CN102108422A - Fluorescent quantitative PCR kit for quickly detecting human enterovirus 71 - Google Patents

Abstract

The invention discloses a fluorescent quantitative polymerase chain reaction (PCR) kit for quickly detecting human enterovirus 71, relates to a technology for detecting gene of pathogen causing various diseases, and is suitable for qualitative and quantitative detection of the human enterovirus 71. The kit comprises RNA extracting solution, fluorescent quantitative PCR reaction solution, an EV71 standard positive template PMD18-T-EV71 and a negative quality control standard, wherein the fluorescent quantitative PCR reaction solution contains a human enterovirus 71 specific primer pairs and a fluorescent probe. The kit is accurate in quantity, high in detection speed, and high in specificity and sensitivity, can identify and detect the human enterovirus 71, and is simple in using steps and high in repeatability. The kit can quickly perform qualitative and quantitative detection on the human enterovirus 71, and can replace the traditional culture method.

Description

The PCR kit for fluorescence quantitative of rapid detection human enterovirus 71

Technical field

The present invention relates to a kind of human multiple disease pathogen technique of gene detection that causes, relate in particular to a kind of rapid detection human enterovirus 71 PCR kit for fluorescence quantitative, be applicable to the qualitative and quantitative detection of human enterovirus 71.

Background technology

(Enterovirus 71, EV71) belong to Picornaviridae (Picornaradae) enterovirus genus (Enterovirus), and the virus of same genus also has poliovirus, Coxsackie virus and Echo virus etc. for human enterovirus 71.This viroid is propagated through blood circulation by invasion and attack in the digestive tube tissue of human body and after breeding, and finally causes the various clinical symptom.EV71 was isolated from the cerebrospinal fluid of 19 months big encephalitis infant of California, USA by Schmidt etc. in 1969 at first, made serotype in 1972 years, and in 1974 years reported first.Since report, this virus worldwide causes more than ten outburst with popular, thereby has been subjected to people's extensive concern.EV71 infects and to be recessiveness more, and dominance shows slight person can cause hand foot mouth disease, diarrhoea, fash, aseptic meningitis, encephalitis, myocarditis, and severe patient can show as acute flaccid paralysis, panencephalitis, pulmonary edema or hemorrhage etc., finally can cause death.

Therefore, diagnose EV71 that the development and the prognosis of guiding clinical treatment, assess disease are significant accurately and timely.

The quantitative fluorescent PCR that development in recent years is got up (Fluorescence Quantitative PCR, advantages such as FQ-PCR) technology is highly sensitive with it, speed fast, high specificity are at gene expression dose analysis (Eng Lee Tan, Li Li Gaynor Yong, Rapid detection of Enterovirus 71 by real-time TaqManRT-PCR[J] .Journal of Clinical Virology 42 (2008) 203-206; ) and detection by quantitative (Singh S, Chow VTK, Phoon MC, Chan KP, Poh CL (2002) Direct detection of enterovirus 71 (EV71) in clinical specimens from a hand, foot and mouth disease outbreak in Singapore by reverse transcription-PCR with universal enterovirus and EV71-specific primers.J Clin Microbiol 40:2823-2827; Tan EL, Chow VTK, Kumarasinghe G, Lin RTP, Mackay IM, Sloots TP, Poh CL (2006) Specific detection of Enterovirus 71 directly from clinical specimens using real-time RT-PCR hybridization probe assay.Mol Cell Probes 20:135-140.) etc. be used widely in the aspect, and become the quantitative main method of current viral nucleic acid, domestic existing at present about third liver, hepatitis B, gonococcus, mycoplasma, chlamydozoan, the test kit listing of acquired immune deficiency syndrome (AIDS) and tuberculosis detection by quantitative.

Culture method and serological method traditional on the clinical detection have shortcomings such as sensitivity is low, poor specificity, false positive, time and effort consuming; Though conventional PCR method has easy, quick, sensitive advantage, have can not accurate quantification and the PCR aftertreatment produce the problems such as false positive that pollution causes; Yin Ci Qi waits to develop a kind of accurate, sensitive, quick and free of contamination Clinical Laboratory method.

Summary of the invention

The objective of the invention is to overcome the shortcoming and defect that prior art exists, a kind of PCR kit for fluorescence quantitative of rapid detection human enterovirus 71 is provided.

The present invention is by the following technical solutions:

One, PCR test kit

This test kit comprises: RNA extracting solution (being TRIZOL nucleic acid extraction agent), fluorescence quantitative PCR reaction solution, EV71 standard positive template PMD18-T-EV71 and negative quality control standard product;

1, fluorescence quantitative PCR reaction solution contain the human enterovirus 71 Auele Specific Primer to and fluorescent probe,

1) human enterovirus 71 (EV71):

Forward primer is 5 '-GCCCAATYACAGCCTATYATAATAGC-3 ',

Reverse primer is 5 '-TACARTCTGCCYACCCTARTCTC-3 ', wherein forward primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction, and reverse primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction;

2) the fluorescent probe sequence be 5 '-CTAGCGGCAGCCCAAA-3 ', this fluorescent probe sequence can respectively be extended 10 bases to 5 ' and 3 ' extreme direction, fluorescent probe 5 ' end mark report fluorophor FAM, 3 ' hold the non-luminous quenching group mark of mark Eclipse, can significantly reduce the interference of background noise.

2, EV71 standard positive template PMD18-T-EV71 contains the PMD18-T carrier that the nucleotide fragments of 124 base pairs of human enterovirus 71 VP1 gene fragment constitutes, and this carrier can be bred in bacillus coli DH 5 alpha.

3, negative quality control standard product

These feminine gender quality control standard product are aseptic double-distilled water, are used for negative control.

Two, the preparation of PCR test kit and detection method

The preparation and the detection method of PCR test kit comprise the following steps:

1. prepare the RNA extracting solution;

2. prepare fluorescence quantitative PCR reaction solution;

3. prepare EV71 standard positive template PMD18-T-EV71;

4. prepare positive quantitative criterion product;

5. prepare negative quality control standard product;

6. judge the yin and yang attribute of unknown sample

Extract the unknown sample that detects with the RNA extracting solution and obtain RNA, after get the positive quantitative criterion product of EV71 again and negative quality control standard product add respectively in the PCR reaction tubes that fluorescence quantitative PCR reaction solution is housed, place PCR fluorescent quantitation instrument to react then; Wherein, as standard control, negative quality control standard product response curve is judged the concentration of positive sample as negative control with positive quantitative criterion product response curve with positive quantitative criterion product response curve, thereby judges the yin and yang attribute and the concentration of unknown sample.

The principle of work of this test kit:

Detect in the human enterovirus 71 PCR kit for fluorescence quantitative at fast quantification provided by the invention, the underlined specificity fluorescent probe of fluorophor, when probe is complete, two groups distance on space structure is close mutually, the fluorescence that 5 ' end reporter group produces is because FRET (fluorescence resonance energy transfer) (FRET) and by the group cancellation of going out of 3 ' end quenching, so there is not the variation of fluorescent signal in the system.In PCR annealing and extension process, probe combines with template specificity, extension along with primer, the Taq archaeal dna polymerase utilizes its 5 ' → 3 ' circumscribed activity that probe cutting is discharged reporter group, destroyed the FRET (fluorescence resonance energy transfer) (FRET) between two groups like this, the photofluorometer that the fluorescence that reporter group discharged can be built in the detection by quantitative instrument detects, and the accumulation volume of the increase of fluorescence volume and PCR product is proportionlity.To human enterovirus 71 quantitatively can comparing draws by the circulation thresholding (Ct, Threshold Cycle) with standard substance.The Ct value is in the PCR process, and the accumulation of fluorescence volume surpasses the circulation number of substrate fluorescence volume, and Ct value and initial modulus are the certain proportion relation, and the Ct value is more little, and the starting template number is many more, and on the contrary, the Ct value is big more, and the starting template number is few more.Utilize the Ct value of positive gradient standard form to make typical curve, can accurately measure the initial copy number of this sample again according to the Ct value of testing sample.

In detection human enterovirus 71 PCR kit for fluorescence quantitative provided by the invention, the singularity in detecting at human enterovirus 71 is carried out reaction system to different target fragments, as primer and concentration and probe concentration, Mg ²⁺The optimization of concentration, annealing temperature etc., and FQ-PCR technology (fluorescent quantitative PCR technique) and detection by quantitative system combined, use it for the human enterovirus 71 detection by quantitative.Pass through prioritization scheme, experiment repeatedly, set up detection human enterovirus 71 fluorescence quantifying PCR method, and develop and detect the human enterovirus 71 PCR kit for fluorescence quantitative, the sensitivity of this test kit can detect 10 copies in each reaction system, can satisfy the requirement of quick diagnosis human enterovirus 71.

The present invention compared with prior art has the following advantages and positively effect:

1, quantitatively accurately;

2, detection speed is fast, and only 2 hours, add the extraction preparation of sample DNA, only need 2.5 hours altogether;

3, specificity is good, and is highly sensitive;

4, can identify that difference detects human enterovirus 71;

5, use step simple, repeatable high.

This test kit can carry out the fast qualitative detection by quantitative to human enterovirus 71, and alternative traditional culture method of always continuing to use.

Embodiment

Below in conjunction with specific embodiment, further specify.

Should be appreciated that these embodiment only to be used to the present invention is described and be not used in restriction the scope of protection of present invention.

Unreceipted concrete experiment condition and method in the following example, usually according to normal condition as chief editors such as J. Sa nurse Brooker, Science Press, 1992, molecular cloning experiment guide (second edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, 1982, or connect the condition of advising according to manufacturer.

One, about the preparation and the embodiment of detection method

1. prepare the RNA extracting solution

It is TRIZOL nucleic acid extraction agent.

2. prepare fluorescence quantitative PCR reaction solution

A, fluorescent PCR 10 * Buffer form:

500mM?KCl、100mM?Tris-HCl(PH9.025℃)、1.0％Triton?X-100；

B, fluorescence quantitative PCR reaction solution: PCR 10 * buffer 5.0 μ l, each 1.0 μ l of the forward primer of 10 μ mol/L and reverse primer, the fluorescent probe 1.0 μ l of 5 μ mol/L, the MgCl of 25mmol/L ₂5 μ l, the dNTPs 2.0 μ l of 2.5 μ mol/L, the Taq archaeal dna polymerase 0.5 μ l of 5U/ μ l, the RNA enzyme inhibitors 0.5 μ l of 40U/ μ l, the AMV reversed transcriptive enzyme 1.0 μ l of 10U/ μ l, RNase Free dH ₂O 33 μ l.

3. prepare EV71 standard positive template PMD18-T-EV71

Concentration is 10 ⁹Copy/ml standard positive template PMD18-T-EV71.

4. be 10 with the dilution of positive criteria moulding plate series ⁸Copy/ml, 10 ⁷Copy/ml, 10 ⁶Copy/ml, 10 ⁵Copy/ml, 10 ⁴Copy/ml, 10 ³Copy/ml.

5. prepare negative quality control standard product:

These feminine gender quality control standard product are aseptic double-distilled water.

Two, about the application experiment of test kit

1, uses test kit rapid detection human enterovirus 71

1. the extraction of RNA: each 100 μ l of liquid samples such as serum, bleb liquid, add 200 μ lRNA lysates and 100 μ l chloroforms, leave standstill 4min behind the thermal agitation mixing 30s on ice; 4 ℃ of centrifugal 15min of 12000rpm; Get the Virahol that supernatant adds equivalent volumes, mixing, room temperature is placed 15min; 4 ℃ of centrifugal 15min of 12000rpm; With 75% washing with alcohol precipitation, the centrifugal 10min of room temperature 12000rpm; Room temperature is dried, standby (preserve RNA as need, then add the DEPC treating water ,-20 ℃ of preservations).

2. be 10 to storing concentration ⁹Copy/ml standard positive template PMD18-T-EV71 carries out 10 times serial dilution, and preparation positive criteria product are measured A with ultraviolet spectrophotometer ₂₆₀Quantitative to standard substance.With the dilution of positive criteria moulding plate series is 10 ⁸Copy/ml, 10 ⁷Copy/ml, 10 ⁶Copy/ml, 10 ⁵Copy/ml, 10 ⁴Copy/ml, 10 ³Copy/ml.

3. get each 45 μ l of fluorescence quantitative PCR reaction solution respectively, get 1. step gained EV71RNA and 2. each 5 μ l of EV71 positive criteria template of step dilution, and establish negative control, add different PCR reaction tubess respectively, the parallel PCR that is detects on the fluorescent quantitation detector.Cycling condition is: 42 ℃ of reverse transcription 45min; 95 ℃ of pre-sex change 3min; 95 ℃ of 20s, 45 ℃ of 25s, 32 circulations of 72 ℃ of 30s amplifications; 72 ℃ of 10min.Carry out when the program of fluoroscopic examination is arranged on each round-robin second EOS, used fluorescence is FAM, its absorbing wavelength 494nm, emission wavelength 522nm.

4. by the circulation thresholding Ct value of testing sample and respective standard product relatively, the initial copy number of testing sample is carried out quantitatively.

2, experimental result

After the quantitative fluorescent PCR reaction finished, the utilization instrument carried software, reads sample copy number to be checked.The result is: EV71 standard positive template 10 ⁸Copy/ml, 10 ⁷Copy/ml, 10 ⁶Copy/ml, 10 ⁵Copy/ml, 10 ⁴Copy/ml, 10 ³The Ct value of copy/ml is respectively 17.52,20.64, and 24.43,27.88,30.69,34.42; Negative control is 0 or 40;

Revision test is 3 times repeatedly, obtains the Ct value and carries out statistical analysis P＞0.05, and the data difference nonsignificance illustrates that the detected result between its different batches has comparability, has good repeatability.

Can illustrate from above-mentioned example, the fluorescence quantifying PCR method quantitative repeatability is good, quantitatively accurately, and, fluorescent quantificationally PCR detecting kit only needed just can finish in 2.5 hours to the detection of sample, and traditional cell culture method needs just can finish about 1 week approximately, therefore, uses this test kit to shorten detection time greatly.

The operation of this test kit only needs 1 people can finish whole quantitative work process, once can detect 32-384 (by the model decision of detection by quantitative instrument) sample, has so also reduced waste of manpower resource.

Claims (4)

1. rapid detection human enterovirus 71 PCR kit for fluorescence quantitative is characterized in that comprising:

RNA extracting solution, fluorescence quantitative PCR reaction solution, EV71 standard positive template PMD18-T-EV71 and negative quality control standard product;

Described fluorescence quantitative PCR reaction solution contain the human enterovirus 71 Auele Specific Primer to and fluorescent probe;

Forward primer is 5 '-GCCCAATYACAGCCTATYATAATAGC-3 ',

Reverse primer is 5 '-TACARTCTGCCYACCCTARTCTC-3 ',

Wherein forward primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction, and reverse primer can respectively extend 10 bases to 5 ' and 3 ' extreme direction;

The fluorescent probe sequence is 5 '-CTAGCGGCAGCCCAAA-3 ', this fluorescent probe sequence can respectively be extended 10 bases to 5 ' and 3 ' extreme direction, fluorescent probe 5 ' end mark report fluorophor FAM, the non-luminous quenching group mark of 3 ' end mark Eclipse, can significantly reduce the interference of background noise, standard positive template PMD18-T-EV71 contains the PMD18-T carrier that the nucleotide fragments of 124 base pairs of human enterovirus 71 VP1 gene constitutes, and this carrier can be bred in bacillus coli DH 5 alpha.

2. by the described PCR test kit of claim 1, it is characterized in that the nucleotides sequence of the VP1 gene fragment that EV71 standard positive template PMD18-T-EV71 comprises is classified as:

GCCCAATACAGCCTATATAATAGCACTAGCGGCAGCCCAAAAGAACTTCACTATGAAATTGTGCAAGGATGCTAGTGATATCCTGCAGACGGGCACCATCCAGGGAGATAGGGTGGCAGATGTA。

3. by the described PCR test kit of claim 1, it is characterized in that negative quality control standard product are:

Aseptic double-distilled water.

4. by the preparation method of the described PCR test kit of claim 1, it is characterized in that comprising the following steps:

1. prepare the RNA extracting solution;

2. prepare fluorescence quantitative PCR reaction solution;

3. prepare EV71 standard positive template PMD18-T-EV71;

4. prepare positive quantitative criterion product;

5. prepare negative quality control standard product;

6. judge the yin and yang attribute of unknown sample.