CN105256075A - Fluorescent PCR kit for eight gene types of hepatitis B virus and detection method thereof - Google Patents
Fluorescent PCR kit for eight gene types of hepatitis B virus and detection method thereof Download PDFInfo
- Publication number
- CN105256075A CN105256075A CN201510804784.8A CN201510804784A CN105256075A CN 105256075 A CN105256075 A CN 105256075A CN 201510804784 A CN201510804784 A CN 201510804784A CN 105256075 A CN105256075 A CN 105256075A
- Authority
- CN
- China
- Prior art keywords
- hbv
- hepatitis
- virus
- end mark
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a fluorescent PCR kit for eight gene types of hepatitis B virus and a detection method thereof and belongs to the technical field of biological analysis. According to the adopted technical scheme, primers and probes specific to the eight gene types of the hepatitis B virus are designed and synthesized, and fluorescence labelling is carried out on the probes respectively, and specific detection is carried out by adopting a fluorescent PCR method. The fluorescent PCR kit for the eight gene types of the hepatitis B virus and the detection method thereof have the beneficial effects that firstly polymerase chain reaction (PCR) and fluorescent probe technique are combined, A-H types of the hepatitis B virus in a sample are detected, and the designed probes and primers have high specificity and sensitivity and good accuracy; and secondly, cost is economic, and an operation method is quick and simple, so that the fluorescent PCR kit for the eight gene types of the hepatitis B virus and the detection method thereof are applicable to being extensively popularized and applied.
Description
Technical field
The invention belongs to bio-assay technology field, be specifically related to fluorescent PCR kit and the detection method of a kind of hepatitis B virus eight kinds of gene types.
Background technology
Hepatitis B is a difficult problem for long-standing problem whole world medical circle, and being one of the important virulence factor of acute, chronic hepatitis, liver cirrhosis, liver cancer, is also one of public health problem that the whole world is the most serious.According to WTO report, in more than 60 hundred million populations of the whole world, have about 3,000,000,000 population lives in hepatitis B virus (HBV) high Prevalent district, infected HBV more than 2,000,000,000 people, wherein chronic infection is more than 3.5 hundred million.The annual hepatitis B sickness rate of China, more than 6,000 ten thousand person-times, is a hepatitis B morbidity big country.In countries and regions such as China, South East Asia and Africa, the have an appointment liver cirrhosis of 50% and the liver cancer of 70-90% are caused by chronic HBV infection, and the HBV carrier having infected HBV varient has 7-30%.
According to the nucleotide difference of gene order, HBV is divided into A ~ H8 kind gene type at present, be judged to be different type according to the diversity factor of complete genome sequence nucleotide difference >=8% or its S gene order nucleotide difference >=4%, same gene type meets sequence difference≤5.6%.There is obvious regionality distribution feature in HBV gene type, A type Europe and Central Africa common; Type B, C type are mainly distributed in Asia; D type distributed areas are the widest, are popular in the area such as Mediterranean Sea, the Middle East; E type is based on Africa; G type is detected in US and European; F, H type is distributed in the U.S..China is distributed as master with Type B and C type, is advantage type, and there are differences between the south and the north, and the north is with C type for advantage type, and south is advantage type with Type B; D type is distributed in as minority areas such as Xinjiang, Tibet, Ningxia more, occasionally has A, E, F type to report, there is not yet G, H type.There are some researches show, there is other polyinfection of different genotype in HBV.
The detection method of current hepatitis B virus gene typing comprises gene sequencing, PCR-Sequence specific oligonucleotide probing (PCR-RFLP), Serotype-dependent multiplex-PCR somatotype (i.e. labelled by nested-PCR method), specific linear probe assay (INNO-LiPA) INNO-LiPA, PCR microplate making nucleic acid molecular hybridization ELISA method, monoclonal antibody ELISA method and gene chip.But more or less there are some defects in these methods: as gene sequencing classifying method result accurately and reliably, but process is loaded down with trivial details, time-consuming, cost is high, be difficult to popularization, be not suitable for the detection of large sample, and shortage susceptibility, the polyinfection of two or more HBV gene type in same individuality can not be found.PCR-RFLP changes for the restriction enzyme digestion sites that the polymorphism of single nucleotide site causes and hinders endonuclease digestion, enzyme is cut and not exclusively be there will be complicated band, restriction enzyme mapping identification is complicated, thus affect the confidence level of gene type, and this method can not find several genotypic polyinfection equally.Labelled by nested-PCR method method needs to synthesize many primers, need through two-wheeled PCR process, and comparatively RFLP method lasts length, and opportunities for contamination is comparatively large, and cannot avoid completely occurring non-specific amplification band and hindering observation genotyping result.There is expensive, that specificity is slightly low deficiency in INNO-LiPA.Monoclonal antibody ELISA method can not carry out gene type to the HBV infection of serum HBsAg feminine gender, and minority HBsAg cannot somatotype.There is the shortcomings such as cost is higher, false positive rate is high, the integrated level of different chip is not enough in gene chip, PCR microplate making nucleic acid molecular hybridization ELISA method is applicable to the higher laboratory of level of automation.
For the conventional sense of great amount of samples in Molecular Laboratory, urgent need accuracy is high, specificity good, price economy, fast detection method.
Summary of the invention
For solving the problems of the technologies described above, the invention provides fluorescent PCR kit and the detection method of a kind of hepatitis B virus eight kinds of gene types, by design and synthesis specificity for the primer of hepatitis B virus eight kinds of gene hypotypes and probe, and in conjunction with the technical scheme of PCR detection method, achieve quick, Accurate Determining hepatitis B virus somatotype, cost of determination reduces.
The technical solution used in the present invention is: the fluorescent PCR kit of hepatitis B virus eight kinds of gene types, is characterized in that, described test kit comprises as follows
extremely 8. at least one the PCR reaction solution system in:
1. for hepatitis B virus A type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-A-FACCTGGGTGGGTAATAATTTGGA
HBV-A-RGAAACCACAATAGTTGCCTGATCTT
HBV-A-PAATTGACTACTAGATCCCTG
2. for hepatitis B virus Type B genotypic PCR reaction solution system, following primer and probe is comprised
HBV-B-FCTCGTGGTGGACTTCTCTCAATT
HBV-B-RATCCAGCGATAACCAGGACAAAT
HBV-B-PCAAATCTCCAGTCACTCAC
3. for hepatitis B virus C type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-C-FGAGCCAACTCAAACAATCCAGAT
HBV-C-RGAATGCTCCCGCTCCTACCT
HBV-C-PCCCCAACAAGGATC
4. for hepatitis B virus D type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-D-FGGGAACTTTACTGGGCTTTATTCTT
HBV-D-RGGGCCTACAAACTGTTCACATTT
HBV-D-PCTCATTGGAAAACACC
5. for hepatitis B virus E type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-E-FAGTGAACCCTGTTCCGACTACTG
HBV-E-RGGTCCCCAATCCTCGAGAA
HBV-E-PCTCACTCATCTCGTCAAT
6. for hepatitis B virus F type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-F-FGAGTCCCTTTATACCGCTGTTACC
HBV-F-RGTAATGATCCCCAACTGCCAAT
HBV-F-PATGGATACCCACAGATAA
7. for hepatitis B virus G type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-G-FTGGAAAGTCTGTCAACGAATAACTG
HBV-G-RAAGGCAGGGTAACCACATTGG
HBV-G-PTTTCGCTGCTCCTTTT
8. for hepatitis B virus H type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-H-FCCCGTGTGTCCTCTACTTCCA
HBV-H-RAAGAGTGGTGCAGGTTTTGCA
HBV-H-PATCTACAACCACCAGCACG。
Preferably, described often kind of probe one end is marked with fluorescent reporter group FAM, TET, HEX, ROX, JOE, CY3, CY5, TAMRA or TexasRed, and the other end is marked with fluorescent quenching group MGB, BHQ-1, BHQ-2, LowaBlackRQ, LowaBlack
tMfQ or Dabcyl.
Preferred, describedly form the first reaction system for hepatitis B virus A-D type genotypic PCR reaction solution system, wherein the 5' of HBV-A-P holds flag F AM, 5' end mark HEX, the 3' end mark MGB of 3' end mark MGB, HBV-B-P, the 5' end mark ROX of HBV-C-P, 5' end mark CY5, the 3' end mark MGB of 3' end mark MGB, HBV-D-P;
The second reaction system is formed for hepatitis B virus E-H type genotypic PCR reaction solution system, wherein the 5' of HBV-E-P holds flag F AM, 3' end mark MGB, the 5' end mark HEX of HBV-F-P, 5' end mark ROX, the 3' end mark MGB of 3' end mark MGB, HBV-G-P, 5' end mark CY5, the 3' end mark MGB of HBV-H-P.
The genotypic standard substance of hepatitis B virus A-H type are also comprised in described test kit.
The present invention also provides the nondiagnostic detection method of hepatitis B virus eight kinds of gene types, it is characterized in that, said method comprising the steps of:
(1) primer according to claim 1 and probe is synthesized;
(2) according to instrument, the fluorescent reporter group described in claim 2 and corresponding fluorescent quenching group are marked respectively to each probe two ends;
(3) positive criteria product are prepared;
(4) testing sample DNA is extracted;
(5) PCR reaction system is prepared;
(6) PCR is run;
(7) data analysis.
Preferably, the preparation method of described step (3) positives standard substance builds to comprise the plasmid that hepatitis B virus A-H eight kinds of gene hypotypes detect target gene standard sequence respectively: synthesize hepatitis B virus A-H eight kinds of gene hypotypes respectively and detect target gene standard sequence and be cloned in P18-T carrier, called after PMT-HBV-A, PMT-HBV-B, PMT-HBV-C, PMT-HBV-D, PMT-HBV-E, PMT-HBV-F, PMT-HBV-G, PMT-HBV-H.
Preferred, the mark of described step (2) middle probe is respectively: the 5' of HBV-A-P holds flag F AM, 3' end mark MGB, the 5' end mark ROX of 5' end mark HEX, 3' end mark MGB, the HBV-C-P of HBV-B-P, 5' end mark CY5, the 3' end mark MGB of 3' end mark MGB, HBV-D-P; The 5' of HBV-E-P holds 5' end mark CY5, the 3' end mark MGB of 5' end mark ROX, 3' end mark MGB, the HBV-H-P of 5' end mark HEX, 3' end mark MGB, the HBV-G-P of flag F AM, 3' end mark MGB, HBV-F-P;
In step (5), PCR reaction system is divided into two, is added to the first reaction system, is added to the second reaction system for the genotypic primer of hepatitis B virus E FGH type and probe for the genotypic primer of hepatitis B virus ABCD type and probe.
Preferably, during described step (6) operation PCR, fluorescence channel detects selection: detect and select FAM, HEX, ROX and CY5 passage.
The response procedures that described step (6) operation PCR is is 95 DEG C of 2min; Again by 95 DEG C of 15s, 60 DEG C of 1min, circulate 40 times.
In technique scheme, for the primer of hepatitis B virus eight kinds of gene types and probe, there is good specificity respectively, for Fluorescence PCR, do not exist and interfere with each other, often kind of probe one end is marked with fluorescent reporter group, the other end is marked with fluorescent quenching group, the fluorescent reporter group of probe not of the same race is different, after detected sample increases under the primer of certain somatotype guides, be combined with the probe of corresponding somatotype, by the fluorescent reporter group of its probe, then can detect hepatitis b virus infected by which kind of somatotype of sample, in practical application, in view of instrument, the factors such as fluorescein range of choice, the first reaction system can be formed by for hepatitis B virus A-D type genotypic PCR reaction solution system, the second reaction system is formed for hepatitis B virus E-H type genotypic PCR reaction solution system.
For improving the accuracy detected, test kit kind is configured with the positive criteria product of eight kinds of hypotypes, these standard substance can be the complete sequences of various hypotype, (its sequence can be looked at gene pool), also can be comprise the fragment gene sequence detecting target gene site, above-mentioned sequence authorized company synthesizes, the highly conserved sequence site of each hypotype of described detection target gene site and the present invention's screening, during application, spliced by the method for PCR, synthetic detection target gene sequence is cloned in P18-T carrier pMD18-Tvector (Takara), build and comprise the plasmid that hepatitis B virus A-H eight kinds of hypotypes detect target gene standard sequence respectively, called after: PMT-HBV-A, PMT-HBV-B, PMT-HBV-C, PMT-HBV-D, PMT-HBV-E, PMT-HBV-F, PMT-HBV-G, PMT-HBV-H.
Beneficial effect of the present invention is: (1) this product adopts polymerase chain reaction (PCR) combined with fluorescent probe technique, detects A-H type hepatitis B virus somatotype in sample, designed probe and primer specific sexual type and highly sensitive, and accuracy is good.(2) economical, working method is fast and convenient, suitable wide popularization and application.
Embodiment
Here is the PCR kit of above-mentioned pin hepatitis B virus eight kinds of gene types and utilizes it to carry out illustrating of the method for detection by quantitative, but does not limit the present invention in any form.The experimental technique used in embodiment if no special instructions, is ordinary method.Material used, reagent and synthesized primer and probe sequence etc., if no special instructions, all can obtain from commercial channels.
embodiment 1: the design of primer, probe sequence and synthesis in the PCR kit of pin hepatitis B virus eight kinds of gene types
Geneseq database from GenBank(NIH safeguards) search for the genotypic complete sequence of HBVA-H type utilize BLAST sequential analysis to compare, sift out high conservative region, primer-design software PrimerPremier5 is adopted to design primer and corresponding specific probe respectively for conserved sequence, and detect whether have hairpin structure or dimer formation, result shows that the probe designed meets specific requirements, and can not form hairpin structure or dimer.Designed primer, probe sequence are respectively:
1. for hepatitis B virus A type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-A-FACCTGGGTGGGTAATAATTTGGA
HBV-A-RGAAACCACAATAGTTGCCTGATCTT
HBV-A-PAATTGACTACTAGATCCCTG
2. for hepatitis B virus Type B genotypic PCR reaction solution system, following primer and probe is comprised
HBV-B-FCTCGTGGTGGACTTCTCTCAATT
HBV-B-RATCCAGCGATAACCAGGACAAAT
HBV-B-PCAAATCTCCAGTCACTCAC
3. for hepatitis B virus C type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-C-FGAGCCAACTCAAACAATCCAGAT
HBV-C-RGAATGCTCCCGCTCCTACCT
HBV-C-PCCCCAACAAGGATC
4. for hepatitis B virus D type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-D-FGGGAACTTTACTGGGCTTTATTCTT
HBV-D-RGGGCCTACAAACTGTTCACATTT
HBV-D-PCTCATTGGAAAACACC
5. for hepatitis B virus E type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-E-FAGTGAACCCTGTTCCGACTACTG
HBV-E-RGGTCCCCAATCCTCGAGAA
HBV-E-PCTCACTCATCTCGTCAAT
6. for hepatitis B virus F type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-F-FGAGTCCCTTTATACCGCTGTTACC
HBV-F-RGTAATGATCCCCAACTGCCAAT
HBV-F-PATGGATACCCACAGATAA
7. for hepatitis B virus G type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-G-FTGGAAAGTCTGTCAACGAATAACTG
HBV-G-RAAGGCAGGGTAACCACATTGG
HBV-G-PTTTCGCTGCTCCTTTT
8. for hepatitis B virus H type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-H-FCCCGTGTGTCCTCTACTTCCA
HBV-H-RAAGAGTGGTGCAGGTTTTGCA
HBV-H-PATCTACAACCACCAGCACG。
In above-mentioned probe, the detection target gene site of HBV-A-P is positioned at the 2143-2162 base of hepatitis B virus A type genotype complete sequence, the detection target gene site of HBV-B-P is positioned at the 320-338 base of hepatitis B virus Type B genotype complete sequence, the detection target gene site of HBV-C-P is positioned at the 2985-3998 base of hepatitis B virus C type genotype complete sequence, the detection target gene site of HBV-D-P is positioned at the 2521-2536 base of hepatitis B virus D type genotype complete sequence, the detection target gene site of HBV-E-P is positioned at the 106-123 base of hepatitis B virus E type genotype complete sequence, the detection target gene site of HBV-F-P is positioned at the 931-814 base of hepatitis B virus F type genotype complete sequence, the detection target gene site of HBV-G-P is positioned at the 1014-1029 base of hepatitis B virus G type genotype complete sequence, the detection target gene site of HBV-H-P is positioned at the 490-508 base of hepatitis B virus H type genotype complete sequence, the standard substance sequence of its correspondence can be looked at gene pool.
Specifically to the fluorescent mark of often kind of probe, follow following principle, according to the resolution condition of instrument to fluorescence, select fluorescent reporter group and corresponding fluorescent quenching group.For ease of using and improve specificity, the accuracy of reaction, the first reaction system can be formed by for hepatitis B virus A-D type genotypic PCR reaction solution system, describedly form the first reaction system for hepatitis B virus A-D type genotypic PCR reaction solution system, the second reaction system is formed for hepatitis B virus E-H type genotypic PCR reaction solution system, the design reduces reaction sample, simplify operation, improve conventional efficient.
embodiment 2:mentioned reagent box is utilized to detect positive criteria product
(1) according to gene pool Query Result, entrust specialized company's (work as raw in Shanghai, prompt base (Shanghai) trade Co., Ltd in the English Weihe River) synthesis is for the standard sequence of eight kinds of gene hypotypes of hepatitis B virus, primer and probe sequence, and making following mark: the 5' of HBV-A-P holds flag F AM, 3' end mark MGB, the 5' end mark HEX of HBV-B-P, 3' end mark MGB, the 5' end mark ROX of HBV-C-P, 3' end mark MGB, the 5' end mark CY5 of HBV-D-P, 3' end mark MGB, the 5' of HBV-E-P holds flag F AM, 3' end mark MGB, the 5' end mark HEX of HBV-F-P, 3' end mark MGB, the 5' end mark ROX of HBV-G-P, 3' end mark MGB, the 5' end mark CY5 of HBV-H-P, 3' end mark MGB.
Commercially available fluorescent PCR reagent or test kit or PremixExTaq test kit is adopted to prepare PCR reaction system.Be divided into the first reaction system and the second reaction system, first reaction system comprises for the genotypic primer of hepatitis B virus ABCD type and probe (with above-mentioned fluorescent mark), second reaction system comprises for the genotypic primer of hepatitis B virus E FGH type and probe, concrete, working fluid and the reaction conditions of each PCR reaction system are as follows:
1) the first reaction system: pcr amplification reaction system is 20 μ L, comprising 10 × PCRBuffer2 μ L, dNTP(2.5mmoL/L) 2 μ L, Taq enzyme (5U/ μ L) 0.07 μ L, HBV-A-F/R(5 μM) 0.3 μ L, HBV-A-P(5 μM) 1.5 μ L, HBV-B-F/R(5 μM) 0.3 μ L, HBV-B-P(5 μM) 1.5 μ L, HBV-C-F/R(5 μM) 0.3 μ L, HBV-C-P(5 μM) 1.5 μ L, HBV-D-F/R(5 μM) 0.3 μ L, HBV-D-P(5 μM) and 1.5 μ L, A-D standard sequences each 2 μ L of DNA, mend ddH
2o0.73 μ L is 20 μ L to final volume.
2) the second reaction system: pcr amplification reaction system is 20 μ L, comprising 10 × PCRBuffer2 μ L, dNTP(2.5mmoL/L) 2 μ L, Taq enzyme (5U/ μ L) 0.07 μ L, HBV-E-F/R(5 μM) 0.3 μ L, HBV-E-P(5 μM) 1.5 μ L, HBV-F-F/R(5 μM) 0.3 μ L, HBV-F-P(5 μM) 1.5 μ L, HBV-G-F/R(5 μM) 0.3 μ L, HBV-G-P(5 μM) 1.5 μ L, HBV-H-F/R(5 μM) 0.3 μ L, HBV-H-P(5 μM) and 1.5 μ L, A-D standard sequences DNA each DNA2 μ L, mend ddH
2o0.73 μ L is 20 μ L to final volume;
(4) above-mentioned each 20 μ L systems are added in PCR pipe respectively, lid upper tube cap, PCR pipe are put into fluorescent quantitative PCR detector (the ABI7500 detector etc. of ABI company), run PCR reaction, reaction conditions: 95 DEG C of 2min; Again by 95 DEG C of 15s, 60 DEG C of 1min, circulate 40 times; Reaction system is 20 μ L.Fluorescence channel detects to be selected: detect and select FAM, HEX, ROX and CY5 passage.
(5) data analysis,
Primer pair B Hepatitis virus provided by the invention eight kinds of gene types have good specific amplification, utilize the result that the fluorescent reporter group of mark can obtain accurately, stablizes, collimation is good.
embodiment 3:mentioned reagent box is utilized to carry out the method for pattern detection
(1) according to the primer of above-mentioned design and the sequence of probe, entrust specialized company's (work as raw in Shanghai, prompt base (Shanghai) trade Co., Ltd in the English Weihe River) synthetic primer and probe, and mark for subsequent use;
(2) extract test serum sample and extract its hepatitis B virus DNA
Extract person under inspection's venous blood 1ml, inject the centrifuge tube of aseptic 1.5ml, after room temperature leaves standstill 2h, get supernatant and go in another sterile centrifugation tube, be serum sample; Conventionally hepatitis B virus DNA is extracted by DNA extraction liquid;
(3) PCR reaction system is prepared
In the present embodiment, somatotype detection is carried out to eight of hepatitis B virus kinds of gene hypotypes simultaneously, adopt commercially available regular-PCR reagent or test kit or PremixExTaq test kit.PCR reaction system wherein for hepatitis B virus divides two, be respectively the first reaction system and the second reaction system, first reaction system comprises for the genotypic primer of hepatitis B virus ABCD type and probe, and the second reaction system comprises for the genotypic primer of hepatitis B virus E FGH type and probe; Probe in each reaction system used, all with the fluorescent reporter group can distinguished by instrument and fluorescent quenching group, arranges the blank not having hepatitis B virus DNA simultaneously, and the positive control PCR system of A-H positive criteria product.Concrete, working fluid and the reaction conditions of each PCR reaction system are as follows:
1) the first reaction system: pcr amplification reaction system is 20 μ L, comprising 10 × PCRBuffer2 μ L, dNTP(2.5mmoL/L) 2 μ L, Taq enzyme (5U/ μ L) 0.07 μ L, HBV-A-F/R(5 μM) 0.3 μ L, HBV-A-P(5 μM) 1.5 μ L, HBV-B-F/R(5 μM) 0.3 μ L, HBV-B-P(5 μM) 1.5 μ L, HBV-C-F/R(5 μM) 0.3 μ L, HBV-C-P(5 μM) 1.5 μ L, HBV-D-F/R(5 μM) 0.3 μ L, HBV-D-P(5 μM) 1.5 μ L, sample DNA 2 μ L, mend ddH
2o6.73 μ L is 20 μ L to final volume.
2) the second reaction system: pcr amplification reaction system is 20 μ L, comprising 10 × PCRBuffer2 μ L, dNTP(2.5mmoL/L) 2 μ L, Taq enzyme (5U/ μ L) 0.07 μ L, HBV-E-F/R(5 μM) 0.3 μ L, HBV-E-P(5 μM) 1.5 μ L, HBV-F-F/R(5 μM) 0.3 μ L, HBV-F-P(5 μM) 1.5 μ L, HBV-G-F/R(5 μM) 0.3 μ L, HBV-G-P(5 μM) 1.5 μ L, HBV-H-F/R(5 μM) 0.3 μ L, HBV-H-P(5 μM) 1.5 μ L, sample DNA 2 μ L, mend ddH
2o6.73 μ L is 20 μ L to final volume;
3) blank PCR system I:PCR amplification reaction system is 20 μ L, comprising 10 × PCRBuffer2 μ L, dNTP(2.5mmoL/L) 2 μ L, Taq enzyme (5U/ μ L) 0.07 μ L, HBV-A-F/R(5 μM) 0.3 μ L, HBV-A-P(5 μM) 1.5 μ L, HBV-B-F/R(5 μM) 0.3 μ L, HBV-B-P(5 μM) 1.5 μ L, HBV-C-F/R(5 μM) 0.3 μ L, HBV-C-P(5 μM) 1.5 μ L, HBV-D-F/R(5 μM) 0.3 μ L, HBV-D-P(5 μM) 1.5 μ L, distilled water 2 μ L, mend ddH
2o6.73 μ L is 20 μ L to final volume;
Blank PCR system II: pcr amplification reaction system is 20 μ L, comprising 10 × PCRBuffer2 μ L, dNTP(2.5mmoL/L) 2 μ L, Taq enzyme (5U/ μ L) 0.07 μ L, HBV-E-F/R(5 μM) 0.3 μ L, HBV-E-P(5 μM) 1.5 μ L, HBV-F-F/R(5 μM) 0.3 μ L, HBV-F-P(5 μM) 1.5 μ L, HBV-G-F/R(5 μM) 0.3 μ L, HBV-G-P(5 μM) 1.5 μ L, HBV-H-F/R(5 μM) 0.3 μ L, HBV-H-P(5 μM) 1.5 μ L, distilled water 2 μ L, mend ddH
2o6.73 μ L is 20 μ L to final volume;
4) positive control PCR system is see the first reaction system in embodiment 2 and the second reaction system;
(4) above-mentioned each 20 μ L systems are added in PCR pipe respectively, lid upper tube cap, PCR pipe are put into fluorescent quantitative PCR detector (the ABI7500 detector etc. as ABI company), run PCR reaction, reaction conditions: 95 DEG C of 2min; Again by 95 DEG C of 15s, 60 DEG C of 1min, circulate 40 times; Fluorescence channel detects to be selected: detect and select FAM, HEX, ROX and CY5 passage.
(5) data analysis,
Every data that composite analyser provides, set rational threshold value and baseline, blank group committee is stealthy, various positive controls is the positive, according to affiliated system and the fluorescent signal that detects, sample to be tested confirms whether corresponding hypotype has amplification, thus be derived as the hepatitis b virus infected of which kind of hypotype or mixed type infects.
SEQUENCELISTING
<110> Hebei international travel health care center
The fluorescent PCR kit of <120> hepatitis B virus eight kinds of gene types and detection method
<130>1
<160>24
<170>PatentInversion3.3
<210>1
<211>23
<212>DNA
<213> artificial sequence
<400>1
acctgggtgggtaataatttgga23
<210>2
<211>25
<212>DNA
<213> artificial sequence
<400>2
gaaaccacaatagttgcctgatctt25
<210>3
<211>20
<212>DNA
<213> artificial sequence
<400>3
aattgactactagatccctg20
<210>4
<211>23
<212>DNA
<213> artificial sequence
<400>4
ctcgtggtggacttctctcaatt23
<210>5
<211>23
<212>DNA
<213> artificial sequence
<400>5
atccagcgataaccaggacaaat23
<210>6
<211>19
<212>DNA
<213> artificial sequence
<400>6
caaatctccagtcactcac19
<210>7
<211>23
<212>DNA
<213> artificial sequence
<400>7
gagccaactcaaacaatccagat23
<210>8
<211>20
<212>DNA
<213> artificial sequence
<400>8
gaatgctcccgctcctacct20
<210>9
<211>14
<212>DNA
<213> artificial sequence
<400>9
ccccaacaaggatc14
<210>10
<211>25
<212>DNA
<213> artificial sequence
<400>10
gggaactttactgggctttattctt25
<210>11
<211>23
<212>DNA
<213> artificial sequence
<400>11
gggcctacaaactgttcacattt23
<210>12
<211>16
<212>DNA
<213> artificial sequence
<400>12
ctcattggaaaacacc16
<210>13
<211>23
<212>DNA
<213> artificial sequence
<400>13
agtgaaccctgttccgactactg23
<210>14
<211>19
<212>DNA
<213> artificial sequence
<400>14
ggtccccaatcctcgagaa19
<210>15
<211>18
<212>DNA
<213> artificial sequence
<400>15
ctcactcatctcgtcaat18
<210>16
<211>24
<212>DNA
<213> artificial sequence
<400>16
gagtccctttataccgctgttacc24
<210>17
<211>22
<212>DNA
<213> artificial sequence
<400>17
gtaatgatccccaactgccaat22
<210>18
<211>18
<212>DNA
<213> artificial sequence
<400>18
atggatacccacagataa18
<210>19
<211>25
<212>DNA
<213> artificial sequence
<400>19
tggaaagtctgtcaacgaataactg25
<210>20
<211>21
<212>DNA
<213> artificial sequence
<400>20
aaggcagggtaaccacattgg21
<210>21
<211>16
<212>DNA
<213> artificial sequence
<400>21
tttcgctgctcctttt16
<210>22
<211>21
<212>DNA
<213> artificial sequence
<400>22
cccgtgtgtcctctacttcca21
<210>23
<211>21
<212>DNA
<213> artificial sequence
<400>23
aagagtggtgcaggttttgca21
<210>24
<211>19
<212>DNA
<213> artificial sequence
<400>24
atctacaaccaccagcacg19
Claims (9)
1. the fluorescent PCR kit of hepatitis B virus eight kinds of gene types, is characterized in that, described test kit comprises as follows
extremely 8. at least one the PCR reaction solution system in:
1. for hepatitis B virus A type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-A-FACCTGGGTGGGTAATAATTTGGA
HBV-A-RGAAACCACAATAGTTGCCTGATCTT
HBV-A-PAATTGACTACTAGATCCCTG
2. for hepatitis B virus Type B genotypic PCR reaction solution system, following primer and probe is comprised
HBV-B-FCTCGTGGTGGACTTCTCTCAATT
HBV-B-RATCCAGCGATAACCAGGACAAAT
HBV-B-PCAAATCTCCAGTCACTCAC
3. for hepatitis B virus C type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-C-FGAGCCAACTCAAACAATCCAGAT
HBV-C-RGAATGCTCCCGCTCCTACCT
HBV-C-PCCCCAACAAGGATC
4. for hepatitis B virus D type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-D-FGGGAACTTTACTGGGCTTTATTCTT
HBV-D-RGGGCCTACAAACTGTTCACATTT
HBV-D-PCTCATTGGAAAACACC
5. for hepatitis B virus E type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-E-FAGTGAACCCTGTTCCGACTACTG
HBV-E-RGGTCCCCAATCCTCGAGAA
HBV-E-PCTCACTCATCTCGTCAAT
6. for hepatitis B virus F type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-F-FGAGTCCCTTTATACCGCTGTTACC
HBV-F-RGTAATGATCCCCAACTGCCAAT
HBV-F-PATGGATACCCACAGATAA
7. for hepatitis B virus G type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-G-FTGGAAAGTCTGTCAACGAATAACTG
HBV-G-RAAGGCAGGGTAACCACATTGG
HBV-G-PTTTCGCTGCTCCTTTT
8. for hepatitis B virus H type genotypic PCR reaction solution system, following primer and probe is comprised
HBV-H-FCCCGTGTGTCCTCTACTTCCA
HBV-H-RAAGAGTGGTGCAGGTTTTGCA
HBV-H-PATCTACAACCACCAGCACG。
2. the fluorescent PCR kit of hepatitis B virus according to claim 1 eight kinds of gene types, it is characterized in that, described often kind of probe one end is marked with fluorescent reporter group FAM, TET, HEX, ROX, JOE, CY3, CY5, TAMRA or TexasRed, and the other end is marked with fluorescent quenching group MGB, BHQ-1, BHQ-2, LowaBlackRQ, LowaBlack
tMfQ or Dabcyl.
3. the fluorescent PCR kit of hepatitis B virus according to claim 2 eight kinds of gene types, it is characterized in that, describedly form the first reaction system for hepatitis B virus A-D type genotypic PCR reaction solution system, wherein the 5' of HBV-A-P holds flag F AM, 3' end mark MGB, the 5' end mark HEX of HBV-B-P, 5' end mark ROX, the 3' end mark MGB of 3' end mark MGB, HBV-C-P, 5' end mark CY5, the 3' end mark MGB of HBV-D-P;
The second reaction system is formed for hepatitis B virus E-H type genotypic PCR reaction solution system, wherein the 5' of HBV-E-P holds flag F AM, 3' end mark MGB, the 5' end mark HEX of HBV-F-P, 5' end mark ROX, the 3' end mark MGB of 3' end mark MGB, HBV-G-P, 5' end mark CY5, the 3' end mark MGB of HBV-H-P.
4. the fluorescent PCR kit of hepatitis B virus according to claim 1 eight kinds of gene types, is characterized in that, also comprises the genotypic standard sequence of hepatitis B virus A-H type in described test kit.
5. the nondiagnostic detection method of hepatitis B virus eight kinds of gene types, is characterized in that, said method comprising the steps of:
(1) primer according to claim 1 and probe is synthesized;
(2) according to instrument, the fluorescent reporter group described in claim 2 and corresponding fluorescent quenching group are marked respectively to each probe two ends;
(3) positive criteria product are prepared;
(4) testing sample DNA is extracted;
(5) PCR reaction system is prepared;
(6) PCR is run;
(7) data analysis.
6. the nondiagnostic detection method of hepatitis B virus according to claim 5 eight kinds of gene types, it is characterized in that, the preparation method of described step (3) positives standard substance builds to comprise the plasmid that hepatitis B virus A-H eight kinds of gene hypotypes detect target gene standard sequence respectively: synthesize hepatitis B virus A-H eight kinds of gene hypotypes respectively and detect target gene standard sequence and be cloned in P18-T carrier, called after PMT-HBV-A, PMT-HBV-B, PMT-HBV-C, PMT-HBV-D, PMT-HBV-E, PMT-HBV-F, PMT-HBV-G, PMT-HBV-H.
7. the nondiagnostic detection method of hepatitis B virus according to claim 5 eight kinds of gene types, it is characterized in that, the mark of described step (2) middle probe is respectively: the 5' of HBV-A-P holds flag F AM, 5' end mark HEX, the 3' end mark MGB of 3' end mark MGB, HBV-B-P, the 5' end mark ROX of HBV-C-P, 5' end mark CY5, the 3' end mark MGB of 3' end mark MGB, HBV-D-P; The 5' of HBV-E-P holds 5' end mark CY5, the 3' end mark MGB of 5' end mark ROX, 3' end mark MGB, the HBV-H-P of 5' end mark HEX, 3' end mark MGB, the HBV-G-P of flag F AM, 3' end mark MGB, HBV-F-P;
In step (5), PCR reaction system is divided into two, is added to the first reaction system, is added to the second reaction system for the genotypic primer of hepatitis B virus E FGH type and probe for the genotypic primer of hepatitis B virus ABCD type and probe.
8. the nondiagnostic detection method of hepatitis B virus according to claim 7 eight kinds of gene types, is characterized in that, during described step (6) operation PCR, fluorescence channel detects and selects: detect and select FAM, HEX, ROX and CY5 passage.
9. the nondiagnostic detection method of hepatitis B virus according to claim 5 eight kinds of gene types, is characterized in that, the response procedures that described step (6) operation PCR is is 95 DEG C of 2min; Again by 95 DEG C of 15s, 60 DEG C of 1min, circulate 40 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510804784.8A CN105256075B (en) | 2015-11-20 | 2015-11-20 | The fluorescent PCR kit and detection method of eight kinds of Genotypings of hepatitis type B virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510804784.8A CN105256075B (en) | 2015-11-20 | 2015-11-20 | The fluorescent PCR kit and detection method of eight kinds of Genotypings of hepatitis type B virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105256075A true CN105256075A (en) | 2016-01-20 |
| CN105256075B CN105256075B (en) | 2018-06-01 |
Family
ID=55096000
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510804784.8A Expired - Fee Related CN105256075B (en) | 2015-11-20 | 2015-11-20 | The fluorescent PCR kit and detection method of eight kinds of Genotypings of hepatitis type B virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105256075B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022543A (en) * | 2017-05-25 | 2017-08-08 | 郑州市第六人民医院 | One kind extracts hbv nucleic acid with magnetic bead, extracts reagent, extracting method, quantitative detection kit |
| CN112813204A (en) * | 2021-03-10 | 2021-05-18 | 北京康美天鸿生物科技有限公司 | Fluorescent PCR kit for genotyping hepatitis B virus |
| CN113549707A (en) * | 2020-04-24 | 2021-10-26 | 利多(香港)有限公司 | Method, oligonucleotide and kit for HBV genotype detection |
| CN114250325A (en) * | 2021-12-31 | 2022-03-29 | 广西壮族自治区疾病预防控制中心 | Primer, probe, kit and method for rapidly detecting 9 genotypes of hepatitis B virus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1584053A (en) * | 2004-06-03 | 2005-02-23 | 佛山市第一人民医院 | Hepatitis B virus gene parting method |
| CN101402993A (en) * | 2007-11-05 | 2009-04-08 | 中国科学院武汉病毒研究所 | Parting method for hepatitis B virus gene |
-
2015
- 2015-11-20 CN CN201510804784.8A patent/CN105256075B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1584053A (en) * | 2004-06-03 | 2005-02-23 | 佛山市第一人民医院 | Hepatitis B virus gene parting method |
| CN101402993A (en) * | 2007-11-05 | 2009-04-08 | 中国科学院武汉病毒研究所 | Parting method for hepatitis B virus gene |
Non-Patent Citations (2)
| Title |
|---|
| OLIVER KIRSCHBERG等: "A multiplex-PCR to identify hepatitis B virus—genotypes A–F", 《JOURNAL OF CLINICAL VIROLOGY》 * |
| SEBASTIAN MALMSTROM等: "Novel Method for Genotyping Hepatitis B Virus on the Basis of TaqMan Real-Time PCR", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022543A (en) * | 2017-05-25 | 2017-08-08 | 郑州市第六人民医院 | One kind extracts hbv nucleic acid with magnetic bead, extracts reagent, extracting method, quantitative detection kit |
| CN113549707A (en) * | 2020-04-24 | 2021-10-26 | 利多(香港)有限公司 | Method, oligonucleotide and kit for HBV genotype detection |
| WO2021213503A1 (en) * | 2020-04-24 | 2021-10-28 | 利多(香港)有限公司 | Method for detecting hbv genotype, oligonucleotide and kit |
| EP4141129A4 (en) * | 2020-04-24 | 2024-06-05 | Leadway Hk Ltd | Method for detecting hbv genotype, oligonucleotide and kit |
| CN112813204A (en) * | 2021-03-10 | 2021-05-18 | 北京康美天鸿生物科技有限公司 | Fluorescent PCR kit for genotyping hepatitis B virus |
| CN114250325A (en) * | 2021-12-31 | 2022-03-29 | 广西壮族自治区疾病预防控制中心 | Primer, probe, kit and method for rapidly detecting 9 genotypes of hepatitis B virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105256075B (en) | 2018-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103045591B (en) | HLA gene specific PCR amplification primer, HLA typing method and kit | |
| Cao et al. | Rapid detection of CALR type 1 and type 2 mutations using PNA-LNA clamping loop-mediated isothermal amplification on a CD-like microfluidic chip | |
| CN105256075A (en) | Fluorescent PCR kit for eight gene types of hepatitis B virus and detection method thereof | |
| Somogyvari et al. | Detection of invasive fungal pathogens by real-time PCR and high-resolution melting analysis | |
| CN107460235A (en) | A kind of mankind's ApoE genetic polymorphism detection kits based on ARMS PCR melting curve methods | |
| CN105349680A (en) | PIK3CA gene mutation nucleic acid detection kit | |
| CN106148484B (en) | A kind of kit that diagnosis Y chromosome is micro-deleted | |
| CN113718021A (en) | Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene | |
| CN111073964B (en) | Kit for detecting human leukocyte antigen HLA-ABCCDRDQ genotyping | |
| CN104531881A (en) | Fluorescence PCR detection kit for human K-RAS gene mutation | |
| CN103045717B (en) | Pyrosequencing techniques detects the method for mycobacterium tuberculosis detection of rifampin resistant | |
| CN103451302A (en) | Deafness susceptible gene mitochondrion 12SrDNA 1555A>G and 1494C>T mutant ratio detection kit | |
| CN103898240B (en) | Detect the primer of dengue virus and somatotype thereof, probe and method | |
| CN110982895B (en) | Primer group and kit for detecting human erythrocyte ABO blood type genotyping and application | |
| CN106319079B (en) | Method for detecting 22q11.2 copy number loss | |
| CN105368943A (en) | Kit and method for identifying mycobacterium strains | |
| CA2803401C (en) | Methods and kits used in the detection of fungus | |
| CN101586170B (en) | Method and kits for detecting genotype of hepatitis B virus | |
| CN102212621A (en) | Detection kit and detection method for hepatitis B virus genotyping | |
| CN107385048A (en) | A kind of Nucleic acid combinations, kit and method for detecting dendrobium candidum | |
| CN101402993A (en) | Parting method for hepatitis B virus gene | |
| CN105256076B (en) | The discriminating detection method and kit of eight kinds of gene hypotypes of hepatitis type B virus | |
| CN101333561A (en) | Detecting kit for cardiovascular and cerebrovascular diseases predisposing gene chip | |
| CN106755530A (en) | One kind detection HLA A*31:The MGB probe for real-time fluorescence PCR method and its primer combination of probe of 01 allele | |
| CN114085926A (en) | Primer, probe, kit and detection method for SNP site polymorphism of ABCB1 gene C3435T |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180601 Termination date: 20201120 |