CN105274119A

CN105274119A - Cell wall acid invertase inhibitor gene LcCIF and application thereof

Info

Publication number: CN105274119A
Application number: CN201510652952.6A
Authority: CN
Inventors: 王惠聪; 赵杰堂; 张洁琼; 吴子辰; 刘恋; 黄旭明
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2015-10-10
Filing date: 2015-10-10
Publication date: 2016-01-27
Anticipated expiration: 2035-10-10
Also published as: CN105274119B

Abstract

Belonging to the technical field of molecular biology, the invention in particular discloses a cell wall acid invertase inhibitor gene LcCIF and application thereof. The LcCIF nucleotide sequence is shown as SEQ ID No:1. The inhibitor can combine with cell wall acid invertase to inactivate it, through short-term silencing of the cell wall acid invertase inhibitor, the cell wall acid invertase activity can be enhanced, and liquid endosperm early development can be promoted. The cell wall acid invertase inhibitor gene LcCIF can be used for improving the fruit setting rate of Nuomici litchi, and has wide application prospect in production.

Description

Cell walls acidic conversion enzyme level subbase is because of LcCIF and application thereof

Technical field

The present invention relates to field of molecular biotechnology, more specifically, relate to cell walls acidic conversion enzyme level subbase because of lcCIFand application.

Background technology

Endosperm is ubiquity in angiosperm seed.The growth of endosperm is the important composition of of embryo development, and the polar core of fertilization, without dormancy, just starts to carry out mitotic division, forms a large amount of albuminous cells through repeatedly dividing.The main function of endosperm is for developmental embryo provides nutrition.Lichee is bloomed latter 3 days of pollination, and the fusion of visible spermoblast of cutting into slices, spends latter 6 days, and existing a small amount of endosperm (free core) exists, after spending 20 ~ 30 days, and blastular endosperm is very abundant, and to spending latter about 50 days, albuminous cell is all absorbed.Have research to think that the growth of endosperm directly has influence on the developmental process of embryo, endosperm is rich in various hormone makes seed become metabolism center, attract nutrient for other some growth growths of itself and fruit so the growth of endosperm affects very large on embryonic development.

This research finds that the content of the Litchi Varieties liquid endosperm of different seed development type is obviously different, and " glutinous rice wrapped in lotus leaves " liquid endosperm amount of stamen abortion type is few, and the impaired development of visible liquid endosperm may be the major cause of " glutinous rice wrapped in lotus leaves " abortion; Relatively other Litchi Varieties, the low and shakiness of bearing fruit is an outstanding problem on glutinous rice wrapped in lotus leaves is produced, and has had a strong impact on output and the economic benefit of this kind.The fruit-setting rate of general lichee does not reach 5% of Female Flower Number, and glutinous rice wrapped in lotus leaves is lower.It is bad that to be glutinous rice wrapped in lotus leaves fruit make to bear fruit in the early stage endosperm abortion of growing topmost reason, and prior art is unclear for the Study on Molecular Mechanism of glutinous rice wrapped in lotus leaves early stage endosperm abortion.

Summary of the invention

Technical problem to be solved by this invention be overcome prior art exist above-mentioned defect, provide a kind of cell walls acidic conversion enzyme level subbase because of lcCIF.

Second object of the present invention is to provide the application of said gene.

The object of the invention is to be achieved by the following technical programs:

A kind of cell walls acidic conversion enzyme level subbase because of lcCIF, its nucleotide sequence is as shown in SEQIDNO:1.

The present invention also provide described cell walls acidic conversion enzyme level subbase because of lcCIFthe albumen of coding, its aminoacid sequence is as shown in SEQIDNO:2.

Cell walls acidic conversion enzyme level is a kind of protein regulating cell walls acidic conversion enzymic activity, belong to the sub-supergene family of pectinesterase enzyme level, it can under the condition of pH4.5, be combined with cell walls acidic conversion enzyme active sites closely, cause cell walls acid invertase cannot be combined with sucrose, thus lose catalytic activity.

The present invention be also provided for increasing described lichee cell walls acidic conversion enzyme level subbase because of lcCIFprimer, its primer sequence is as shown in SEQIDNO:3 ~ 4.

The present invention also provide containing cell walls acidic conversion enzyme level subbase described in claim 1 because of lcCIFexpression vector .

The present invention also provides described gene or described expression vector improving the application in lichee fruit-setting rate.

The present invention also provides described gene or described expression vector to improve the application in the preparation of lichee fruit-setting rate in preparation.

Preferably, described lichee is glutinous rice wrapped in lotus leaves.

Compared with prior art, the present invention has following beneficial effect:

The present invention clone first cell walls acidic conversion enzyme level subbase because of lcCIFthis suppression can combine with cell walls acid invertase and make it lose activity, cell walls acidic conversion enzymic activity is improved by short-term silenced cell Teichaic acid Invertase inhibitor, promote liquid endosperm early development, can be used for the fruit-setting rate improving Litchi chinensis cv. Nuomici, production has this application prospect widely.

Accompanying drawing explanation

Fig. 1 is the agarose gel electrophoresis figure of Partial Litchi tissue RNA sample, and wherein, swimming lane 1 ~ 4 is Litchi Leaves sample, swimming lane 5 ~ 8 is lichee seed coat sample, swimming lane 9 ~ 12 is lichee seedstalk sample, and swimming lane 13 ~ 14 is the sample of lychee flower, and swimming lane 15 ~ 16 is Seed Kernel of Litchi Chinesis sample.

Fig. 2 is lcCIFaminoacid sequence and other species homologies comparisons.

Fig. 3 is TRV1 (a) and TRV2 (b) structural representation; Wherein, RdRP is the RNA polymerase that RNA relies on; 16K is the 16kDa albumen being rich in halfcystine; Mp is motor protein; Cp is capsid protein; MCS is multiple clone site.

But Fig. 4 is the impact on Litchi chinensis cv. Nuomici embryo after the process of replicon gene silence.

Embodiment

Further illustrate content of the present invention below in conjunction with Figure of description and specific embodiment, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the simple modification do the inventive method, step or condition or replacement, all belong to scope of the present invention; If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.

embodiment 1 lichee cell walls acidic conversion enzyme level subbase because of clone

One, the extraction of lichee sample RNA and quality examination

RNA that the blade, flower, pericarp, base of fruit, seed coat, kind benevolence etc. of test kit (concrete grammar is with reference to specification sheets) to " cv. Feizixiao ", " black leaf " and " glutinous rice wrapped in lotus leaves " lichee organize extracts to adopt the CHMC ultrafast type RNA in ocean to extract, the concentration ultraviolet nucleic acid-protein detector of RNA, get the ratio that 1 μ l measures 260nm and 280nm, if between 1.80 ~ 2.00, next step experiment can be carried out.If RNA concentration is higher, detect after certain multiple can be diluted.

Agarose gel electrophoresis detected result, as Fig. 1, can find out that RNA presents 28S and 18S two band clearly, and the brightness of 28S is about the twice of 18S, does not have conditions of streaking, without DNA pollution.Show that the RNA quality comparation extracted is high, without obvious degradation, meet the needs of subsequent experimental.

Two, cell walls acidic conversion enzyme level subbase because of clone

According to lichee gene order-checking result, recall all about the super annotate genes because of family of pectin methylesterase, to the compound crystal model of the cell walls acid invertase of arabidopsis cell wall acid invertase and tobacco, sub contrast with the crystal model of pectinesterase enzyme complex finds with pectinesterase enzyme level, although two kinds are suppressed son all to belong to same supergene family, all again that the avtive spot of substrate is suppressed, but because the avtive spot of substrates enzymes is different, so two kinds are suppressed son also to have very large difference on avtive spot, according to the comparing of other species, suppression of acid invertase generally all includes the such avtive spot of GXPKFXE, according to this point comparison in the pectin methylesterase supergene family of lichee, find three genes with such site.And forecast analysis is carried out to three genes, only find that a Litchi_GLEAN_10013696 has signal peptide, and be positioned extracellular (Fig. 2).Design total length primer is carried out by the sequence of Litchi_GLEAN_10013696 on lichee genome database, its total length is cloned, finally obtain suppression of the lichee cell walls acid invertase of 477bp, called after LcCIF, its gene order is as shown in SEQIDNO:1, the protein amino acid sequence of coding is as shown in SEQIDNO:2, the homology pressing down replicon gene and tobacco that the homology of cell walls acidic conversion enzyme level of it and tobacco reaches 38%(Arabidopis thaliana is 41%), with database comparison, do not find differences.

embodiment 2 lichee cell walls acidic conversion enzyme level subbase because of functional verification

one, lcCIFthe clone of gene fragment

With lichee lcCIFabout 500bp fragment design primer, and to add before primer with pTRV2's bamhI and smathe carrier sequence joint of the 15bp of I restriction enzyme site homology, primer sequence sees the following form 1, and pcr amplification condition is 94 DEG C, 2min; 98 DEG C, 10s, 55 DEG C, 30s, 72 DEG C, 30s, 30 circulations; 72 DEG C, 10min.Get 2 μ l and carry out agarose gel electrophoresis detection, and purifying reclaims.

Two, viral silent carrier pTRV2(pYL156) enzyme cut

Virus silent carrier pTRV1 (pYL192), pTRV2(pYL156) structural representation as Fig. 3, choose pTRV2(pYL156) on bamhI and smai two restriction enzyme sites carry out double digestion to carrier, and restriction enzyme selects NEB(NewEnglandBiolabs) company bamHiHF and smai restriction endonuclease.Reaction system is: pTRV2 plasmid 1 μ g, and each 1 μ l, the 10 × CutsmartBuffer5 μ l of restriction endonuclease, complements to 50 μ l with water.15 minutes are cut, 65 DEG C of enzyme deactivations 20 minutes in 37 DEG C of enzymes.Ethanol, after phenol chloroform, through the NaAc precipitation of the dehydrated alcohols of 2 times and 1/10 volume, after what the ethanol with 75% was conscientious wash twice, dries up by digestion products.Linearization plasmid after enzyme is cut is dissolved in the distilled water of 20 μ l for subsequent use.

Three, the extraction of recombinant plasmid, connection, conversion and qualification

Utilize GibsonAssembly ^?masterMix(NewEnglandBiolabs) linearized vector that the pcr amplification product after step one purifying and step 2 obtain is connected, concrete reaction system is: the pcr amplification product that 1 μ l purifying reclaims, 1 μ l linearized vector, 4 μ l2 × GibsonAssemblyMasterMix, supply 8 μ l with water.Get 2 μ l and proceed to 50 μ l bacillus coli DH 5 alpha competence after 50 DEG C of reaction half an hour, what order-checking qualification result was correct is pTRV2-LcCIF recombinant plasmid, expands and shakes extraction plasmid.

Four, utilize freeze-thaw method by recombinant plasmid transformed Agrobacterium

Taking out 100 μ lGV3101 Agrobacterium competent cells in thawing on ice, adding 5 μ l recombinant plasmid dnas immediately.Flick, place 30min on ice, freezing 5min in liquid nitrogen, in 37 DEG C of water-baths, temperature bath 5min, on ice 2min, add the YEP(AgrobacteriumGrowthMedium of 500 μ l of antibiotic-free) liquid nutrient medium, 28 DEG C are shaken 3 ~ 4h.3000r, centrifugal 3min, remove substratum 500 μ l, and 100 remaining μ l are all spread evenly across (100 μ l100mgl on YEP solid medium ^-1kan, 50 μ l50mgl ^-1rif).28 DEG C of static 2 ~ 3d.Shake bacterium in containing antibiotic (100 μ l100mgl ^-1kan, 50 μ l50mgl ^-1rif), in YEP substratum, 28 DEG C, 250rpm shaken overnight, bacterium liquid PCR verifies.

Five, the extensive extraction of plasmid

Picking positive colony contains 100 μ gml in 500 μ l ^-1lB(Lysogenybroth, the LB of Amp) in liquid nutrient medium, incubated overnight.Transfer 100 μ l bacterium liquid to 10mlLB liquid nutrient medium 37 DEG C of incubated overnight, and the centrifugal 1min of 15,000g collects thalline, adds according to every milliliter of thalline:

SolutionI100 μ l(ice bath 5min thermal agitation)

SolutionII200 μ l(ice bath 5min mixes gently)

SolutionIII150 μ l(ice bath 5min mixes gently)

Solution (I ~ III) is see Molecular Cloning: A Laboratory guide (Sha's nurse Brooker, U.S., 2005).

The centrifugal 5min of 15,000g, supernatant adds RNAse(10mgml ^-1) add equal-volume phenol after 37 DEG C of 1h: chloroform (1:1), after thermal agitation 15,000g5min is centrifugal, gets supernatant, adds equal-volume chloroform isoamyl alcohol, 15,000g, 5min reset and add 1/10 volume 2.5MNaAc and 2 volume dehydrated alcohols, after-20 DEG C of precipitation 10min, use 75% washing with alcohol, add appropriate distilled water after drying and dissolve.

Six, Agrobacterium enlarged culturing and infect

100 μ l100mgl are added in every 100mlYEP substratum ^-1kan, 50 μ l50mgl ^-1rif.Picking list bacterium colony to 2ml centrifuge tube contains 500 μ lYEP substratum, after proceed to 50ml centrifuge tube and shake bacterium 15ml, 28 DEG C, 200r.m, shake bacterium and spend the night.Comprise pTRV1 and pTRV2-LcCIF two kinds of bacterium.

The bacterium liquid that first day is shaken, be diluted in fresh YEP substratum by 1:50 or 1:25, every 100mlYEP substratum adds 1ml1MMES(final concentration 10mM), 10 μ l Syringylethanone mother liquors (final concentration 20mM), 100 μ l100mgl ^-1kan, 50 μ l50mgl ^-1rif.500ml triangular flask shakes bacterium 100 ~ 200ml, 28 DEG C, and 200rpm shakes bacterium and spends the night.

The centrifugal 15min of 3000g, outwells substratum, makes it to be uniformly suspended in infect in liquid with rifle pressure-vaccum thalline, inhales and plays mixing until without bulk.Hang bacterial concentration with spectrophotometer check weighing, make OD ₆₀₀1.0 ~ 3.0, by the by volume 1:1 mixing of pTRV1 and pTRV2-LcCIF bacterium liquid, dark place leaves standstill 4 ~ 6 hours.

Choose three strain female flowers and bloom " glutinous rice wrapped in lotus leaves " of phase as experiment material, utilize the OD prepared March 19 (female flower full-bloom stage) ₆₀₀=1.0 dip-dyeing solution carry out spraying decoration process (treatment group), and control group is: spray OD ₆₀₀=1.0 infect liquid containing unloaded, (after first and second physiological fruit drops) are investigated average fringe fruit-setting rate and embryo development situation to process latter 50 days.

Result shows: compared with the control, and the number of bearing fruit of the single fruit fringe for the treatment of group " glutinous rice wrapped in lotus leaves " lichee obviously increases, and contrasting that average single fringe bears fruit is 1.68 ± 0.48, and treatment group is then 2.57 ± 0.45, and number of on average bearing fruit is than contrast raising 53%.Spend latter 50 days, contrast fruit and seed are on average heavily respectively 1.67 ± 0.07g and 0.293 ± 0.017g, treatment group is respectively 1.66 ± 0.07g and 0.291 ± 0.016g, both no significant differences, but, from the form of seed, the inner chamber for the treatment of group seed is obviously greater than contrast seed (see figure 4), and the size that litchi fruits grows seed seed coat is decided by liquid endosperm amount, and liquid endosperm amount is more, seed coat is larger, and this result illustrates that the growth for the treatment of group fruit liquid endosperm is obviously more than contrast fruit.

SEQUENCELISTING

<110> Agricultural University Of South China

<120> cell walls acidic conversion enzyme level subbase is because of LcCIF and application thereof

<130>

<160>4

<170>PatentInversion3.3

<210>1

<211>477

<212>DNA

<213>LcCIF gene order

<400>1

atgatgttcatggtcttgtttattgaaagtcaagtttctgctgacttgattgatgatacg60

tgcaataaaacgcccttctataatctttgtgtcaccaccctgagatcagaccctcaaagc120

tccaaggctgatgtgcaaggcctggctcgtatagccgccataaagcttcaggataaagca180

actagtaccaagaatcaaatcaatgacttacttaaagggaaaacagatccaaagctgaaa240

ggggccttgaacatttgtgctgacgcgtacaacattatagtgaagtatgacatttcagtt300

atcattggagccatcacaaaaggtaacccgaaatttgcagaagaatatgctattgattta360

actaaagaggctgataaatgtggtaagggcatctcaggatcaccattggctagtaacaac420

aagtttgtgcatgacctctctgatgtagttctatttattgtcagattgttactttga477

<210>2

<211>158

<212>PRT

<213>LcCIF aminoacid sequence

<400>2

MetMetPheMetValLeuPheIleGluSerGlnValSerAlaAspLeu

151015

IleAspAspThrCysAsnLysThrProPheTyrAsnLeuCysValThr

202530

ThrLeuArgSerAspProGlnSerSerLysAlaAspValGlnGlyLeu

354045

AlaArgIleAlaAlaIleLysLeuGlnAspLysAlaThrSerThrLys

505560

AsnGlnIleAsnAspLeuLeuLysGlyLysThrAspProLysLeuLys

65707580

GlyAlaLeuAsnIleCysAlaAspAlaTyrAsnIleIleValLysTyr

859095

AspIleSerValIleIleGlyAlaIleThrLysGlyAsnProLysPhe

100105110

AlaGluGluTyrAlaIleAspLeuThrLysGluAlaAspLysCysGly

115120125

LysGlyIleSerGlySerProLeuAlaSerAsnAsnLysPheValHis

130135140

AspLeuSerAspValValLeuPheIleValArgLeuLeuLeu

145150155

<210>3

<211>38

<212>DNA

<213>LcCIF-TRV2-F

<400>3

gcctccatggggatccatgttcatggtcttgtttattg38

<210>4

<211>43

<212>DNA

<213>LcCIF-TRV2-R

<400>4

cttcgggacatgcccgggtcaaagtaacaatctgacaataaat43

Claims

1. a cell walls acidic conversion enzyme level subbase because of lcCIF, it is characterized in that, its nucleotide sequence is as shown in SEQIDNO:1.

2. the acidic conversion of cell walls shown in claim 1 enzyme level subbase because of lcCIFthe albumen of coding, it is characterized in that, its aminoacid sequence is as shown in SEQIDNO:2.

3. for increase lichee cell walls acidic conversion enzyme level subbase described in claim 1 because of lcCIFprimer, it is characterized in that, its primer sequence is as shown in SEQIDNO:3 ~ 4.

4. containing cell walls acidic conversion enzyme level subbase described in claim 1 because of lcCIFexpression vector .

5. expression vector described in gene described in claim 1 or claim 4 is improving the application in lichee fruit-setting rate.

6. expression vector described in gene described in claim 1 or claim 4 improves the application in the preparation of lichee fruit-setting rate in preparation.

7. the application according to claim 5 or 6, is characterized in that, described lichee is glutinous rice wrapped in lotus leaves.