CN105255932A - Conotoxin variant GMVIIA as well as preparation method and application thereof - Google Patents
Conotoxin variant GMVIIA as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN105255932A CN105255932A CN201510684291.5A CN201510684291A CN105255932A CN 105255932 A CN105255932 A CN 105255932A CN 201510684291 A CN201510684291 A CN 201510684291A CN 105255932 A CN105255932 A CN 105255932A
- Authority
- CN
- China
- Prior art keywords
- gmviia
- conotoxin
- varient
- trx
- recombinant protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a preparation method of a conotoxin variant GMVIIA with analgesic activity and belongs to the field of gene engineering. The preparation method comprises steps as follows: the gene sequence of the conotoxin variant GMVIIA is optimized according to the use frequency of Escherichia coli codons, a prokaryotic expression vector, namely, a pET-32a vector, is connected after chemical synthesis, then a recombinant plasmid is introduced into an Escherichia coli Origami (DE3) strain, and efficient soluble expression of recombinant protein Trx-GMVIIA is realized after IPTG induction; the recombinant protein Trx-GMVIIA is separated and purified with the nickel ion affinity chromatography; the recombinant protein Trx-GMVIIA is cut with enterokinase to release GMVIIA, Trx labels are removed with the nickel ion affinity chromatography, and the conotoxin variant GMVIIA is obtained. The mouse acetic acid writhing method proves that the prepared conotoxin variant GMVIIA has significant analgesic activity and has potential application value in the analgesic field.
Description
Technical field
The invention discloses the preparation method of a kind of conotoxin varient GMVIIA, belong to genetically engineered field.
Background technology
Conotoxin be by sea mollusk cone shell (
conus) the bioactive peptide toxin of a class for defending oneself and prey on secreted, be usually made up of 10-30 amino-acid residue, be mostly rich in halfcystine, there is the disulfide linkage skeleton of high conservative.Conotoxin can act on the acceptor of various neurotransmitter on multiple in body (potassium, sodium, calcium etc.) ionic channel, cytolemma and hormone specifically, thus the signal transmission in interference cell or nerve.Therefore, be with a wide range of applications in treatment chronic pain, acute pain, epilepsy, neuroprotective, cardiovascular disorder, insane, ataxia, spasm disease, cancer and apoplexy etc.Omega-conotoxin M VII A (ω-MVIIA) derive from the unreal cone shell of marine organisms (
conusmagus, also claim frock cone shell), calcium channel can be blocked specifically, stop the conduction of pain signal, the Ziconotide(trade(brand)name Prialt being effective constituent with it
tM) be used for the treatment of chronic pain (Terlau, Olivera.Conusvenoms:arichsourceofnovelionchannel-targete dpeptides.PhysiolRev.2004,84:41-68) by FDA approval.
Because in cone shell, conotoxin content is low, and a large amount of gather marine organisms and be also unfavorable for keeping ecological balance, so the method utilizing classical biochemistry to extract directly is separated the needs that conotoxin has been difficult to meet research and drug manufacture from cone shell.Many scientists wish to adopt the method for Solid-phase synthesis peptides to solve this difficulty, but the cost of synthetic conotoxin is very high, can't meet the requirement of producing as pharmaceutical businessization completely.Therefore, scientist is had to propose to express (Zhanetal.AfusionproteinofconotoxinMVIIAandthioredoxinexp ressedin by the gene transformation of conotoxin to the microorganisms such as intestinal bacteria
escherichiacolihassignificantanalgesicactivity.BiochemBiophysResCommun. 2003,311:495-500).
In the restructuring conotoxin of expressing, Trx label (Trx label) is not only conducive to the solubility expression of target protein, can also promote the correct formation of three pairs of disulfide linkage.But this body length of Trx label is 109 amino-acid residues, molecular weight is comparatively large, if do not excised, can affect the perviousness in vivo of conotoxin dramatically, thus affecting analgesic effect.In theory, use enteropeptidase cutting recombinant protein can remove Trx label, but be cysteine residues (Cys) at the C-terminal of natural ripe ω-MVIIA, when being cysteine residues (Cys) after enterokinase cleavage site point (DDDDK), enteropeptidase can not cut effectively.In order to overcome this problem, the present invention introduces the less glycine residue (Gly) of a side chain group at the C-terminal of ω-MVIIA, research confirms, the introducing of glycine residue (Gly), can make conotoxin varient GMVIIA effectively be cut down by enteropeptidase.Conotoxin varient GMVIIA prepared by the scheme utilizing the present invention to propose shows higher analgesic activities, has great using value.
Summary of the invention
The object of the invention is to preparation method and the application thereof of the conotoxin varient GMVIIA of openly a kind of high expression tool analgesic activities.
The present invention is achieved through the following technical solutions above-mentioned purpose:
A preparation method of conotoxin varient GMVIIA, is characterized in that, comprise following steps:
(1) ω-MVIIA variant genes GMVIIA is designed and synthesized;
(2) ω-MVIIA variant genes GMVIIA construction recombination plasmid pET-32a-GMVIIA utilizing step (1) to synthesize, imports Host Strains by recombinant plasmid, obtains genetic engineering bacterium;
(3) the LB substratum concussion be inoculated in by the genetic engineering bacterium that step (2) obtains containing penbritin is cultivated, and after IPTG induction, high expression produces soluble recombinant protein Trx-GMVIIA;
(4) recombinant protein Trx-GMVIIA is obtained after purifying with nickel ion affinity chromatograph.
(5) cut recombinant protein Trx-GMVIIA and obtain restructuring conotoxin varient GMVIIA.
Wherein, the concrete grammar designing and synthesizing ω-MVIIA variant genes GMVIIA described in step (1) is: the codon optimizing conotoxin ω-MVIIA gene according to e. coli codon frequency of utilization, the N of conotoxin ω-MVIIA after optimization holds introducing glycine (Gly) residue, called after GMVIIA, its nucleotide sequence is as shown in SEQIDNO.1.
Wherein, the recombinant plasmid described in step (2) is ω-MVIIA variant genes GMVIIA warp step (1) synthesized
kpni/
hindafter III double digestion, be connected into that the prokaryotic expression carrier pET-32a that cuts through same enzyme obtains; Described Host Strains is intestinal bacteria Origami(DE3) bacterial strain competent cell.
Wherein, cutting recombinant protein Trx-GMVIIA concrete operations described in step (5) are: adopt enteropeptidase cutting recombinant protein Trx-GMVIIA to discharge GMVIIA, remove Trx label with nickel ion affinity chromatograph further, obtain restructuring conotoxin varient GMVIIA.
The present invention also provides a kind of restructuring conotoxin varient GMVIIA obtained according to aforesaid method, and described restructuring conotoxin varient GMVIIA has analgesic activities.
The present invention provides a kind of described restructuring conotoxin varient GMVIIA preparing the application in analgesic in addition.
beneficial effect of the present invention:
The present invention is by the Trx-GMVIIA(15.3kDa of genetic engineering means in E. coli solubility), after nickel ion affinity chromatograph separation and purification, adopt enteropeptidase cutting Trx-GMVIIA, and then remove Trx label and His label, obtain the restructuring conotoxin varient GMVIIA of molecular weight (2.8kDa).With 2.0mg/kg dosage injection mouse, carry out the experiment of mouse acetic acid twisting, result shows, after injection GMVIIA, the average writhing number of times of mouse is 3.55 times, compared with injecting normal saline negative control, has significant analgesic activities, compared with the positive controls of injection Trx-GMVIIA, small-molecular-weight GMVIIA has stronger analgesic activities.Therefore, the restructuring conotoxin varient GMVIIA using the present invention to prepare has high analgesic activities, has potential using value in analgesia field.
Accompanying drawing explanation
Fig. 1: restructuring conotoxin Trx-GMVIIA, Trx-ω-MVIIA structural representation.Trx label can promote the solubility expression of recombinant protein, and promotes to form correct disulfide linkage.His label is poly His label, can be used for nickel ion affinity chromatograph separation and purification recombinant protein.Arrow is depicted as the cleavage site of enteropeptidase.Though × representing there is enterokinase cleavage site point, enteropeptidase can not effectively cut.
Fig. 2: the electrophoresis result after enteropeptidase cutting recombinant protein.M: protein marker, 1: without the recombinant protein Trx-GMVIIA of enteropeptidase cutting, the enteropeptidase cleaved products of 2: recombinant protein Trx-ω-MVIIA, the enteropeptidase cleaved products of 3: recombinant protein Trx-GMVIIA, 4: the GMVIIA of purifying.Arrow is depicted as the corresponding band of the rear GMVIIA of enteropeptidase cutting.
Fig. 3: the analgesic activities analytical results of restructuring conotoxin GMVIIA.
Embodiment
Term used in the present invention, unless otherwise specified, generally has the implication that those of ordinary skill in the art understand usually.Below in conjunction with specific embodiment, and comparable data describes the present invention in further detail.These embodiments just in order to demonstrate the invention, but not limit the scope of the invention by any way.
Embodiment of the present invention expression vector pET-32a used is easily replaced by the expression vector of similar functions, and the present invention's expression strain used also can be replaced by the coli strain of similar functions.
embodiment 1: the synthesis of conotoxin GMVIIA gene and qualification
According to e. coli codon frequency of utilization, the codon of conotoxin ω-MVIIA gene (GenBank:FJ959111) is optimized.Effectively cut recombinant protein in order to enteropeptidase can be made and express label to remove, hold introducing glycine (Gly) residue, called after GMVIIA at the N of conotoxin ω-MVIIA.The gene order of designed conotoxin ω-MVIIA varient GMVIIA is that SEQIDNO.1(is to introduce restriction enzyme in GMVIIA upstream
kpnthe restriction enzyme site of I, the encoding sequence of enterokinase cleavage site point DDDDK), the sequence of the GMVIIA albumen of its coding is SEQIDNO.2.
Adopt chemical process synthesis GMVIIA gene (being synthesized by Shanghai JaRa Bioisystech Co., Ltd), warp
kpni/
hindafter III double digestion, be connected into the prokaryotic expression carrier pET-32a(that cuts through same enzyme purchased from Novagen company), recombinant plasmid pET-32a-GMVIIA verifies through DNA sequencing.In order to ω-MVIIA in contrast, use the same method construction recombination plasmid pET-32a-ω-MVIIA.
Fig. 1 is shown in the structural representation utilizing the present invention to design the recombinant protein of expression.
embodiment 2: the expression of restructuring conotoxin GMVIIA, separation and purification and cutting
Adopt thermal shock method that correct recombinant plasmid pET-32a-GMVIIA, pET-32a-ω-MVIIA of checking is imported intestinal bacteria Origami(DE3 respectively) bacterial strain (purchased from Novagen company) competent cell, obtain genetic engineering bacterium Origami-GMVIIA, Origami-ω-MVIIA.
Respectively by Origami-GMVIIA, Origami-ω-MVIIA inoculation in LB substratum (containing penbritin 100 μ g/mL), 37 DEG C concussion cultivate, to OD
600value is about 0.8, cultured cells is cooled to 28 DEG C, adds the IPTG that final concentration is 1mmol/L, and 28 DEG C shake cultivation 12 hours.Centrifugal collecting cell, 37 DEG C/-20 DEG C multigelations 5 times, 200w ultrasonication.After high speed centrifugation, utilize nickel ion resin from supernatant, be separated solubility restructuring Trx-GMVIIA, Trx-ω-MVIIA with His label.The recombinant protein of purifying removes the impurity such as imidazoles through dialysis, then concentrates recombinant protein solution with freeze-drying.Measure Proteins In Aqueous Solutions concentration by Bradford method, and detect recombinant protein with SDS-PAGE.
Recombinant protein Trx-GMVIIA, Trx-ω-MVIIA of enteropeptidase to separation and purification is used to cut, 37 DEG C of cuttings of spending the night.SDS-PAGE electrophoresis result shows, enteropeptidase can effectively cut recombinant protein Trx-GMVIIA, but can not cut Trx-ω-MVIIA(and see Fig. 2).Halfcystine (Cys) residue of the C end of visible ω-MVIIA can have a strong impact on the cutting efficiency of enteropeptidase to recombinant protein.And in GMVIIA, owing to introducing glycine (Gly) residue when designing at C end, enteropeptidase effectively can cut recombinant protein Trx-GMVIIA.
After enteropeptidase cutting, nickel ion resin specificity from cleaved products is utilized to retain Trx label with poly His, the GMVIIA containing release in the solution of outflow.Adopt Bradford method to measure the GMVIIA protein concentration obtained, and adopt SDS-PAGE to detect.
embodiment 3: the analgesic activities analysis of restructuring conotoxin GMVIIA
Experimental group is with restructuring conotoxin GMVIIA, Trx-GMVIIA, Trx-ω-MVIIA injection of solution mouse obtained in embodiment 2, and using dosage is 2.0mg/kg, negative control group injecting normal saline (0.9%NaCl).Often organize injection 20 male mices, the body weight of every mouse is 20 ± 0.2g.45min after administration, stimulates writhing behavior to every injected in mice 0.2mL0.6% Glacial acetic acid, counts, then carry out statistical study to experimental data to the writhing action of every mouse in 20min.Result shows, the average writhing number of times of the mouse of injection Trx-GMVIIA, Trx-ω-MVIIA solution is respectively 20.60 times and 20.05 times, saline control group is 37.4 times, visible recombinant protein Trx-GMVIIA, Trx-ω-MVIIA all has significant analgesic activities, but the analgesic activities of Trx-GMVIIA, Trx-ω-MVIIA is without significant difference.After using enteropeptidase cutting, the GMVIIA of purifying injects mouse, and average writhing number of times is 3.55 (see figure 3)s, far below the average writhing number of times of injection recombinant protein Trx-GMVIIA, Trx-ω-MVIIA.Therefore, the restructuring conotoxin GMVIIA using the present invention to prepare has high analgesic activities, has potential using value.
SEQUENCELISTING
<110> Jiangsu University
<120> conotoxin varient GMVIIA and its preparation method and application
<130> conotoxin varient GMVIIA and its preparation method and application
<160>2
<170>PatentInversion3.3
<210>1
<211>108
<212>DNA
The unreal cone shell of <213> (Conusmagus)
<400>1
ctgggtaccgacgacgacgacaagggttgcaagggtaaaggcgcgaaatgtagccgtctg60
atgtatgactgctgcaccggctcgtgccgcagtggtaaatgtggctaa108
<210>2
<211>27
<212>PRT
The unreal cone shell of <213> (Conusmagus)
<400>2
GlyCysLysGlyLysGlyAlaLysCysSerArgLeuMetTyrAspCys
151015
CysThrGlySerCysArgSerGlyLysCysGly
2025
Claims (6)
1. a preparation method of conotoxin varient GMVIIA, is characterized in that, comprises following steps:
(1) ω-MVIIA variant genes GMVIIA is designed and synthesized;
(2) ω-MVIIA variant genes GMVIIA construction recombination plasmid pET-32a-GMVIIA utilizing step (1) to synthesize, imports Host Strains by recombinant plasmid, obtains genetic engineering bacterium;
(3) the LB substratum concussion be inoculated in by the genetic engineering bacterium that step (2) obtains containing penbritin is cultivated, and after IPTG induction, high expression produces soluble recombinant protein Trx-GMVIIA;
(4) recombinant protein Trx-GMVIIA is obtained after purifying with nickel ion affinity chromatograph;
(5) cut recombinant protein Trx-GMVIIA and obtain restructuring conotoxin varient GMVIIA.
2. the preparation method of a kind of conotoxin varient GMVIIA according to claim 1, it is characterized in that, the concrete grammar designing and synthesizing ω-MVIIA variant genes GMVIIA described in step (1) is: the codon optimizing conotoxin ω-MVIIA gene according to e. coli codon frequency of utilization, the N of conotoxin ω-MVIIA after optimization holds introducing glycine (Gly) residue, called after GMVIIA, its nucleotide sequence is as shown in SEQIDNO.1.
3. the preparation method of a kind of conotoxin varient GMVIIA according to claim 1, is characterized in that, the recombinant plasmid described in step (2) is ω-MVIIA variant genes GMVIIA warp step (1) synthesized
kpni/
hindafter III double digestion, be connected into that the prokaryotic expression carrier pET-32a that cuts through same enzyme obtains; Described Host Strains is intestinal bacteria Origami(DE3) bacterial strain competent cell.
4. the preparation method of a kind of conotoxin varient GMVIIA according to claim 1, it is characterized in that, cutting recombinant protein Trx-GMVIIA concrete operations described in step (5) are: adopt enteropeptidase cutting recombinant protein Trx-GMVIIA to discharge GMVIIA, remove Trx label with nickel ion affinity chromatograph further, obtain restructuring conotoxin varient GMVIIA.
5. the restructuring conotoxin varient GMVIIA that obtains of method according to claim 1, described restructuring conotoxin varient GMVIIA has analgesic activities.
6. the conotoxin varient GMVIIA that recombinates according to claim 5 is preparing the application in analgesic.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510684291.5A CN105255932B (en) | 2015-10-22 | 2015-10-22 | A kind of conotoxin variant GMVIIA and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510684291.5A CN105255932B (en) | 2015-10-22 | 2015-10-22 | A kind of conotoxin variant GMVIIA and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105255932A true CN105255932A (en) | 2016-01-20 |
| CN105255932B CN105255932B (en) | 2018-12-14 |
Family
ID=55095859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510684291.5A Expired - Fee Related CN105255932B (en) | 2015-10-22 | 2015-10-22 | A kind of conotoxin variant GMVIIA and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105255932B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108117599A (en) * | 2018-01-03 | 2018-06-05 | 海门迈克艾伦生物医药有限公司 | The recombination expression and purification process of Ssm6a and its fusion protein used |
| CN116355932A (en) * | 2022-11-04 | 2023-06-30 | 北京百奥茵诺生物科技有限公司 | Recombinant vector and method for preparing mu-conotoxin |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1876176A (en) * | 2006-07-11 | 2006-12-13 | 浙江大学 | Omega-conotoxin M VII A mutant and its preparation and uses |
| CN1982457A (en) * | 2006-04-30 | 2007-06-20 | 中山大学 | Toxic sequential, its preparation and use |
| CN101967493A (en) * | 2010-06-10 | 2011-02-09 | 广东医学院 | Prokaryotic expression vector and application thereof |
-
2015
- 2015-10-22 CN CN201510684291.5A patent/CN105255932B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1982457A (en) * | 2006-04-30 | 2007-06-20 | 中山大学 | Toxic sequential, its preparation and use |
| CN1876176A (en) * | 2006-07-11 | 2006-12-13 | 浙江大学 | Omega-conotoxin M VII A mutant and its preparation and uses |
| CN101967493A (en) * | 2010-06-10 | 2011-02-09 | 广东医学院 | Prokaryotic expression vector and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| DAVID P. GOLDENBERG等: "Solution structure and backbone dynamics of an -conotoxin precursor", 《PROTEIN SCIENCE》 * |
| MARIAN PRICE-CARTER等: "Folding of ω-Conotoxins. 2. Influence of Precursor Sequences and Protein Disulfide Isomerase", 《BIOCHEMISTRY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108117599A (en) * | 2018-01-03 | 2018-06-05 | 海门迈克艾伦生物医药有限公司 | The recombination expression and purification process of Ssm6a and its fusion protein used |
| CN116355932A (en) * | 2022-11-04 | 2023-06-30 | 北京百奥茵诺生物科技有限公司 | Recombinant vector and method for preparing mu-conotoxin |
| CN116355932B (en) * | 2022-11-04 | 2024-01-23 | 北京百奥茵诺生物科技有限公司 | Recombinant vector and method for preparing mu-conotoxin |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105255932B (en) | 2018-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104450746A (en) | Method for fixed-point introduction of non-natural amino acid to protein | |
| CN104017786B (en) | A kind of phospholipase A2Mutant and preparation method thereof | |
| CN103555756A (en) | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae | |
| CN103103174A (en) | Chondrosulphatase AC fusion protein, and coding gene and construction method thereof | |
| CN107759675A (en) | A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis | |
| CN101906165B (en) | Expression product in series of two fish antibacterial peptide genes and expression method thereof | |
| CN107312095A (en) | A kind of Melittin of antibacterial peptide LL 37 and its application and the preparation method in bacillus subtilis | |
| CN105255932A (en) | Conotoxin variant GMVIIA as well as preparation method and application thereof | |
| CN101343635B (en) | Method for construction and expression of prescribed sugar chain modified glucoprotein engineering bacterial strain | |
| CN103103173B (en) | Chondrosulphatase B fusion protein, and coding gene and construction method thereof | |
| CN103194477B (en) | Fused type prokaryotic expression vector and construction method and application thereof | |
| CN103865867A (en) | Engineering bacteria based on extracellular Alpha-L-arabinofuranosidase and implementation method thereof | |
| CN103255115B (en) | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked | |
| CN102337288A (en) | Gene engineering preparation method of tilapia hepcidin | |
| CN103865868A (en) | Xylanase-based engineering bacteria and realization method thereof | |
| CN102061302A (en) | Synthetic method of enterokinase light chain gene and preparation method of expression product of enterokinase light chain gene | |
| CN102094024A (en) | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application | |
| CN110358781A (en) | A kind of acidic mammalian chitinase encoding gene and application | |
| CN105483188A (en) | Splicing method of DNA fragment | |
| CN102212541A (en) | Construction of gene engineering bacteria for expressing recombinant cationic antimicrobial peptides (AMPs) G13 escherichia coli | |
| CN102250938B (en) | Preparation method of cardiactide | |
| CN101880314B (en) | Bursin-like peptide of gene engineering as well as expression gene and application thereof | |
| CN101875691B (en) | Scorpion arialgesic antitumoral peptide mutant and preparation method thereof | |
| CN103993030A (en) | Method of shearing fusion protein by escherichia coli intracellular protease | |
| CN104975058A (en) | Pain-relief active polypeptide screening method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181214 Termination date: 20191022 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |