar at this) consumption law meets the Logistic Changing Pattern, namely YBrix=A2+(A1-A2)/(1+(xd/x0) ^p)), but that parameter A 1, A2 and P between the screening strain, contrast strain and spontaneous fermentation and Logistic fitted figure thereof all have is remarkable different, sees Table 5, sees accompanying drawing 5, accompanying drawing 6.With respect to pure-blood ferment, spontaneous fermentation prior fermentation hypoglycemic (Brix) still is in the stuck fermentation stage, and purebred thermophilic fermentation enters yeast phase rapidly, shown in accompanying drawing 5, explains that further pure-blood ferment can significantly shorten the conclusion of fermentation period.With respect to low temperature fermentation, the high temperature pure-blood ferment has not only shortened the hypoglycemic lag phase (shortening 10d) of earlier fermentation), and the obvious high spontaneous fermentation of the hypoglycemic speed of yeast phase, referring to accompanying drawing 5, accompanying drawing 6, the soluble thermophilic fermentation cycle is significantly shorter than the low temperature fermentation cycle thus.GTGM-E2 fermented preceding 4 days in the 10 strains screening strain, and hypoglycemic (Brix) rate surpasses 50%, and apparently higher than other bacterial strains and spontaneous fermentation, and total Brix amount of falling finally is down to 8.1Brix, referring to accompanying drawing 7 for the highest.

In the thermophilic fermentation process, selected bacterial strain works the time of sending out and fermentation period far less than spontaneous fermentation in the factory (rise and send out a time 5d, fermentation period is 16d), plays a time in 1 day, fermentation period is in 6～10 days, and wherein the GTGM-E2 fermentation period is the shortest (6d).With the natural wine ratio, each physical and chemical index difference is little: the wine degree is between 10.9%～12.2%, and wherein GTGM-E2 wine degree is the highest, is 12.2%; Total acid is higher than commercial bacterium 5.36g/L, is 6.34g/L～6.83 g/L, and total reducing sugar and reducing sugar between 5.50 g/L～6.50g/L and 2.50 g/L～3.10 g/L, see Table 6 respectively.

To sum up test as can be known, GTGM-E2 is that a suitable thermophilic fermentation dry type Musa Lay is thought desirable strain.

Pol (Brix) changes the Logistic mathematical model parameter in the traditional spontaneous fermentation of table 5 (thermophilic fermentation) process

Bacterium number	The A1 value	The A1 standard deviation	The A2 value	The A2 standard deviation	The x0 value	The x0 standard deviation	The p value	The p standard deviation	R2	Prob＞F
											Spontaneous fermentation	24.21	0.41	11.70	1.05	6.51	0.26	7.02	1.69	0.9780	0.00
LTSM-A1	163.04	1350.31	-1.80	15.42	0.01	0.39	0.41	0.74	0.9970	0.00
											GTGM-E2	150.48	2611.98	-3.64	43.68	0.01	0.57	0.34	1.52	0.9910	0.00
F1-7d2-04	23.82	0.87	7.98	0.24	2.05	0.11	2.80	0.33	0.9955	0.00
											C1-AR3-03	23.94	2.18	6.12	1.14	2.43	0.31	1.40	0.32	0.9956	0.00
B3-23d1-02	24.82	2.45	6.23	1.52	2.62	0.34	1.39	0.37	0.9940	0.00
											cy3079	31.93	10.27	6.06	1.80	1.45	0.82	1.26	0.53	0.9911	0.00

Table 6 screening plant height temperature fermentation Musa Lay is thought the statistics of features table

Bacterial strain	Rise and send out time d	Fermentation period d	Wine degree %	Total acid g/L	Total reducing sugar g/L	Reducing sugar g/L
							Spontaneous fermentation	5	16	11.8	6.34	6.00	2.90
LTSM-A1	1	8	12.2	6.34	5.80	2.70
							B3-23d1-02	1	10	11.2	6.50	6.30	2.90
C1-AR3-03	1	7	12.1	6.99	5.40	3.10
							GTGM-E2	1	6	12.2	6.77	5.70	2.80
F1-7d2-04	1	10	11.4	6.50	6.00	2.50
							cy3079	1	7	11.8	5.36	5.90	2.70

Embodiment four: Musa's Lay is thought the subjective appreciation method

Invite 10 to have Musa's Lay and think the expert of trial test experience and the expert that brew Musa Lay is thought, to Musa's Lay of above-mentioned workshop brew capable subjective appreciation of pursuing progress.Because Musa's Lay is thought color and luster, turbidity and camerlsed and raw material have direct relation, 6 strains test strain (containing the commercial bacterium of 1 strain) and natural fermentation broth come from same batch of raw material, fermented wine is at color and luster, opacity, very close between the typicalness (camerlsed), think provincial standard DB65/T 2925-2008 according to Musa's Lay, by the expert it is done unified qualitative description; To being subjected to yeast to influence the fragrant feature of bigger ferment and flavor characteristics is carried out the order minor sort, carry out statistical study according to GB GBT/12315-2008/ISO:8578, seek the difference between the product of making wine.Think quality characteristic according to Musa's Lay, the ordering target setting is ferment perfume (or spice), fragrance Harmony, and acidity, sugariness, the fragrance persistence, the sample of commenting the person of tasting will taste after contrasting is inserted the sensory evaluation scores table shown in the table 7 in proper order.In the test, identical for strip spare, test code number adopts 2 bit digital at random, puts at random in face of the valuation officer and tastes.

Table 7 Musa Lay is thought the sensory evaluation scores table

Index	1	2	3	4	5	6	7
								Sweet-smelling
Sweet
								Acid
Fragrance Harmony
								The fragrance persistence

7 parts of high temperature brews of table 8 Musa Lay is thought subjective appreciation F check significance (α=0.05)

Odour characteristics	Sweet-smelling	Fragrance Harmony	Sugariness	Acidity	The fragrance persistence
						The F value	13.436	2.275	2.524	5.660	13.436
Significance	0.000	0.047	0.030	0.000	0.000

7 parts of high temperature brews of table 9 Musa Lay is thought subjective appreciation T-test two-tailed test (α=0.05)

By above-mentioned subjective appreciation as can be known, the characteristic feature that Musa's Lay that free bacterial strain, commercial bacterial strain and traditional spontaneous fermentation are brewageed is thought sample compares, and the obtained wine thereby product are very close, are brown, and color and luster is dark, and is evenly muddy, gives caramel odor.7 parts of Musa's Lays are thought specimen, sweet-smelling, sugariness, acidity, fragrance Harmony and persistence have the significance difference opposite sex, see Table 8, wherein GTGM-E2 all there were significant differences between Musa's Lay of sweet-smelling, fragrance Harmony and commercial bacterium cy3079 and the brew of spontaneous fermentation institute is thought property, aspect sugariness, think significant difference with spontaneous fermentation Musa Lay, having significant difference with commercial bacterium aspect the fragrance persistence, see Table 9, aspect acidity and with reference to no significant difference (data not shown).There is significant difference in LTSM-A1 aspect the sweet-smelling and between spontaneous fermentation and the commercial bacterium; F1-7d2-04 makes Musa's Lay and thinks with spontaneous fermentation and commercial bacterium remarkable difference is being arranged aspect the fragrance Harmony, and C1-AR3-03 has significant difference with two with reference to product on the fragrance persistence; B3-23d1-01 has significant difference with commercial bacterium cy3079 on sweet-smelling and fragrance Harmony, see Table 9, investigate sense organ product decide rank with, in 7 duplicate samples, GTGM-E2 is higher than other specimen in sweet-smelling and fragrance Harmony rank sum, wherein sweet-smelling sum of ranks 60, in specimen for the highest, acidity sum of ranks 24, sum of ranks is minimum in test specimens, see Table 10, fragrance persistence and sugariness are moderate, are respectively 34 and 36, test index sum of ranks is in proper order: sweet-smelling＞fragrance Harmony＞fragrance persistence＞sugariness＞acidity, Musa's Lay think of characteristics that bacterial strain GTGM-E2 makes are aroma strong fragrances, pure, mouthfeel is plentiful, has good fragrance Harmony and persistence.

This shows, but be numbered the GTGM-E2 bacterial classification at absorbed nitrogen 300mg/L, pol 26Brix, under the suitable growth condition of 28 ℃ of cultivations, its energy for growth (its biomass) is apparently higher than the commercial bacterial strain of 5 strains and free bacterial strain, and anti-37 ℃ and 45 ℃ of high temperature capabilities are the strongest, and ability is high sugared, the ability of anti-low nitrogen and the quick volatility that rises, product wine is moderate, strong flocculence with by force from dissolubility, a little less than the sulfite reductase activity (producing the hydrogen sulfide ability), can produce polygalacturonase and beta-glucosidase, not produce biogenic amine.In the thermophilic fermentation process, can enter yeast phase rapidly, high hypoglycemic speed characteristic worked the time of sending out in 1 day, and fermentation period is short, only is 6 days.Musa's Lay of institute's brew is thought the wine degree 12.2%, total acid 6.77g/L, total reducing sugar 5.50 g/L, reducing sugar 2.50 g/L.Has the characteristic feature that Musa's Lay is thought sample, brown, color and luster is dark, evenly muddy, give caramel odor, aroma strong fragrance, pure, it is moderate to have good Harmony and persistence, sour and sweet palatability in sum, shows that bacterium numbering is that a kind of suitable thermophilic fermentation dry type Musa Lay is thought desirable strain for the GTGM-E2 bacterial classification.

Table 10 thermophilic fermentation Musa Lay is thought the subjective appreciation cartogram

SEQUENCE LISTING 1

＜110〉Zhu Lixia of Tarim University

＜120〉26S rDNA primer

<130> NL1

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

＜213〉primer NL1

<400> 1

gcatatcaataagcggaggaaaag 24

SEQUENCE LISTING 2

＜110〉Zhu Lixia of Tarim University

＜120〉26S rDNA primer

<130> NL4

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

＜213〉primer NL4

<400> 1

ggtccgtgtttcaagacgg 19

SEQUENCE LISTING 3

＜110〉Zhu Lixia of Tarim University

＜120〉a kind of Musa's Lay is thought the high temperature yeast saccharomyces cerevisiae

<130> GTGM-E2

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 583

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

cacgggatgc ttagtacggc gagtgagcgg caaaagctca aatttgaaat ctggtacctt 60

cggtgcccga gttgtaattt ggagagggca actttggggc cgttccttgt ctatgttcct 120

tggaacagga cgtcatagag ggtgagaatc ccgtgtggcg aggagtgcgg ttctttgtaa 180

agtgccttcg aagagtcgag ttgtttggga atgcagctct aagtgggtgg taaattccat 240

ctaaagctaa atattggcga gagaccgata gcgaacaagt acagtgatgg aaagatgaaa 300

agaactttga aaagagagtg aaaaagtacg tgaaattgtt gaaagggaag ggcatttgat 360

cagacatggt gttttgtgcc ctctgctcct tgtgggtagg ggaatctcgc atttcactgg 420

gccagcatca gttttggtgg caggataaat ccataggaat gtagcttgcc tcggtaagta 480

ttatagcctg tgggaatact gccagctggg actgaggact gcgacgtaag tcaaggatgc 540

tggcataatg gttatatgcc gcccgtcttg aaacacggac caa 583

Claims (3)

1. One kind can produce the high temperature yeast saccharomyces cerevisiae that Musa's Lay thinks ( Saccharomyces cerevisiae) GTGM-E2, this yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) preserving number of GTGM-E2 is CGMCC No.7513.
2. One kind utilize the described yeast saccharomyces cerevisiae of claim 1 ( Saccharomyces cerevisiae) GTGM-E2 produces the method that Musa's Lay is thought, and it is characterized in that described method concrete steps comprise:

   (1) distiller's yeast preparation: with yeast saccharomyces cerevisiae ( Saccharomyces cerevisiae) the fresh culture thing of GTGM-E2 CGMCC No.7513 on the YPD solid medium, insert in the grape infusion juice of 24Brix, cultivate 24h for 28 ℃, standby;

   (2) raw material selection and flushing: manually with foreign matters such as stones and go rotten, sort out from grape material such as Chinese olive, choose clean grape to utilize tap water that silt is rinsed well;

   (3) squeeze the juice: utilize crusher that the grape after above-mentioned steps (2) selection and the flushing is dug up the roots after the fragmentation, utilize expeller to squeeze, Sucus Vitis viniferae is pumped into Buffer Pool, carry out quiescent setting, then squeeze into steam cooker;

   (4) infusion: in the grape skin that step (3) is squeezed out, add to flood the water yield that the skin slag is advisable, infusion 2h～6h, enduring well-done skin pulp water filters, Sucus Vitis viniferae after skin pulp water after the filtration and the squeezing is squeezed into steam oven with the ratio of 1:3 ~ 1:8(v:v) and is boiled infusion, and regularly detecting pol end of a period pol is 22Brix～25Brix;

   (5) cooling: steam off, with water coolant step (4) infusion juice is cooled off, be cooled to 35 ℃ and squeeze in the fermenting container;

   (6) fermentation: with the fresh distiller's yeast of step (1) preparation, 1% (v/:v) inoculum size by total fermented liquid inserts cooled grape infusion juice, inoculation temp is 32 ℃ ~ 35 ℃, envrionment temperature is fermented for 20 ℃-30 ℃, the product temperature is 25 ℃～37 ℃, optimal temperature is 28 ℃, regularly detects pol, till pol no longer reduces;

   (7) after-ripening, sterilization and can: after the fermentation ends, carry out after-ripening, the after-ripening temperature must not surpass 25 ℃, and wine and schlempe are placed 40 ~ 45d, and supernatant liquor is imported in the clean container, before can, carry out 65 ℃ ~ 75 ℃ sterilization 30min, cool off and cool the temperature to room temperature, carry out can; If container is filled in untimely can, the sterilization conditions before can is the same.
3. One kind utilize the described yeast saccharomyces cerevisiae of claim 1 ( Saccharomyces cerevisiae) method thought of the described production of CGMCC No.7513 and claim 2 Musa Lay prepares Musa's Lay and think.

Images