CN102108421A - Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting coxsackie virus type A16 - Google Patents

Abstract

The invention discloses a fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting coxsackie virus type A16, relating to the gene detection technique for pathogens causing various diseases of human. The fluorescence quantitative PCR kit is suitable for quantitative detection of the coxsackie virus type A16. The kit comprises RNA extracting liquid, fluorescence quantitative PCR reaction liquid, a CA16 standard positive template PMD18-T-CA16 and a negative quality control standard, and the fluorescence quantitative PCR reaction liquid contains a specific primer pair and a fluorescent probe for the coxsackie virus type A16. The fluorescence quantitative PCR kit disclosed by the invention has accurate quantitation, fast detection speed, good specificity, high sensitivity, simple steps in use and high repeatability, and can be used for identifying, discriminating and detecting the coxsackie virus type A16. The kit can be used for quick qualitative and quantitative detection of the coxsackie virus type A16, and can replace the traditional culture method used for a long time.

Description

The PCR kit for fluorescence quantitative of rapid detection coxsackie virus A 16-type

Technical field

The present invention relates to a kind of human multiple disease pathogen technique of gene detection that causes, relate in particular to a kind of rapid detection coxsackie virus A 16-type PCR kit for fluorescence quantitative, be applicable to the qualitative and quantitative detection of coxsackie virus A 16-type.

Background technology

(Coxsackievirus CV) is a class enterovirus to Coxsackie virus, finds to be named in New York, United States COxsackie village first because of 1948.This virus belongs to micro ribonucleic acid (Ribonucleic Acid, RNA) Viraceae (Picornavi ridae), enterovirus genus (Enterovirus), it is the infective pathogen of multiple human diseases, the spectrum of causing a disease is wide, can cause respiratory tract infection, conjunctivitis, heat generation fash, hand foot mouth disease (Hand, Foot and Mouth Disease, HFMD), herpangina, myocarditis, myocardosis and diseases such as aseptic meningitis, encephalitis and acute flaccid paralysis.

Up to now, Coxsackie virus has 30 serotypes, is divided into two groups of A and B, and known A group has 24 types, and the B group has 6 types, and wherein, CV A organizes 16 types, and (CV Group A 16 Strain CVA16) are one of main pathogen of causing children HFMD.Pathogenic former-----human enterovirus 71 (HumanEnterovirus 71Strain with another kind of HFMD, HEV71) compare, the HFMD symptom is lighter relatively due to the CVA16, general nonjoinder severe complications, lysis mostly is self limiting, so less to its research.But because nearly more than 20 years HFMD are in the whole world, especially the Asia-Pacific region is periodically broken out, and epidemic situation is comparatively serious, so the main research of causing a disease former CVA16 and HEV71 of this disease more and more is subject to people's attention.

The quantitative fluorescent PCR that development in recent years is got up (Fluorescence Quantitative PCR, FQ-PCR) technology is highly sensitive with it, speed is fast, advantages such as high specificity are at gene expression dose analysis and detection by quantitative (Eng Lee Tan, Vincent Tak Kwong Chow, Development of multiplex real-timehybridization probe reverse transcriptase polymerase chain reaction forspecific detection and differentiation of Enterovirus 71 andCoxsackievirus A16, Diagnostic Microbiology and Infectious Disease 61 (2008) 294-301; Tsao KC, Chang PY, Ning HC, Sun CF, Lin TY, Chang LY, Huang YC, Shih SR (2002) Use of molecular assay in diagnosis of hand, footand mouth disease caused by enterovirus 71 or coxsackievirus A16.J VirolMethods 102:9-14; Chen TC, Chen GW, Hsiung CA, Yang JY, Shih SR, Lai YK, Juang JL (2006) Combining multiplex reverse transcription-PCR and adiagnostic microarray to detect and differentiate enterovirus 71 andcoxsackievirus A16.J Clin Micro 44:2212-2219.) etc. be used widely in the aspect, and become the quantitative main method of current viral nucleic acid, domestic existing at present about third liver, hepatitis B, mycoplasma, chlamydozoan, acquired immune deficiency syndrome (AIDS), the test kit listing of tuberculosis detection by quantitative.

Culture method and serological method traditional on the clinical detection have shortcomings such as sensitivity is low, poor specificity, false positive, time and effort consuming; Though conventional PCR method has easy, quick, sensitive advantage, have can not accurate quantification and the PCR aftertreatment produce the problems such as false positive that pollution causes; Therefore demand accurate, sensitive, quick, the free of contamination Clinical Laboratory method of exploitation urgently.

Summary of the invention

The objective of the invention is to overcome the shortcoming and defect that prior art exists, a kind of PCR kit for fluorescence quantitative of rapid detection coxsackie virus A 16-type is provided.

The present invention is by the following technical solutions:

One, PCR test kit

This test kit comprises: RNA extracting solution (being TRIZOL nucleic acid extraction agent), fluorescence quantitative PCR reaction solution, CA16 standard positive template PMD18-T-CA16 and negative quality control standard product;

1, fluorescence quantitative PCR reaction solution contain the coxsackie virus A 16-type Auele Specific Primer to and fluorescent probe

1) coxsackie virus A 16-type

Forward primer is 5 '-TCARTTCYATGGCTACAGGTYAAGR-3 ',

Reverse primer is 5 '-CTAGRCATTGCTYGTGATTCTG-3 ',

Wherein forward primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction, and reverse primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction;

2) the fluorescent probe sequence be 5 '-TGCTCATCGCCTACACCY-3 ', this fluorescent probe sequence can respectively be extended 10 bases to 5 ' and 3 ' extreme direction,

Fluorescent probe 5 ' end mark report fluorophor FAM, 3 ' hold the non-luminous quenching group mark of mark Eclipse, can significantly reduce the interference of background noise.

2, CA16 standard positive template PMD18-T-CA16 contains the PMD18-T carrier that the nucleotide fragments of 85 base pairs of coxsackie virus A 16-type VP1 gene fragment constitutes, and this carrier can be bred in bacillus coli DH 5 alpha.

3, negative quality control standard product

These feminine gender quality control standard product are aseptic double-distilled water, are used for negative control.

Two, the preparation of PCR test kit and detection method

The preparation and the detection method of PCR test kit comprise the following steps:

1. prepare the RNA extracting solution;

2. prepare fluorescence quantitative PCR reaction solution;

3. prepare CA16 standard positive template PMD18-T-CA16;

4. prepare positive quantitative criterion product;

5. prepare negative quality control standard product;

6. judge the yin and yang attribute of unknown sample.

Extract the unknown sample that detects with the RNA extracting solution and obtain RNA, after get the positive quantitative criterion product of CA16 again and negative quality control standard product add respectively in the PCR reaction tubes that fluorescence quantitative PCR reaction solution is housed, place PCR fluorescent quantitation instrument to react then; Wherein, as standard control, negative quality control standard product response curve is judged the concentration of positive sample as negative control with positive quantitative criterion product response curve with positive quantitative criterion product response curve.Thereby judge the yin and yang attribute and the concentration of unknown sample.

The principle of work of this test kit:

Detect in the coxsackie virus A 16-type PCR kit for fluorescence quantitative at fast quantification provided by the invention, the underlined specificity fluorescent probe of fluorophor, when probe is complete, two groups distance on space structure is close mutually, the fluorescence that 5 ' end reporter group produces is because FRET (fluorescence resonance energy transfer) (FRET) and by the group cancellation of going out of 3 ' end quenching, so there is not the variation of fluorescent signal in the system.In PCR annealing and extension process, probe combines with template specificity, extension along with primer, the Taq archaeal dna polymerase utilizes its 5 ' → 3 ' circumscribed activity that probe cutting is discharged reporter group, destroyed the FRET (fluorescence resonance energy transfer) (FRET) between two groups like this, the photofluorometer that the fluorescence that reporter group discharged can be built in the detection by quantitative instrument detects, and the accumulation volume of the increase of fluorescence volume and PCR product is proportionlity.To coxsackie virus A 16-type quantitatively can comparing draws by the circulation thresholding (Ct, Threshold Cycle) with standard substance.The Ct value is in the PCR process, and the accumulation of fluorescence volume surpasses the circulation number of substrate fluorescence volume, and Ct value and initial modulus are the certain proportion relation, and the Ct value is more little, and the starting template number is many more, and on the contrary, the Ct value is big more, and the starting template number is few more.Utilize the Ct value of positive gradient standard form to make typical curve, can accurately measure the initial copy number of this sample again according to the Ct value of testing sample.

In detection coxsackie virus A 16-type PCR kit for fluorescence quantitative provided by the invention, the singularity in detecting at coxsackie virus A 16-type is carried out reaction system to different target fragments, as primer and concentration and probe concentration, Mg ²⁺The optimization of concentration, annealing temperature etc., and FQ-PCR technology (fluorescent quantitative PCR technique) and detection by quantitative system combined, use it for the coxsackie virus A 16-type detection by quantitative.Pass through prioritization scheme, experiment repeatedly, set up detection coxsackie virus A 16-type fluorescence quantifying PCR method, and develop and detect the coxsackie virus A 16-type PCR kit for fluorescence quantitative, the sensitivity of this test kit can detect 10 copies in each reaction system, can satisfy the requirement of quick diagnosis coxsackie virus A 16-type.

The present invention compared with prior art has the following advantages and effect:

1, quantitatively accurately;

2, detection speed is fast, and only 2 hours, add the extraction preparation of sample DNA, only need 2.5 hours altogether;

3, specificity is good, and is highly sensitive;

4, can identify that difference detects coxsackie virus A 16-type;

5, use step simple, repeatable high.

This test kit can carry out the fast qualitative detection by quantitative to coxsackie virus A 16-type, and alternative traditional culture method of always continuing to use.

Embodiment

Below in conjunction with concrete embodiment, further set forth the present invention.

Should be appreciated that these embodiments only to be used to the present invention is described and be not used in restriction the scope of protection of present invention.

Unreceipted concrete experiment condition and method in the following example, usually according to normal condition as chief editors such as J. Sa nurse Brooker, Science Press, 1992, molecular cloning experiment guide (second edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.

One, about the preparation and the embodiment of detection method

1, test kit is formed and preparation

1. prepare the RNA extracting solution

It is TRIZOL nucleic acid extraction agent.

2. prepare fluorescence quantitative PCR reaction solution

A, fluorescent PCR 10 * Buffer form:

500mM?KCl，100mM?Tris-HCl，PH9.0，1.0％Triton?X-100；

B, fluorescence quantitative PCR reaction solution: PCR 10 * buffer 5.0 μ l, each 1.0 μ l of the forward primer of 10 μ mol/L and reverse primer, the fluorescent probe 1.0 μ l of 5 μ mol/L, the MgCl of 25mmol/L ₂5 μ l, the dNTPs 2.0 μ l of 2.5 μ mol/L, the Taq archaeal dna polymerase 0.5 μ l of 5U/ μ l, the RNA enzyme inhibitors 0.5 μ l of 40U/ μ l, the AMV reversed transcriptive enzyme 1.0 μ l of 10U/ μ l, RNase Free dH ₂O 33 μ l.

3. prepare CA16 standard positive template PMD18-T-CA16: concentration is 10 ⁹Copy/ml standard positive template PMD18-T-CA16.

4. be 10 with the dilution of positive criteria moulding plate series ⁸Copy/ml, 10 ⁷Copy/ml, 10 ⁶Copy/ml, 10 ⁵Copy/ml, 10 ⁴Copy/ml, 10 ³Copy/ml.

5. prepare negative quality control standard product:

These feminine gender quality control standard product are aseptic double-distilled water.

Two, about the Application Example of test kit

1, uses test kit rapid detection coxsackie virus A 16-type

1. the extraction of RNA: each 100 μ l of liquid samples such as serum, bleb liquid, add 200 μ 1RNA lysates and 100 μ l chloroforms, leave standstill 4min behind the thermal agitation mixing 30s on ice; 4 ℃ of centrifugal 15min of 12000rpm; Get the Virahol that supernatant adds equivalent volumes, mixing, room temperature is placed 15min; 4 ℃ of centrifugal 15min of 12000rpm; With 75% washing with alcohol precipitation, the centrifugal 10min of room temperature 12000rpm; Room temperature is dried, standby (preserve RNA as need, then add the DEPC treating water ,-20 ℃ of preservations).

2. get each 45 μ l of fluorescence quantitative PCR reaction solution respectively, get the and 1. go on foot 2. each 5 μ l of CA16 positive criteria template of step dilution of gained CA16RNA and the, and establish negative control, add different PCR reaction tubess respectively, the parallel PCR that is detects on the fluorescent quantitation detector.Cycling condition is: 42 ℃ of reverse transcription 45min; 95 ℃ of pre-sex change 3min; 95 ℃ of 20s, 45 ℃ of 25s, 32 circulations of 72 ℃ of 30s amplifications; 72 ℃ of 10min.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, used fluorescence is FAM, its absorbing wavelength 494nm, emission wavelength 522nm.

3. by the circulation thresholding Ct value of testing sample and respective standard product relatively, the initial copy number of testing sample is carried out quantitatively.

2, experimental result

After the quantitative fluorescent PCR reaction finished, the utilization instrument carried software, reads sample copy number to be checked.The result is: CA16 standard positive template 10 ⁸Copy/ml, 10 ⁷Copy/ml, 10 ⁶Copy/ml, 10 ⁵Copy/ml, 10 ⁴Copy/ml, 10 ³The Ct value of copy/ml is respectively 17.92,21.64, and 24.83,28.248,31.09,34.82; Negative control is 40;

Revision test is 3 times repeatedly, obtains the Ct value and carries out statistical analysis P＞0.05, and the data difference nonsignificance illustrates that the detected result between its different batches has comparability, has good repeatability.

Can illustrate from above-mentioned example, the fluorescence quantifying PCR method quantitative repeatability is good, quantitatively accurately, and, fluorescent quantificationally PCR detecting kit only needed just can finish in 2.5 hours to the detection of sample, and traditional cell culture method needs just can finish about 1 week approximately, therefore, uses this test kit to shorten detection time greatly.

Sequence table

＜110〉Wuhan hundred trt gene Engineering Co., Ltd

＜120〉PCR kit for fluorescence quantitative of rapid detection coxsackie virus A 16-type

<140>

<141>

<160>4

<210>1

<211>21

<212>DNA

＜213〉CA16 forward primer

<400>

5′-TCARTTCYATGGCTACAGGTYAAGR-3′；

<211>2

<212>DNA

＜213〉CA16 reverse primer

<400>

5′-CTAGRCATTGCTYGTGATTCTG-3′；

<211>3

<212>DNA

＜213〉CA16 fluorescent probe sequence

<400>

5′-TGCTCATCGCCTACACCY-3′；

<211>4

<212>DNA

＜213〉nucleotide sequence of the VP1 gene fragment that comprises of CA16 standard positive template PMD18-T-CA16

<400>

TCATTCATGGCTACAGGTAAGATGCTCATCGCCTACACCCCACCCGGGGGAAGTGTGCCTGCGGACAGAATCACAGCAATGCTAG。

Claims (4)

1. the PCR kit for fluorescence quantitative of a rapid detection coxsackie virus A 16-type is characterized in that comprising:

RNA extracting solution, fluorescence quantitative PCR reaction solution, CA16 standard positive template PMD18-T-CA16 and negative quality control standard product;

Described fluorescence quantitative PCR reaction solution contain the coxsackie virus A 16-type Auele Specific Primer to and fluorescent probe;

Forward primer is 5 '-TCARTTCYATGGCTACAGGTYAAGR-3 ',

Reverse primer is 5 '-CTAGRCATTGCTYGTGATTCTG-3 ',

Wherein forward primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction, and reverse primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction;

The fluorescent probe sequence is 5 '-TGCTCATCGCCTACACCY-3 ', this fluorescent probe sequence can respectively be extended 10 bases to 5 ' and 3 ' extreme direction, fluorescent probe 5 ' end mark report fluorophor FAM, the non-luminous quenching group mark of 3 ' end mark Eclipse, can significantly reduce the interference of background noise, CA16 standard positive template PMD18-T-CA16 contains the PMD18-T carrier that the nucleotide fragments of 85 base pairs of coxsackie virus A 16-type VP1 gene constitutes, and this carrier is bred in bacillus coli DH 5 alpha.

2. by the described PCR test kit of claim 1, it is characterized in that the nucleotides sequence of the VP1 gene fragment that CA16 standard positive template PMD18-T-CA16 comprises is classified as:

TCATTCATGGCTACAGGTAAGATGCTCATCGCCTACACCCCACCCGGGGGAAGTGTGCCTGCGGACAGAATCACAGCAATGCTAG。

3. by the described PCR test kit of claim 1, it is characterized in that negative quality control standard product are:

Aseptic double-distilled water.

4. by the preparation and the detection method of the described PCR test kit of claim 1, it is characterized in that comprising the following steps:

1. prepare the RNA extracting solution;

2. prepare fluorescence quantitative PCR reaction solution;

3. prepare CA16 standard positive template PMD18-T-CA16;

4. prepare positive quantitative criterion product;

5. prepare negative quality control standard product;

6. judge the yin and yang attribute of unknown sample.