CN105256068A - Novel high-sensitivity respiratory virus nucleic acid NASBA (nucleic acid sequence based amplification) primers and detection method - Google Patents
Novel high-sensitivity respiratory virus nucleic acid NASBA (nucleic acid sequence based amplification) primers and detection method Download PDFInfo
- Publication number
- CN105256068A CN105256068A CN201510677850.XA CN201510677850A CN105256068A CN 105256068 A CN105256068 A CN 105256068A CN 201510677850 A CN201510677850 A CN 201510677850A CN 105256068 A CN105256068 A CN 105256068A
- Authority
- CN
- China
- Prior art keywords
- nasba
- nucleic acid
- rna
- amplification
- respirovirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides novel high-sensitivity respiratory virus nucleic acid NASBA (nucleic acid sequence based amplification) primers. A respiratory virus conservative area is selected, and a promoter sequence capable of being recognized by T7 RNA (ribose nucleic acid) polymerase is formed at the 5' terminal of one of the synthesized primers. The invention further provides a novel high-sensitivity respiratory virus nucleic acid NASBA detection method. T7 RNA polymerase promoter sequences are added to the 5' terminals of the two primers complementary to two ends of a respiratory virus RNA sequence, so that when the primers enter a circulation phase, RNA sequences [RNA(+)] consistent with a template sequence can be synthesized, RNA sequences [RNA(-)] complementary to a template RNA sequence can be synthesized, and the detection sensitivity of viral nucleic acid is greatly improved; a throat swab sample of a patient can be directly used for amplification, a reverse transcription process is not required, and the operation time is saved.
Description
Technical field
The present invention relates to biologic pharmacological science technical field, particularly relate to the gene amplification that a kind of Respirovirus detects, set up a kind of highly sensitive Respirovirus nucleic acid NASBA amplification technique more specifically.Specifically comprise a pair Respirovirus specificity amplification primer, NASBA amplification reaction system and NASBA product detection system.
Background technology
Acute respiratory infection is one of human disease and dead main reason.Cause the Pathogen category of infection many, comprise bacterium, virus, mycoplasma and chlamydozoan etc., especially common with virus.Regardless of the cause of disease, the clinical symptom of respiratory tract infection is all very similar with sign, and the infection that different sorts pathogenic agent causes, its methods for the treatment of is completely different, and curative effect and the course of disease are also not quite similar.
Respirovirus is as topmost disease-producing pathogens, of a great variety, needs to differentiate fast.The detection means of respiratory virus infection is mainly divided into four classes clinically at present: the first kind is the most classical virus culture, is the gold standard that respiratory virus infection detects; But because viral proliferation has strict with host's property, need to select cell strain responsive separately according to different virus, cause operational loaded down with trivial details; And the virus culture cycle is long, be not well positioned to meet clinical demand.Equations of The Second Kind is immunological method, is also method the most frequently used at present.According to detection target compound be antigen/antibody, direct immunofluorescence/indirect immunofluorescence or enzyme-linked immunosorbent assay can be divided into.Although indirect immunofluorescence/enzyme-linked immunosorbent assay detection method is simple, sensitivity is low, and is disturbed many factors.Direct immunofluorescence mainly detects Respirovirus antigen, and sensitivity is high compared with the above two, but sample takes from sufferer throat swab or bronchoalveolar lavage fluid more, and add the misery of sufferer, therefore practicality is lower.3rd class is nucleic acid amplification technologies, and the method comprises the multiple detection method based on viral nucleic acid as the isothermal amplification technique etc. of polymerase chain reaction (PCR), NASBA technology, ring mediation.Because PCR is short, highly sensitive for detection time, it is the attractive method of current most.But this kind of method needs first viral RNA reverse transcription to be become cDNA, and then carries out the amplified reaction of specific nucleic acid squences, adds the chance of pollution, limits the widespread use of this type of technology in clinical detection.4th class is gene chip, sequencing technologies of future generation and mass-spectrometric technique etc., although the detection technique of these advanced persons substantially increases sensitivity, but length consuming time or expensive, scientific research purposes is more, not yet obtains large-scale application in clinical pathogens detects at present.
In Respirovirus, except minority if adenovirus is except DNA virus, all the other great majority are RNA viruses.Though the whole process of current round pcr comparatively traditional method consuming time shortens, sensitivity is inevitable to decline to some extent.NASBA technology is directly the nucleic acid amplification technologies of template with RNA, under the effect of AMV reversed transcriptive enzyme, t7 rna polymerase and RNaseH enzyme, under constant temperature, template ribonucleic acid can be amplified to 10 in a short time
10-10
12copy number.This experimentation can be thought and is divided into acyclic phase and circulation phase two portions: in acyclic phase, and primer 1 manually adds one section of t7 rna polymerase identification promoter sequence at its 5 ' end, and 3 ' end of primer 1 is then complementary with RNA template sequence.Under the effect of AMV reversed transcriptive enzyme, take viral RNA as templated synthesis cDNA chain; RnaseH identifies RNA-DNA heteroduplex and hydrolysis RNA chain wherein; Primer 2 is complementary with remaining DNA chain, under AMV enzyme which catalyzes, with DNA chain for templated synthesis complementary strand, forms double-stranded DNA; T7 rna polymerase identification promoter sequence, catalyzes and synthesizes a large amount of RNA.The RNA of new synthesis enters circulation phase, becomes new template, so moves in circles, and RNA copy number is expanded rapidly.In sum, NASBA technology has 3 points from the maximum difference of round pcr: 1) with round pcr be that template is different with DNA, NASBA technology is directly template with RNA, operation there is more terseness; 2) PCR needs to carry out denaturation renaturation-extension process, and at least need the change of two temperature, and NASBA technology is constant-temperature amplification, therefore NASBA technology does not need special equipment; 3) sensitivity of NASBA technology is high about 1000 times compared with PCR, can significantly improve the recall rate of clinical nucleic acid virus, can better clinical detection need.
According to the know-why of NASBA, its final product is arrange consistent fragment with RNA template in a large number, for making product fragment visual, once adopt sepharose imaging technique before, but because sepharose dyestuff used is ethidium bromide, there is certain toxicity, at present the detection adopting the mode of NASBA technology conjugate enzyme mark (fluorescence) probe hybridization to carry out product amount more.Because Respirovirus great majority are single strand RNA virus, 5 ' of the wall scroll primer that the many employings of existing detection method design of primers principle are contrary with RNA template is held and is introduced t7 rna polymerase promoter region, finally a large amount of amplification is the RNA molecule consistent with viral RNA template sequence, and reaches the object of Viral diagnosis based on this.It can thus be appreciated that, classical NASBA technology conjugate enzyme mark (fluorescence) probe hybridization method only can identify the RNA sequence consistent with template strand, and must by the developing technology of enzyme mark (fluorescence) probe conjugate in testing process, colour developing equipment etc. used by the complex operation and the needs that add the method., because Respirovirus great majority are RNA viruses, very easily degrade in patient's sample preservation process meanwhile, therefore the problem that the detection sensitivity of the further NASBA of raising technology, the technological operation fussy degree that reduces have become anxious to be resolved in the detection of clinical RNA viruses.
All the time, researchist is devoted to develop that a kind of sensitivity is higher, easier, the simpler Respirovirus nucleic acid detection method of equipment requirements of operation.Classical NASBA technology, only in 5 ' end interpolation, one section of t7 rna polymerase Promoter Recognition sequence of primer 1, to guarantee to synthesize rna replicon consistent with template sequence, facilitates subsequent probes to carry out hybridization check.
Summary of the invention
Because the above-mentioned defect of prior art, the technical problem that first the present invention will solve is to provide new type of high sensitivity Respirovirus nucleic acid NASBA amplimer.For achieving the above object, the invention provides following technical scheme:
The invention discloses a pair specificity amplification primer for respiratory tract disease virus gene, its principle of design is by inquiry ncbi database and utilizes sequence alignment program, selects Respirovirus conservative region, and at this zone design amplimer; Primer designed by it is that primer 5 ' is held all with the promoter sequence of t7 rna polymerase identification, as shown in SEQ in synthesis.
Another technical problem to be solved by this invention is to provide a kind of new type of high sensitivity Respirovirus nucleic acid NASBA amplification detection method, and the method comprises the following steps:
(1) amplimer described in claim 1 or 2 is prepared,
(2) prepare amplification kit, described amplification kit is made up of following detection reagent:
The present invention further discloses the NASBA detection kit for Respirovirus, become to be grouped into by following:
1) primer
Primers F P:0.25ul
Primer RP:0.25ul
Described primer sequence is as shown in SEQ.
2) NASBA amplifing reagent
BA (damping fluid): 2ul
DA：dNTP0.25ul
NA：NTP0.5ul
DMSO：0.25ul
EM (enzyme mixture): AMV reversed transcriptive enzyme, RNAseH, t7 rna polymerase, BSA5.5ul
3) NASBA product detection reagent
1% sepharose
The present invention further discloses the using method for Respirovirus NASBA detection kit, its feature comprises the steps:
1) amplification reaction system:
1ul sample rna to be checked, 0.25ulFP, 0.25ulRP, 2ulBA, 0.25ulDA, 0.5ulNA, 0.25ulDMSO.
2) NASBA amplification procedure:
65 ° of heating 5min, add 5.5ulEM after 42 ° of cooling 5min, 42 ° of reaction 60min.
3) NASBA product testing process:
1. take 0.6g sepharose, be placed in 100ml Erlenmeyer flask, add 60mlTAE, microwave-oven-heating, to boiling, is cooled to about 70 ° and adds GelRed dyestuff, pours in gel module, to be cooledly solidifies;
2., after NASBA amplified production being added 2ul sample-loading buffer termination reaction, join in gel loading hole respectively;
3. 100V carries out electrophoresis 10min, observes object band wrong, judged result.
The more detailed preparation method of the present invention following (for respiratory syncytial virus):
1, reagent composition
1.1 primer
For the N gene conserved regions design synthetic primer of respiratory syncytial virus, synthesized by Shanghai biotechnology company limited, sequence is as follows:
FP：AATTCTAATACGACTCACTATAGGGAGAAGGX；
RP:AATTCTAATACGACTCACTATAGGGAGAAGGY；
Leading portion sequence is conserved sequence or the complementary sequence that the promoter sequence " X, Y " of t7 rna polymerase identification represents Respirovirus (as respiratory syncytial virus, Type B influenza virus, Parainfluenza type 1 virus and haemadsorption virus 1).
1.2NASBA amplifing reagent
BA (damping fluid): purchased from TAKARA company
DA:10mMdNTP, purchased from Sangon Biotech (Shanghai) Co., Ltd.
NA:10mMNTP, purchased from Sangon Biotech (Shanghai) Co., Ltd.
DMSO: available from Sigma
EM (enzyme mixture): 10UAMV, 0.2 ~ 0.6URNAseH, 38 ~ 63UT7RNA polysaccharase, 2.5ugBSA, all purchased from TAKARA company
1.3NASBA product detection reagent
Agar Icing Sugar, purchased from Sangon Biotech (Shanghai) Co., Ltd.
2, NASBA testing process
2.1 amplification system
Get 1ul sample rna template, 2ulBA, 0.25ulNA, 0.5ulDA, 0.25ulDMSO and 0.25ulFP, 0.25ulRP add 0.2mlPCR and increase in pipe.
2.2 amplification procedure
Above-mentioned pcr amplification pipe is placed on amplification instrument and enter 42 ° of cooling 5min after 65 ° of heating 5min; Add 5.5ulEM subsequently, continue 42 ° of reaction 60min.
The detection of 2.3NASBA amplified production
2.3.1 taking 0.6g agarose powder joins in 60mlTAE damping fluid, and microwave-oven-heating adds GelRed dyestuff after dissolving, and pours in gel module, and patchhole is combed.
2.3.2 get 2ul sample-loading buffer and join termination reaction in amplified production.
2.3.3 after above-mentioned gel sets, take off hole comb, in a well, addition point swimming standard substance, add amplified production in other holes, 100V electrophoresis 10min respectively.
2.3.4 in electrophoresis imager, the presence or absence of object band is observed, judged result.
The invention has the beneficial effects as follows: the present invention all adds t7 rna polymerase Promoter Recognition sequence by holding at 5 ' of two primers with the two ends complementation of Respirovirus RNA sequence, enable it synthesize both consistent with template sequence RNA row [RNA (+)] entering circulation phase time, can synthesize again and the RNA sequence of template ribonucleic acid complementary [RNA (-)].So, in circulation phase reaction, RNA (+) and RNA (-) can respectively as template, and through N circulation, RNA amplification efficiency can be significantly improved (formula 1), thus greatly improves the detection sensitivity of viral nucleic acid; Patient's oropharyngeal swab specimen directly can be adopted to increase, and without the need to carrying out process of reverse-transcription, save the operating time; Simultaneously, update as avirulent fuel in conjunction with recent agarose gel electrophoresis is fuel used, therefore its testing cost will significantly reduce, eliminate the harm of poisonous, harmful dyestuff to human body and environment, and operating process is easier, decoding for DTMF design adds primer dimer and the problem such as hairpin structure is more complicated, should be noted that when selecting primer.
One-sided primer+t7 rna polymerase promoter sequence design:
Amplified production amount
1=T × A
n
Bilateral primer+t7 rna polymerase promoter sequence design:
Amplified production amount
2=T × A
n× 2
n
Then: after improving bilateral primer, its product amount increase multiple is:
P=amplified production amount
2/ amplified production amount
1=2
n
Wherein T is primary template number, and A is amplification efficiency, and N is cycle number.
Formula 1. bilateral design of primers amplification efficiency compares
By by this design ap-plication in NASBA technology, can make that detection method sensitivity is higher, result more accurately, more convenient operation.
Accompanying drawing explanation
Fig. 1 is technical schematic diagram of the present invention.
Fig. 2 is the present invention and PCR method control experiment figure.
Fig. 3 is that the present invention is applied to the one-sided and two-sided design comparison chart of respiratory syncytial virus primer.
Fig. 4 is that the present invention is applied to respiratory syncytial virus specific detection.
Fig. 5 is that the present invention is applied to the one-sided and two-sided design comparison chart of Type B influenza virus primer.
Fig. 6 is that the present invention is applied to Type B influenza virus specific detection figure.
Fig. 7 is that the present invention is applied to the one-sided and two-sided design comparison chart of Parainfluenza type 1 virus primer.
Fig. 8 is that the present invention is applied to Parainfluenza type 1 virus specific detection figure.
Fig. 9 is that the present invention is applied to the one-sided and two-sided design comparison chart of haemadsorption virus 1 primer.
Figure 10 is that the present invention is applied to haemadsorption virus 1 specific detection figure.
Embodiment
In order to explain implementation method of the present invention more fully, provide the embodiment of NASBA test kit for detecting respiratory syncytial virus, Type B influenza virus, parainfluenza 1 type and haemadsorption virus 1.These embodiments are only explain, instead of limit the scope of the invention.DNTP, NTP and agar Icing Sugar are all purchased from Shanghai Sheng Gong biotechnology company limited; Reaction buffer, BSA, AMV, RNAseH, t7 rna polymerase are all purchased from TAKARA company; DMSO available from Sigma.
Embodiment 1
Reagent composition (for respiratory syncytial virus)
(1) primer
FP：AATTCTAATACGACTCACTATAGGGAGAAGGAAAGTCCTACAAAAAAATGC
The each 0.25ul of RP:AATTCTAATACGACTCACTATAGGGAGAAGGATCTATCTCCTGCTGCTAAT.
(2) NASBA amplifing reagent
BA (damping fluid): 2ul
DA:dNTP0.25ul
NA：NTP0.5ul
DMSO:0.25ul
EM (enzyme mixture): AMV, RNAseH, t7 rna polymerase, BSA5.5ul
(3) NASBA product detection reagent
1% sepharose
Embodiment 2:NASBA testing process
(1) amplification system: 1ul sample rna template, 2ulBA, 0.25ulNA, 0.5ulDA, 0.25ulDMSO and 0.25ulFP, 0.25ulRP add 0.2mlPCR and increase in pipe.
(2) amplification procedure: pcr amplification pipe is placed on amplification instrument and enter 42 ° of cooling 5min after 65 ° of heating 5min; Add 5.5ulEM subsequently, technology 42 ° reaction 60min.
(3) amplified production detects: get 2ul sample-loading buffer and join termination reaction in amplified production.
Added by amplified production in 1% sepharose, one of them well adds electrophoresis standard substance, after 100V electrophoresis 10MIN, observes the presence or absence of object band in electrophoresis imager.
Embodiment 3: contrast experiment
Adopt the contrast of respiratory syncytial virus NASBA test kit of the present invention and single stage method PCR method that respiratory syncytial virus secondary standard product are diluted to 10
2, 10
4-10
10copy/ul.Detect with test kit of the present invention and single stage method PCR simultaneously.
(1) NASBA test kit sensitivity Detection
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 2, NASBA test kit of the present invention successfully can detect 10
2the sample of copy/ul.
(2) the quick rigidity of single stage method PCR detects
A. single stage method PCR reaction system: 2ul sample rna template, 12.5ul2*one-stepSYBRRT-PCRbuffer, 1ulprimeScript1stepEnzymeMix, 1ulFP, 1ulrp, 7.5ulRNaseFreeddh
20.
B. single stage method PCR reaction process: above-mentioned PCR pipe is placed in 42 ° and enters circulation after 5 minutes and do not walk, 95 ° 10 seconds, 95 degree 5 seconds, 60 degree 30 seconds, totally 40 circulations.
C. detected result: by single stage method pcr amplification product with after 1% agarose gel electrophoresis, observations in electrophoresis imager.As can be seen from accompanying drawing 2, single stage method PCR can detect 10
6the sample of copy/ul.
In sum, the susceptibility of NASBA amplification kit of the present invention is 10 of single stage method PCR method
4doubly, there is higher sensitivity.
Embodiment 4: the one-sided and bilateral control experiment of respiratory syncytial virus primer
Respiratory syncytial virus NASBA test kit of the present invention is adopted to carry out primer one-sided (F end or R end) and bilateral (F end and R end) reagent contrast experiment.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 3, the present invention holds primer all to include T7 startup cog region at F end and R will improve amplification efficiency greatly.
Embodiment 5: the Non-specific experiment of respiratory syncytial virus
Respiratory syncytial virus NASBA test kit of the present invention is adopted to carry out clinical ' negative ' specimens, positive clinical sample and H
2o specific amplification detects.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 4, the respiratory syncytial virus primer sequence involved by NASBA test kit of the present invention only increases in positive sample has band, ' negative ' specimens and H
2o is feminine gender, shows that this test kit has higher specificity.
One-sided and the bilateral of embodiment 6:B type influenza virus primer relates to control experiment
Type B influenza virus NASBA test kit of the present invention is adopted to carry out primer one-sided (F end or R end) and bilateral (F end and R hold) relates to control experiment.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 5, the present invention holds primer all to include T7 Promoter Recognition district at F end and R will improve amplification efficiency greatly.
Embodiment 7:B type influenza virus specificity experiments
Type B influenza virus NASBA test kit of the present invention is adopted to carry out clinical ' negative ' specimens, positive clinical sample and H
2o specific amplification detects.
Sample and H
2o specific amplification detects.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 6, the Type B influenza virus primer sequence involved by NASBA test kit of the present invention only increases in positive sample has band, ' negative ' specimens and H
2o is feminine gender, shows that this test kit has higher specificity.
Embodiment 8: the one-sided and two-sided design control experiment of Parainfluenza type 1 virus primer
Parainfluenza type 1 virus NASBA test kit of the present invention is adopted to carry out primer one-sided (F end or R end) and bilateral (F end and R end) design control experiment.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 7, the present invention holds primer to be all designed with T7 Promoter Recognition district at F end and R will improve amplification efficiency greatly.
Embodiment 9: Parainfluenza type 1 virus specificity experiments
Parainfluenza type 1 virus NASBA test kit of the present invention is adopted to carry out clinical ' negative ' specimens, positive clinical sample and H
2o specific amplification detects.
Sample and H
2o specific amplification detects.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 8, the Parainfluenza type 1 virus primer sequence involved by NASBA test kit of the present invention only increases in positive sample has band, ' negative ' specimens and H
2o is feminine gender, shows that this test kit has higher specificity.
Embodiment 10: the one-sided and two-sided design control experiment of parainfluenza 3 type primer
Haemadsorption virus 1 NASBA test kit of the present invention is adopted to carry out primer one-sided (F end or R end) and bilateral (F end and R end) design control experiment.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 9, the present invention holds primer to be all designed with T7 Promoter Recognition district at F end and R will improve amplification efficiency greatly.
Embodiment 11: parainfluenza 3 type specificity is tested
Haemadsorption virus 1 NASBA test kit of the present invention is adopted to carry out clinical ' negative ' specimens, positive clinical sample and H
2o specific amplification detects.
Sample and H
2o specific amplification detects.
NASBA amplification and detection is carried out according to embodiment 2.
As can be seen from accompanying drawing 10, the haemadsorption virus 1 primer sequence involved by NASBA test kit of the present invention only increases in positive sample has band, ' negative ' specimens and H
2o is feminine gender, shows that this test kit has higher specificity.
More than describe preferred embodiment of the present invention in detail.Should be appreciated that the ordinary skill of this area just design according to the present invention can make many modifications and variations without the need to creative work.Therefore, in all technical fields, technician is under this invention's idea on the basis of existing technology by the available technical scheme of logical analysis, reasoning, or a limited experiment, all should by the determined protection domain of claims.
Han Shengtai Bioisystech Co., Ltd in <110> Hangzhou
<120> new type of high sensitivity Respirovirus nucleic acid NASBA amplimer and detection method
<130>
<160>5
<170>PatentInversion3.3
<210>1
<211>31
<212>DNA
<213> artificial sequence
<400>1
aattctaatacgactcactatagggagaagg31
<210>2
<211>32
<212>DNA
<213> artificial sequence
<400>2
aattctaatacgactcactatagggagaaggx31
<210>3
<211>32
<212>DNA
<213> artificial sequence
<400>3
aattctaatacgactcactatagggagaaggy31
<210>4
<211>51
<212>DNA
<213> artificial sequence
<400>4
aattctaatacgactcactatagggagaaggaaagtcctacaaaaaaatgc51
<210>5
<211>51
<212>DNA
<213> artificial sequence
<400>5
aattctaatacgactcactatagggagaaggatctatctcctgctgctaat
Claims (5)
1. a new type of high sensitivity Respirovirus nucleic acid NASBA amplimer, is characterized in that, is made up of following principle:
(1) Respirovirus conservative region is chosen;
(2) based on above-mentioned conserved viral region, synthesize pair for amplification primer, described pair for amplification primer has the promoter sequence of t7 rna polymerase identification respectively at 5 ' end and 3 ' end band;
(3) promoter sequence of described t7 rna polymerase identification is AATTCTAATACGACTCACTATAGGGAGAAGG.
2. a kind of new type of high sensitivity Respirovirus nucleic acid NASBA amplimer as claimed in claim 1, it is characterized in that, described pair for amplification primer is:
Primers F P (forwardprimer): AATTCTAATACGACTCACTATAGGGAGAAGGX,
Primer RP (reverseprimer): AATTCTAATACGACTCACTATAGGGAGAAGGY,
Wherein, X and Y represents conserved sequence or the complementary sequence of Respirovirus respectively.
3. a new type of high sensitivity Respirovirus nucleic acid NASBA amplification detection method, is characterized in that, comprise the following steps:
(1) amplimer described in claim 1 or 2 is prepared,
(2) prepare amplification kit, described amplification kit is made up of following detection reagent:
1) NASBA amplifing reagent
2ul reflects damping fluid (BA), 0.25ulNTP (NA), 0.5ulDntp (DA), 0.25ulDMSO, 5.5ul reaction enzymes mixture (EM),
Wherein said BA:250mMTris-HCL, 375mMKCL, 40mMMgCL2,50mMDTT,
Described NA:10mMNTP,
Described DA:10mMdNTP,
Described EM:10UAMV, 0.2-0.6URNAseH, 38-63UT7RNA polysaccharase, 2.5ugBSA,
Primers F P (forwardprimer): 0.25ul
AATTCTAATACGACTCACTATAGGGAGAAGGX
Primer RP (reverseprimer): 0.25ul
AATTCTAATACGACTCACTATAGGGAGAAGGY，
Wherein, X and Y represents conserved sequence or the complementary sequence of Respirovirus respectively;
2) NASBA product detection system
1% agarose gel electrophoresis,
Described 1% agarose: 0.6g agarose powder is dissolved in 60mlTAE electrophoretic buffer, adds GelRed dyestuff after heating,
Described TAE electrophoretic buffer: 242gTris, 37.2gNa2-EDTA-2H2O, 57.1ml acetic acid, the used time dilutes 50 times;
(3) process that sample to be tested is nucleic acid-templated: go patient's throat swab to be dipped in 1ml physiological saline, vibrate centrifugal rear remaining 100ul physiological saline and cell precipitation, namely containing virus genome RNA in frozen rear supernatant, is nucleic acid-templated;
(4) NASBA reaction system: get the nucleic acid-templated or positive control of 1ul or negative control RNA, add NASBA amplified reaction composition 2ulBA, 0.25ulNA, 0.5ulDA, 0.25ulDMSO and 0.25ulFP, 0.25ulRP respectively;
(5) NASBA amplification condition: by step 2) reaction system be placed in 65 degree heating 5min, 42 degree cooling 5min after add 5.5ulEM, continue react 60min;
(6) result detects: get 2ul sample-loading buffer and join termination reaction in amplified production, carry out agarose electrophoresis, observe the presence or absence of object band, judged result in electrophoresis imager.
4. amplimer as claimed in claim 1 detects the application in Respirovirus clinical sample test kit in preparation.
5. test kit as claimed in claim 3 is detecting the application in Respirovirus clinical sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510677850.XA CN105256068B (en) | 2015-10-19 | 2015-10-19 | A kind of high sensitivity Respirovirus nucleic acid NASBA amplimer and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510677850.XA CN105256068B (en) | 2015-10-19 | 2015-10-19 | A kind of high sensitivity Respirovirus nucleic acid NASBA amplimer and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105256068A true CN105256068A (en) | 2016-01-20 |
| CN105256068B CN105256068B (en) | 2019-02-12 |
Family
ID=55095993
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510677850.XA Active CN105256068B (en) | 2015-10-19 | 2015-10-19 | A kind of high sensitivity Respirovirus nucleic acid NASBA amplimer and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105256068B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636061A (en) * | 2016-07-27 | 2017-05-10 | 华东理工大学 | Isothermal amplification reaction reagent |
| CN109207640A (en) * | 2018-10-23 | 2019-01-15 | 深圳市亿立方生物技术有限公司 | It is a kind of detect various respiratory road virus primer sets, probe groups and kit and its application |
| CN109295260A (en) * | 2018-11-09 | 2019-02-01 | 辽宁佰昊生物科技有限公司 | For detecting and/or assisting detection to cause primer sets, reagent and the kit and detection method of hand-foot-and-mouth disease poison EV71 |
| CN111004867A (en) * | 2020-01-03 | 2020-04-14 | 牡丹江医学院 | Influenza A virus detection primer, probe and kit thereof |
-
2015
- 2015-10-19 CN CN201510677850.XA patent/CN105256068B/en active Active
Non-Patent Citations (5)
| Title |
|---|
| RAMONA LIZA TILLMANN，ET AL: "Comparison of in-house PCR, rapid ELISA and NASBA technology for the detection of respiratory syncytial virus in clinical specimen", 《JOURNAL OF CLINICAL VIROLOGY》 * |
| SAM HIBBITTS，ET AL: "Development and evaluation of NucliSens† Basic Kit NASBA for diagnosis of parainfluenza virus infection with ‘end-point’ and ‘realtime’detection", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 张志宏等: "利用NASBA技术检测草莓斑驳病毒", 《果树学报》 * |
| 杨海鸥等: "依赖核酸序列扩增技术检测呼吸道合胞病毒方法的建立", 《检验医学》 * |
| 王小明等: "黄瓜花叶病毒NASBA检测技术的建立", 《植物病理学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636061A (en) * | 2016-07-27 | 2017-05-10 | 华东理工大学 | Isothermal amplification reaction reagent |
| CN109207640A (en) * | 2018-10-23 | 2019-01-15 | 深圳市亿立方生物技术有限公司 | It is a kind of detect various respiratory road virus primer sets, probe groups and kit and its application |
| CN109295260A (en) * | 2018-11-09 | 2019-02-01 | 辽宁佰昊生物科技有限公司 | For detecting and/or assisting detection to cause primer sets, reagent and the kit and detection method of hand-foot-and-mouth disease poison EV71 |
| CN111004867A (en) * | 2020-01-03 | 2020-04-14 | 牡丹江医学院 | Influenza A virus detection primer, probe and kit thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105256068B (en) | 2019-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN103074450B (en) | Kit for synchronously detecting thirty diarrhea pathogens and detection method of kit | |
| CN111235316A (en) | Primer probe for identifying novel coronavirus and application of primer probe in triple fluorescence RPA | |
| CN103074449B (en) | Kit for synchronously detecting thirteen diarrhea viruses and detection method of kit | |
| CN101712973B (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| CN105256068A (en) | Novel high-sensitivity respiratory virus nucleic acid NASBA (nucleic acid sequence based amplification) primers and detection method | |
| CN107488748B (en) | Composition for detecting 23 respiratory pathogens, kit and detection method thereof | |
| CN110804669A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof | |
| CN109517927A (en) | A kind of A type, influenza B virus rapid typing detection reagent box and its application | |
| WO2023109031A1 (en) | Respiratory pathogen detection kit, and preparation method therefor and use thereof | |
| CN103276099B (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN107574262A (en) | A kind of fluorescence RT RAA primers, probe and detection method for being used to detect A (H 1 N 1) virus | |
| CN113046483A (en) | Novel real-time fluorescent RT-RAA primer, probe and detection kit for coronavirus | |
| CN103320532A (en) | Rapid detection primer group of H7N7 subtype avian influenza virus and use thereof | |
| CN102108421A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting coxsackie virus type A16 | |
| CN101591713A (en) | Gosling plague virus LAMP detection kit and detection method thereof | |
| CN111690772A (en) | New coronavirus nucleic acid detection kit, preparation method and application | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN114959081A (en) | Primer and probe for detecting mycoplasma gallisepticum by LAMP-Taqman and application of primer and probe | |
| CN104894296B (en) | Detect primer, molecular beacon probe and the kit of swine influenza virus H3N2 | |
| CN106086226A (en) | A kind of blood plasma miRNA mark relevant to IgA nephropathy auxiliary diagnosis and application thereof | |
| CN113817870A (en) | Primer composition for simultaneously detecting seven respiratory tract-related viruses and application thereof | |
| CN109576394A (en) | It is a kind of detect Nebovirus SYBR Green fluorescence quantitative RT-PCR primer and application | |
| CN106191312B (en) | A kind of quick multi-fluorescence immunoassay method and reagent for distinguishing AIV, NDV, MG and MS | |
| CN104946792A (en) | RT-LAMP kit for rapidly identifying dengue virus type 4 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 311100 building 10, building 519, Xingguo Road, Yuhang Economic Development Zone, Zhejiang, Hangzhou Applicant after: The Sheng Tai biotechnology Limited by Share Ltd Address before: 311100 No. 10, building 519, Xingguo Road, Qianjiang Economic Development Zone, Zhejiang, Hangzhou Applicant before: HANGZHOU JOINSTAR BIOTECHNOLOGY CO., LTD. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |