CN105274235A

CN105274235A - Application of for ABCA3 genes to detecting congenital CCMC (cataract-microcornea syndrome)

Info

Publication number: CN105274235A
Application number: CN201510789150.XA
Authority: CN
Inventors: 陈鹏; 代云海; 谢立信; 王晔; 肖晶晶; 张清岩; 管李萍; 王俊
Original assignee: SPECIALTY OF OPHTHALMOLOGY RESEARCH INSTITUTE SHANDONG PROV; BGI Shenzhen Co Ltd
Current assignee: SPECIALTY OF OPHTHALMOLOGY RESEARCH INSTITUTE SHANDONG PROV; BGI Shenzhen Co Ltd
Priority date: 2013-10-09
Filing date: 2013-10-09
Publication date: 2016-01-27
Anticipated expiration: 2033-10-09
Also published as: CN105274236A; CN105274235B; CN103589787A; CN105274236B; CN103589787B

Abstract

The invention aims to provide application of ABCA3 genes to preparing diagnosis products for detecting congenital cataract-microcornea syndrome (CCMC). The application has the advantages that novel application of the ABCA3 genes is provided, and accordingly an effective way is provided for genetic diagnosis of congenital CCMC diseases, prenatal gene screening and genetic counseling; as shown by application effects, SNP (single nucleotide polymorphism) sites and detection primers of the genes can be effectively used for quickly detecting ABCA3 gene mutation sites for clinical patients and villus or amniotic fluid of fetuses.

Description

ABCA3 gene is detecting the application in congenital CCMC

Technical field

The invention belongs to the correlative technology field of gene diagnosis and prenatal gene diagnosis, be specifically related to ATP connecting box (ABC) and transport the application of sub-A3 (ABCA3) in preparation detection congenital cataract-microcornea syndrome (CCMC) gene diagnosis goods.

Background of invention

Congenital cataract is the common illness in eye causing low vision children and blinding, and sickness rate is about 0.01% ~ 0.06%, and wherein about 50% is relevant with heredity, and its mode of inheritance is the most common with autosomal dominant inheritance.Congenital cataract can independently occur, and also can be used as eye or the syndromic concomitant symptom of whole body, and wherein the patients with congenital cataract of 12%-18% often occurs to merge microcornea symptom.Cataract-microcornea syndrome (Cataract-microcorneasyndrome, CCMC, OMIM116200) be a kind of congenital dysplasia illness in eye, often involve eyes, show as not isophenic cataract and cornea transverse diameter is less than 10mm, the anterior ocular segment that often occurs together dysplasia, as abnormal in iridocoloboma, Peters, corectopia and ocular ataxy etc., these Poly-monstrosities often make Most patients DE, are one of major reasons of congenital blinding.And compare with simple congenital cataract, the patient Geng Yi of the microcornea that occurs together suffers from glaucoma, and causes irreversible visual impairment.At present limited for CCMC treatment means, blind rate is very high, brings heavy economical load to the whole society.

The cause of disease and the pathomechanism of congenital CCMC it be unclear that, and study less at present in the world.Genetics research result both domestic and external shows this disease to a great extent because inherited genetic factors causes.Up to now, existing 7 Disease-causing genes are proved (referring to table 1).

Table 1: cataract-microcornea syndrome Disease-causing gene location and clone's situation

CCMC has significant genetic heterogeneity, there is multiple candidate disease causing genes.Up to the present still limited to the understanding of the Disease-causing gene of CCMC, 7 knowns only can explain the morbidity of patient less than 30% up to now.This has become the pathogenetic research of CCMC and the bottleneck of etiotropic Diagnosis and Treat research.This present situation is impelled and is gone further find and understand the new Disease-causing gene of this disease, for follow-up gene diagnosis, antenatal diagnosis and gene therapy provide basic.

Summary of the invention

The object of this invention is to provide the application of a kind of ABCA3 gene in preparation detection congenital cataract-microcornea syndrome (CCMC) diagnostic product, thus make up the deficiencies in the prior art.

Applicant has found that 4 generations are the CCMC family of autosomal dominant inheritance, through candidate gene order-checking, eliminates the possibility that 7 known candidate genes sudden changes are caused a disease; Meanwhile, carried out the order-checking of exon group to the core member of this family further, the Disease-causing gene ATP connecting box (ABC) that have found this family transports sub-A3 (ABCA3), thus facilitates the present invention.

First the present invention provides the purposes that ABCA3 gene is new, is for the preparation of the application detected in congenital cataract-microcornea syndrome (CCMC) diagnostic product;

The present invention also provides a kind of for detecting the primer pair of congenital cataract-microcornea syndrome (CCMC), and the upstream and downstream primer sequence of described primer pair is SEQIDNO:1-38, and its primer information is as follows:

The present invention also provides a kind of for detecting the test kit of congenital cataract-microcornea syndrome (CCMC), includes any one or several in above-mentioned primer pair.

The present invention also provides SNP site that is a kind of and congenital cataract-microcornea syndrome (CCMC) disease-related, and be by initiator codon the 4393rd, ABCA3 gene coding region, its base is G or A;

The present invention also provides SNP site that is another kind of and congenital cataract-microcornea syndrome (CCMC) disease-related, and be by initiator codon the 2408th, ABCA3 gene coding region, its base is C or T;

The present invention also provides SNP site that is another kind of and congenital cataract-microcornea syndrome (CCMC) disease-related, and be by initiator codon the 4253rd, ABCA3 gene coding region, its base is A or T;

The invention provides the new purposes of ABCA3 gene, thus provide a kind of approach effectively carrying out the diagnosis of congenital CCMC disease gene, prenatal gene examination and genetic counseling, effect show gene provided by the present invention SNP site and detect primer can effectively for clinical patients and fetus fine hair or amniotic fluid carry out ABCA3 gene mutation site rapid detection.

Accompanying drawing explanation

Fig. 1: ABCA3 gene coding region is the 4393rd SNP site information by initiator codon, and its base is G or A.

Fig. 2: ABCA3 gene coding region is the 2408th SNP site information by initiator codon, and its base is C or T.

Fig. 3: ABCA3 gene coding region is the 4253rd SNP site information by initiator codon, and its base is A or T.

Fig. 4: patient and normal people ABCA3 sequencer map in the cataract-microcornea syndrome family of embodiment 1, wherein A-C: patient; D-F: normal people.In this family, the ABCA3 gene coding region of three patients the 4393rd base by initiator codon there occurs heterozygous mutant, and sport A by G, it is heterozygous mutant that the sequencing result of its reverse primer shows this site, sports T by C.

Fig. 5: patient and normal people ABCA3 sequencing result in the cataract-microcornea syndrome family of embodiment 2.A-E: patient; F-J: normal people.In this family, the ABCA3 gene coding region of five patients the 2408th base by initiator codon there occurs heterozygous mutant, and sport T by C, it is heterozygous mutant that the sequencing result of its reverse primer shows this site, sports A by G.

Fig. 6 a: the cataract-microcornea syndrome patient of embodiment 3 and mother (normal people) ABCA3 sequencing result thereof.A: patient; B: normal people.This patient ABCA3 gene coding region the 4253rd base by initiator codon there occurs heterozygous mutant, and sport T by A, it is heterozygous mutant that the sequencing result of its reverse primer shows this site, sports A by T.

Embodiment

Applicant of the present invention finds the mutational site of ABCA3 gene in a geneogenous CCMC family, and confirms that the sudden change of this gene is the Disease-causing gene of this disease in another geneogenous CCMC family and the several patient of distributing, thus facilitates the present invention.

ABCA3 belongs to the member of ABCA subfamily in abc transport Zijia race, its gene forms by more than 80000 nucleotide bases, be positioned at 16p13.3, the mRNA (NM_001089) of the about 6500bp of transcribed one-tenth, directly translate the protein of formation 1704 amino acid compositions.

Below the present invention is described in detail.

One, the screening in the mutational site of ABCA3 gene is found in congenital CCMC family

Embodiment 1: the mutational site of screening ABCA3 gene from congenital CCMC family

1, peripheral blood genomic dna is extracted:

Meeting national relevant policies regulation, and on the basis that sampling object is agreed to, extract first family member peripheric venous blood 2-5ml, put into EDTA anticoagulant tube ,-80 DEG C frozen for subsequent use; Frozen EDTA anticoagulation, after room temperature is melted, is got 500 μ L and is put in centrifuge tube, add equal-volume TE (pH8.0), and mixing, 4 DEG C, centrifugal 10 minutes of 10000rpm, abandons supernatant.

Add 180 μ LTE, 20 μ LSDS (10%), 8 μ L Proteinase K (l0mg/ml) mixings, be placed in 37 DEG C of water-baths and spend the night.Sample is taken out, brief centrifugation precipitation sample from water-bath.In reaction tubes, add the saturated phenol of isopyknic Tris-(about 300 μ L), fully mix, centrifugal 10 minutes of 10000rpm under room temperature, Aspirate supernatant (about 300 μ L) is in a new centrifuge tube.Repeat phenol extracting once, in the new centrifuge tube of Aspirate supernatant to.

Add the saturated phenol of isopyknic Tris: chloroform mixed solution (each 150 μ L of phenol, chloroform), mixing, centrifugal 10 minutes of room temperature 10000rpm, the new centrifuge tube of transfer supernatant liquor to.

Add the saturated phenol of isopyknic Tris: chloroform: primary isoamyl alcohol mixed solution (each 100 μ L of phenol, chloroform, primary isoamyl alcohol), mixing, centrifugal 10 minutes of room temperature 10000rpm, the new centrifuge tube of transfer supernatant liquor to.

Add l/10 volume 3mol/L, pH5.2 sodium-acetate (about 30 μ L), 2 times of volume precooling 100% ethanol, mix, visible white flocks gently.Centrifugal 10 minutes of room temperature 10000rpm, makes DNA be deposited at the bottom of pipe, abandons supernatant.

Add 70% ethanol to DNA precipitation, once, centrifugal 5 minutes of room temperature 7000rpm, abandons supernatant in rinsing, is placed in room temperature volatilization residue ethanol, finally adds 50 μ LTE (pH8.0), 4 DEG C of dissolving DNAs that spend the night.

To the capable agarose gel electrophoresis of DNA extracted, and apply ultraviolet spectrophotometer in 260nm and 280nm colorimetric, detect DNA purity and concentration.

2. exon group order-checking: exon group order-checking (ExomeSequencing) is a kind of novel genome analysis technology, only need for the DNA in full genome exon (exon) region, get the genomic dna of 3 patients in this family, the exon region that NimbleGen (44Mb) targetenrichmentsystem collects human genome is applied by Shenzhen Huada Genetic Technology Co., Ltd, IlluminaGA high-flux sequence is carried out in the application exon library of IlluminaGenomeAnalyzerII platform to enrichment, what capture in 18357 goal gene altogether is 18283 (99.6%) individual.By these sudden change filtration 4 data of normal people storehouses: single nucleotide polymorphism database (dbSNP129, http://www.ncbi.nlm.nih.gov/projects/SNP/snp_summary.cgi/), thousand human genome plan (February28, 2011releasesforSNPs, andFebruary16, 2011releasesforindelshttp: //www.1000genome.org/), Hapmap8 database (http://hapmap.ncbi.nlm.nih.gov/), and Yan Di and Huang Di, two legendary rulers of remote antiquity's database, filter out non-106, the synonym unknown mutation site that 3 patients have further, application direct sequencing screen in this family to be divided into pathogenic haplotype from Disease-causing gene ABCA3, and in the normal local crowd's peripheral blood genomic dna sample of 200 example, carry out the Mutation Screening in this site, do not find this sudden change.

3. direct sequencing verifies the sudden change of patient ABCA3 gene in this family

Pcr amplification object fragment: reaction conditions and reaction system:

(1) PCR reaction conditions: 94 DEG C of 3min; 94 DEG C of 40sec, 55 ± 3 DEG C of 40se, 72 DEG C of 60sec, 30-35cycles; 72 DEG C of 10min.

(2) reaction system: (TAKARALATaqpolymerase)

Apply this reaction system and carry out the genomic DNA template of Mei Ming family member and the amplified reaction of this ABCA3 primer respectively.

PCR primer checks order: apply conventional Sanger sequencing and check order to above-mentioned PCR primer, in this family, the ABCA3 gene coding region of three patients the 4393rd base by initiator codon there occurs heterozygous mutant, A is sported by G, it is heterozygous mutant that the sequencing result of its reverse primer shows this site, T (Fig. 4) is sported by C, the 1465th, ABCA3 albumen is caused to be l-asparagine by Aspartic acid mutations, point of application mutation forecasting program SIFT (SortingIntolerantFromTolerant) predicts discovery, this sudden change result in the damage of ABCA3 protein function " damaging " level, thus cause the generation of CCMC in this family.Repeatedly sequencing result shows that this mutational site is not because amplification or order-checking mistake are introduced.In the 200 normal local crowds of example and this family normal people peripheral blood genomic dna sample in carry out the Mutation Screening in this site, do not find this sudden change.

By above-mentioned analysis, prove that ABCA3 gene can be used for detecting the danger whether patient has potential trouble CCMC.Compared in normal homologous segment by each exon fragment of the ABCA3 gene by tester, determine the risk of person to be detected.

According to the primer pair of its each exon of genome sequence design amplification of ABCA3, the sequence information of its positive anti-primer is as follows:

ABCA3-1L:AGAAATGGAAAGTGACTCCTCT

ABCA3-1R:GTCTGTGGGTTACTGGAAGTT

ABCA3-2L:AACTTCCAGTAACCCACAGAC

ABCA3-2R:AGAGTGGAGTCAGAATCAAGGT

ABCA3-3L:ACCTTGATTCTGACTCCACTCT

ABCA3-3R:GAAAGAGTCCTAGCACATCAGA

ABCA3-4L:AGCTTTAGCTCATTACCTTGTC

ABCA3-4R:CCTGGTCAATCAGACAGAATTA

ABCA3-5L:ACATCAGAGCTGATTCTGTGAC

ABCA3-5R:ATAGTTTATGTCTCCTGGATGC

ABCA3-6L:CGTACAGTGGGAGACCATC

ABCA3-6R:CACTAATCCAGTGTCTCACCTT

ABCA3-7L:GCTGGGACACTCACTATATTTC

ABCA3-7R:CTGATGAACTTCTTCTTCTTGG

ABCA3-8L:GTTCTCGTAGAAACTGCTGACT

ABCA3-8R:GTCTGAGGACCTCCAAATG

ABCA3-9L:CATTTGGAGGTCCTCAGAC

ABCA3-9R:ATTGTCACATGGTCAGCATAG

ABCA3-10L:ACTCTGTCACATCTGACTTTGG

ABCA3-10R:GAGACACTGATGAGTGAGGAAA

ABCA3-11L:GTGAGTCAGATACGTGCTTCTC

ABCA3-11R:CTTCCTAGAACCACACCATAAC

ABCA3-12L:GTTGCACAGTACAGTCAGAGGT

ABCA3-12R:GACTGTGTCTCTCCCTCCAG

ABCA3-13L:CGCTGAGATGGTGTTAAAG

ABCA3-13R:AGAAAGCACTCAGAAACGAGTA

ABCA3-14L:GTTGAGGTTCAGGTCTCTGAC

ABCA3-14R:ATCTAGTGTGTCTGCTGGTTGT

ABCA3-15L:GAGGTAAAAGGCACTACAGAAG

ABCA3-15R:AACTTTGTGGTCAGAGACTTCA

ABCA3-16L:CTAAATTACGCTGACTTTCCTC

ABCA3-16R:GACATAGTAAGACCCTGTCGAA

ABCA3-17L:AGGAGTGACTGCTATTGACTTG

ABCA3-17R:TGTTAAGGAGTGTCCAGATGAT

ABCA3-18L:GCCTTTTACAGGTTGAAGTAGT

ABCA3-18R:CACAAAAGAAGGTGAGAGACAT

ABCA3-19L:GCCTTTTACAGGTTGAAGTAGT

ABCA3-19R:CACAAAAGAAGGTGAGAGACAT

Apply the detection that above-mentioned every pair of primers carries out ABCA3 gene respectively.

Embodiment 2: the mutational site of screening ABCA3 gene from another congenital CCMC family

1. extract peripheral blood genomic dna: the conventional phenol chloroform method narrated in Application Example 1 extracts genomic dna each member's peripheral blood in family.

2.PCR amplification object fragment: reaction conditions and reaction system:

(1) PCR reaction conditions: 94 DEG C of 3min; 94 DEG C of 40sec, 55 ± 3 DEG C of 40se, 72 DEG C of 60sec, 30-35cycle; 72 DEG C of 10min.

(2) reaction system: (TAKARALATaqpolymerase)

Apply genomic DNA template that this reaction system carries out every patient respectively respectively with the amplified reaction of 19 pairs of primers of ABCA3 gene.

3.PCR product checks order: apply conventional Sanger sequencing and check order with the amplified production of 19 pairs of primers of ABCA3 gene respectively to the genomic DNA template of patient in family, result shows that the ABCA3 gene coding region of five patients in this family the 2408th base by initiator codon there occurs heterozygous mutant, T is sported by C, it is heterozygous mutant that the sequencing result of its reverse primer shows this site, A (Fig. 5) is sported by G, the 803rd, ABCA3 albumen is caused to sport methionine(Met) by Threonine, point of application mutation forecasting program SIFT predicts discovery, this sudden change result in the damage of ABCA3 protein function " damaging " level, thus cause the generation of CCMC in this family.Reproducible results demonstrates the verity in this site.And in the 200 normal local crowds of example and this family normal people peripheral blood genomic dna sample in carry out the Mutation Screening in this site, do not find this sudden change.

Embodiment 3: the mutational site of screening ABCA3 gene from another 2 the congenital CCMC of distributing patients

CCMC patient is distributed in collection: collect the clear and definite CCMC of 2 example diagnosis in Shandong eye institute and Qingdao ophthalmologic hospital altogether and distribute patient.

Extract peripheral blood genomic dna:

Extract the peripheric venous blood 2-5ml that 2 examples distribute CCMC patient respectively, put into EDTA anticoagulant tube ,-80 DEG C frozen for subsequent use; Frozen EDTA anticoagulation is after room temperature is melted, and get 500 μ L and be put in centrifuge tube, the conventional phenol chloroform method narrated in Application Example 1 extracts genomic dna each member's peripheral blood in family.

Pcr amplification object fragment: reaction conditions and reaction system:

(2) reaction system: (TAKARALATaqpolymerase)

PCR primer checks order: apply conventional Sanger sequencing and check order with the amplified production of 19 pairs of primers of ABCA3 gene respectively to the genomic DNA template of every patient, the heterozygous mutant all detecting ABCA3 gene in patient is distributed: ABCA3 gene coding region the 4253rd base by initiator codon there occurs heterozygous mutant at 2, T is sported by A, it is heterozygous mutant that the sequencing result of its reverse primer shows this site, A (Fig. 6) is sported by T, the 1418th, ABCA3 albumen is caused to sport Isoleucine by asparagine, point of application mutation forecasting program SIFT predicts discovery, this sudden change result in the damage of ABCA3 protein function " damaging " level, thus cause the generation of patient CCMC.And in the 200 normal local crowds of example and this family normal people peripheral blood genomic dna sample in carry out the Mutation Screening in this site, do not find this sudden change.

Claims

1. an application for the SNP site of ABCA3 gene, is characterized in that, described application is the diagnostic product of preparation congenital cataract-microcornea syndrome (CCMC); Wherein SNP site is by initiator codon the 4253rd, the ABCA3 gene coding region that NCBI is numbered NM_001089, and its base is A or T.

2. apply as claimed in claim 1, it is characterized in that, described diagnostic product is that PCR detects primer.

3., for detecting a primer pair for congenital cataract-microcornea syndrome (CCMC), described primer requires the SNP site described in 1 for test right, and the information of primer pair is as follows:

ABCA3-5L:ACATCAGAGCTGATTCTGTGACSEQIDNO:9

ABCA3-5R:ATAGTTTATGTCTCCTGGATGCSEQIDNO:10。

4., for detecting a test kit for congenital cataract-microcornea syndrome (CCMC), it is characterized in that, described test kit includes primer pair according to claim 3.