CN104357550B

CN104357550B - A kind of syndromic diagnostic product of Axenfeld-Rieger that detects

Info

Publication number: CN104357550B
Application number: CN201410515439.8A
Authority: CN
Inventors: 陈鹏; 谢立信; 孙大鹏; 李素霞; 张阳阳
Original assignee: SPECIALTY OF OPHTHALMOLOGY RESEARCH INSTITUTE SHANDONG PROV
Current assignee: SPECIALTY OF OPHTHALMOLOGY RESEARCH INSTITUTE SHANDONG PROV
Priority date: 2014-09-30
Filing date: 2014-09-30
Publication date: 2016-05-25
Anticipated expiration: 2034-09-30
Also published as: CN104357550A

Abstract

The object of this invention is to provide a kind of MMRN1 gene and detect the application in Axenfeld-Rieger syndrome diagnosis goods in preparation, the invention provides the new purposes of MMRN1 gene, thereby a kind of approach that effectively carries out the diagnosis of congenital Axenfeld-Rieger syndrome disease gene, antenatal gene screening and genetic counselling is provided, and effect shows the SNP site of gene provided by the present invention and detects primer and can be effectively carry out the fast detecting of MMRN1 gene mutation site for clinical patients and fetus fine hair or amniotic fluid.

Description

A kind of syndromic diagnostic product of Axenfeld-Rieger that detects

Technical field

The invention belongs to gene diagnosis goods preparing technical field, be specifically related to a kind of detectionThe syndromic diagnostic product of Axenfeld-Rieger.

Background of invention

Axenfeld-Rieger syndrome refers to eyes developmental defect, with or grow without whole bodyOne group of abnormal developmental character disease, is characterized in: eyes developmental defect; Can be with whole body dysplasia;Secondary glaucoma; Autosomal dominant inheritance, has family history more, also has the report of Sporadic cases;Men and women falls ill identical. There is no at present effective treatment measure, operation poor prognosis.

The syndromic clinical characters of Axenfeld-Rieger is: the 1. existence of posterior embryotoxon: be thisSick characteristic feature, it shows as thickening of Schwalbe line and gives prominence to and reach. 2. iridocorneal angle is differentNormal: its main feature is that the thick band of organizing is crossed over angle recess from peripheral iris, with outstandingSchwalbe line is connected and angle, room is open, but iris root adheres to a high position, sclera ridge often byCover, iris root invests after trabecular network. 3. iris is abnormal: main manifestations is iris attenuation, mistakeGo that normal texture, pigment epithelial layer turn up, coremetamorphosis multiple pupil and occlusion of pupil etc. 4. can be withWhole body is abnormal: be mainly tooth and facial developmental defect; As tooth defect denticle, anodontia; Face middle partFlat, maxillary development can not have other whole bodies abnormal entirely in addition. 5. secondary glaucoma: 50%Above patient has secondary glaucoma, with childhood and adolescence morbidity common, but also have baby childrenYoungster's phase or midlife are sent out patient. 6. eyes morbidity: the overwhelming majority is eyes morbidities, is simple eye extremely individuallyMorbidity. 7. asexuality difference. 8. this disease has family history.

The syndromic etiology and pathology of Axenfeld-Rieger it be unclear that, and studies in the world at present less.Genetics research result both domestic and external shows that this disease mostly is autosomal dominant inheritance, also has Sporadic casesReport. Up to now, scientists has been located 3 Axenfeld-Rieger syndrome diseasesThe site of gene, and cloned 2 Disease-causing genes (referring to table 1).

Table 1:Axenfeld-Rieger syndrome Disease-causing gene location and clone's situation

Disease-causing gene	Chromosome mapping
		PITX2	4q25
FOXC1	6p25.3
			13q14

But known only can be explained a fraction of patient's morbidity, and this becomesThe syndromic pathogenetic research of Axenfeld-Rieger and etiotropic diagnosis and treatment researchBottleneck. This present situation impel further go find and understand the Disease-causing gene that this disease is new, for follow-upGene diagnosis, pre-natal diagnosis and gene therapy provide basis.

Summary of the invention

The object of this invention is to provide the syndromic diagnostic product of a kind of Axenfeld-Rieger of detection,Detect Axenfeld-Rieger syndrome from polyprotein 1 (MMRN1) design molecular labeling,Thereby make up the deficiencies in the prior art.

Applicant is the Axenfeld-Rieger syndrome family of autosomal dominant inheritance from 4 generationsIn, the whole members of this family have been carried out to full genome linkage analysis, determine the polyprotein 1 of this family(MMRN1) there is the pathogenic mutation in heredity, and in follow-up work, verified MMRN1 withThe syndromic relation of Axenfeld-Rieger, thus the present invention facilitated.

First the present invention provides the purposes that MMRN1 gene is new, for the preparation of detectionApplication in Axenfeld-Rieger syndrome diagnosis goods;

Above-mentioned diagnostic product, as embodiment preferably, be to detect Axenfeld-Rieger syndromePrimer or probe.

It is a kind of for detection of the syndromic primer pair of Axenfeld-Rieger, described that the present invention also providesThe upstream and downstream primer sequence of primer pair is in SEQIDNO:1-24, and its primer information is as follows:

The present invention also provides a kind ofMMRN1 gene code region is played the 1952nd by initiation codon, and its base is C or A;

Wherein as follows for detection of the primer information in above-mentioned SNP site:

MMRN1-E6-2F：GCTTTTATCAACTGAACAGGSEQIDNO:13

MMRN1-E6-2R：TTCCATATCGGAGGTACATTSEQIDNO:14。

The present invention also provides the SNP position of another and Axenfeld-Rieger syndrome disease associationPoint plays the 1157th for MMRN1 gene code region by initiation codon, and its base is T or A;

MMRN1-E6-1F：TGTTCTGCAAGTGATATCTCSEQIDNO:11

MMRN1-E6-1R：GTACTCAGTGACATTATTGCSEQIDNO:12

It is a kind of for detection of the syndromic kit of Axenfeld-Rieger that the present invention also provides, and includesAny one or several in above-mentioned primer pair.

The invention provides the new purposes of MMRN1 gene, effectively carry out thereby provide a kind ofThe approach of the diagnosis of Axenfeld-Rieger syndrome disease gene, antenatal gene screening and genetic counselling,Effect show the SNP site of gene provided by the present invention and detect primer can be effectively forClinical patients and fetus fine hair or amniotic fluid carry out MMRN1 gene mutation site fast detecting.

Brief description of the drawings

Patient and normal person MMRN1 in the Axenfeld-Rieger syndrome family of Fig. 1: embodiment 1Sequencer map, wherein A: patient; B: normal person in family. Five patient MMRN1 bases in this familyBecause coding region plays the 1952nd by initiation codon, heterozygous mutant has occurred, its base is prominent by CBecome A.

The Axenfeld-Rieger syndrome patient of Fig. 2: embodiment 2 and mother MMRN1 order-checking thereofFigure, wherein A: patient; B: mother. This patient MMRN1 gene code region is by initiation codonRise the 1157th there is heterozygous mutant, its base by T for sporting A.

Detailed description of the invention

MMRN1 gene is positioned at Chr4:90.8 – 90.88Mb, the about 3687bp's of transcribed one-tenthMRNA (NCBI accession number is NM_007351.2), directly translation forms 1228 amino acid groupsThe protein becoming.

Below in conjunction with embodiment, the present invention is described in detail.

Embodiment 1: the sudden change of screening MMRN1 gene from Axenfeld-Rieger syndrome familySite

1, extract peripheral blood genomic DNA:

Meet national relevant policies regulation, and on the basis of agreeing at sampling object, extracting firstThe peripheric venous blood 2-5ml of Axenfeld-Rieger syndrome family member, puts into EDTA anticoagulant tube,-80 DEG C frozen for subsequent use; Frozen EDTA anticoagulation, after room temperature is melted, is got 500 μ L and is put in centrifugalPipe, adds equal-volume TE (pH8.0), mixes, and 4 DEG C, centrifugal 10 minutes of 10000rpm, abandonsClearly.

Add 180 μ LTE, 20 μ LSDS (10%), 8 μ L Proteinase Ks (l0mg/ml) to mix, putSpend the night in 37 DEG C of water-baths. From water-bath, take out sample, instantaneous centrifugation sample. In reaction tube, addEnter the saturated phenol of isopyknic Tris-(approximately 300 μ L), fully mix, 10000rpm centrifugal 10 under room temperatureMinute, draw supernatant (approximately 300 μ L) to a new centrifuge tube. Repeat phenol extracting once, in absorptionIn the new centrifuge tube of clear liquid to.

Add the saturated phenol of isopyknic Tris: chloroform mixed liquor (phenol, the each 150 μ L of chloroform), mixes chamberCentrifugal 10 minutes of temperature 10000rpm, shifts the new centrifuge tube of supernatant to.

Add the saturated phenol of isopyknic Tris: chloroform: isoamyl alcohol mixed liquor (phenol, chloroform, isoamyl alcohol each 100μ L), mix, centrifugal 10 minutes of room temperature 10000rpm, shifts the new centrifuge tube of supernatant to.

Add l/10 volume 3mol/L, pH5.2 sodium acetate (approximately 30 μ L), 2 times of volume precoolings 100%Ethanol, mixes visible white flocculent deposit gently. Centrifugal 10 minutes of room temperature 10000rpm, makesDNA is deposited in the pipe end, abandons supernatant.

Add 70% ethanol to DNA precipitation, rinsing once, centrifugal 5 minutes of room temperature 7000rpm,Abandon supernatant, be placed in room temperature volatilization residue ethanol, finally add 50 μ LTE (pH8.0), 4 DEG C are spent the nightDissolving DNA.

To the capable agarose gel electrophoresis of DNA extracting, and apply ultraviolet specrophotometer at 260nm and280nm colorimetric, detects DNA purity and concentration.

2, linkage analysis: passed through by logical Deco skill Development Co., Ltd of the happy U.S. in BeijingOmniZhonghua8 chip carries out linkage analysis to member in this family, shows the region that possibility is chainFor: Chr1:32048052-41842350, Chr4:83673890-133385086, Chr5:148196737-158687153，Chr10:135656-13166875，Chr13:46707064-60101738，Chr15:64367745-78960529，Chr16:23361853-27126459，Chr19:288738-3013374。

3, extron group order-checking: extron group order-checking (ExomeSequencing) is a kind of novelGenome analysis technology, only need, for the DNA in full gene extron (exon) region, get this family3 patients' genomic DNA in system, applies with health Bioisystech Co., Ltd by Beijing shellfish is auspiciousAgilentHumanAllExon50M chip is caught the exon region of human genome, then rightHigh-flux sequence is carried out in the extron library of enrichment. To suddenly change and filter 4 data of normal people storehouses: monokaryonThuja acid polymorphism data storehouse (ftp: //ftp.ncbi.nih.gov/snp/database/), thousand human genome plans(ftp: //ftp-trace.ncbi.nih.gov/1000genomes/ftp/), Hapmap8 database(http://hapmap.ncbi.nlm.nih.gov/), and Yan Di and Huang Di, two legendary rulers of remote antiquity's database(http://yh.genomics.org.cn/), further filters out 3 patients have be positioned at and may connect40, the nonsynonymous mutation site in lock region, application direct sequencing screens and causes a disease in this familyHaplotype be divided into from Disease-causing gene MMRN1, and at normal population peripheral blood genomic DNA sampleIn this, carry out the Mutation Screening in this site, do not find this sudden change.

4, direct sequencing is verified the sudden change of patient MMRN1 gene in this family

Pcr amplification object fragment: reaction condition and reaction system:

(1) PCR reaction condition: 94 DEG C of 3min; 94 DEG C of 40sec, 55 ± 3 DEG C of 40se, 72 DEG C60sec，30-35cycles；72℃10min。

(2) reaction system: (TAKARALATaqpolymerase)

Applying this reaction system carries out respectively the genomic DNA template of Mei Ming family member and is somebody's turn to doThe amplified reaction of MMRN1 primer.

The order-checking of PCR product: apply conventional Sanger PCR sequencing PCR above-mentioned PCR product is checked order,Wherein apply primer pair MMRN1-E6-2F:GCTTTTATCAACTGAACAGG,MMRN1-E6-2R:TTCCATATCGGAGGTACATT, five patients in this familyMMRN1 gene code region is played the 1952nd by initiation codon heterozygous mutant, its base has been occurredBy C for sporting A (Fig. 1). Repeatedly sequencing result shows that this mutational site is not because amplificationOr the wrong introduction of order-checking. Point of application mutation forecasting program SIFT and all discoveries of PolyPhen prediction,This sudden change has caused the damage of MMRN1 protein function " damaging " level, thereby has caused patientThe syndromic generation of Axenfeld-Rieger. And it is normal in the 200 normal local crowds of example and this familyIn people's peripheral blood genomic DNA sample, carry out the Mutation Screening in this site, do not find this sudden change.

By above-mentioned analysis, prove that MMRN1 gene can be used for detecting patient and whether have latentSuffering from the syndromic danger of Axenfeld-Rieger. Each by by tester's MMRN1 geneExtron fragment, in normal homologous segment comparison, is determined person's to be detected ill risk.

According to the primer pair of its each extron of genome sequence design amplification of MMRN1, its positive and negative drawingThe sequence information of thing is as follows:

MMRN1-E1F：AGAAACAGGAAACCGAACTT

MMRN1-E1R：ATAATTTTCTGGGAGTGAGG

MMRN1-E2F：GCAATCTTACAAGGTTTCTG

MMRN1-E2R：GTGTCTGCATTTTCACTTAC

MMRN1-E3F：TAGGCATTGCCCCAAAAACT

MMRN1-E3R：TAACAGTCCTAGGAGTTTGGC

MMRN1-E4F：GCTTCAGTACGCGGGAAAATG

MMRN1-E4R：CCACAATTTCTCCCAACATCC

MMRN1-E5F：TAGTGGTGAAAGTGAGCATC

MMRN1-E5R：CATACCACCCAAACTAAAGC

MMRN1-E6-1F：TGTTCTGCAAGTGATATCTC

MMRN1-E6-1R：GTACTCAGTGACATTATTGC

MMRN1-E6-2F：GCTTTTATCAACTGAACAGG

MMRN1-E6-2R：TTCCATATCGGAGGTACATT

MMRN1-E6-3F：ACTATGCCCTAAAAGAGACT

MMRN1-E6-3R：TTGCTCAACTGTACAGATCT

MMRN1-E7F：CTAAGGGATTTGCATGACGT

MMRN1-E7R：AGTGGATCCAGATTAAGCAG

MMRN1-E8-1F：TGCTAAGTTTGATGGATGGC

MMRN1-E8-1R：CACTTTGTTTTCTGTGCCAC

MMRN1-E8-2F：CTGCTCTGTTTTGGTTTTTC

MMRN1-E8-2R：GAGCATCCCATAAATTGTAG

MMRN1-E8-3F：GTACCTACAGATCTGCCCTT

MMRN1-E8-3R：GTGCTTCTGATTCTCATGGG

Apply respectively above-mentioned every pair of primers and carry out the detection of MMRN1 gene.

Embodiment 2: screen MMRN1 base in the congenital Axenfeld-Rieger of distributing syndrome patientThe mutational site of cause

Axenfeld-Rieger syndrome patient is distributed in collection: in Shandong eye institute and Qingdao eyeHospital of section collects the clear and definite Axenfeld-Rieger syndrome of diagnosis and distributes patient.

Extract peripheral blood genomic DNA:

Extract respectively the peripheric venous blood that this distributes Axenfeld-Rieger syndrome patient and mother thereof2-5ml, puts into EDTA anticoagulant tube, and-80 DEG C frozen for subsequent use; Frozen EDTA anticoagulation is in chamberTemperature melt after, get 500 μ L and be put in centrifuge tube, the conventional phenol chloroform method of narrating in Application Example 1 fromIn family, in each member's peripheral blood, extract genomic DNA.

Pcr amplification object fragment: reaction condition and reaction system:

(1) PCR reaction condition: 94 DEG C of 3min; 94 DEG C of 40sec, 55 ± 3 DEG C of 40se, 72 DEG C of 60sec,30-35cycles；72℃10min。

(2) reaction system: (TAKARALATaqpolymerase)

Apply genomic DNA template that this reaction system carries out respectively every patient respectively withThe amplified reaction of 12 pairs of primers of MMRN1 gene.

PCR product order-checking: apply the genomic DNA mould of conventional Sanger PCR sequencing PCR to this patientPlate checks order with the amplified production of 12 pairs of primers of MMRN1 gene respectively, wherein uses primer pairMMRN1-E6-1F:TGTTCTGCAAGTGATATCTC and MMRN1-E6-1R:GTACTCAGTGACATTATTGC has detected MMRN1 gene in this name is distributed patientHeterozygous mutant: MMRN1 gene code region is played the 1157th base by initiation codon and has been occurredHeterozygous mutant, sports A (Fig. 2) by T, causes that the 386th, MMRN1 albumen dashed forward by leucineBecome glutamine, point of application mutation forecasting program SIFT predicts discovery, and this sudden change has caused MMRN1The damage of protein function " damaging " level, thus patient Axenfeld-Rieger syndrome causedGeneration. And in 200 example normal local crowds and this familys normal person's peripheral blood genomic DNAIn sample, carry out the Mutation Screening in this site, do not find this sudden change. Thereby show the prominent of MMRN1 geneBecome with Axenfeld-Rieger syndrome and have linkage relationship.

Claims

1. a MMRN1 gene is in for the preparation of detection Axenfeld-Rieger syndrome diagnosis goodsApplication, it is characterized in that, described detection for detect MMRN1 gene code region whether exist by riseBeginning codon plays the base C of the 1952nd to the sudden change of A; Or played the alkali of the 1157th by initiation codonBase T is to the sudden change of A.

2. application as claimed in claim 1, is characterized in that, described diagnostic product is that PCR detectsPrimer or probe.

3. for detection of the syndromic primer pair of Axenfeld-Rieger, it is characterized in that, describedPrimer pair be MMRN1-E6-1F:TGTTCTGCAAGTGATATCTCSEQIDNO:11,MMRN1-E6-1R:GTACTCAGTGACATTATTGCSEQIDNO:12 orMMRN1-E6-2F：GCTTTTATCAACTGAACAGGSEQIDNO:13、MMRN1-E6-2R：TTCCATATCGGAGGTACATTSEQIDNO:14。

4. for detection of the syndromic kit of Axenfeld-Rieger, it is characterized in that described examinationAgent box includes any one or several in primer pair claimed in claim 3.