CN103255115B - The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked - Google Patents
The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked Download PDFInfo
- Publication number
- CN103255115B CN103255115B CN201310124191.8A CN201310124191A CN103255115B CN 103255115 B CN103255115 B CN 103255115B CN 201310124191 A CN201310124191 A CN 201310124191A CN 103255115 B CN103255115 B CN 103255115B
- Authority
- CN
- China
- Prior art keywords
- talen
- tat
- chain
- cell
- penetrating type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked.Penetrating type TAT-TALEN albumen also has cell penetrating peptide TAT at the L chain of TALEN albumen and the N end of R chain, and the aminoacid sequence of described cell penetrating peptide TAT is: N holds-TyrGlyArgLysLysArgArgGlnArgArgArg-C end.Penetrating type TAT-TALEN albumen of the present invention can knock out cellular endogenous genomic dna, especially can knock out endogenous cellular CCR5 gene, therefore can be applied to the CCR5 gene knockout in acquired immune deficiency syndrome (AIDS) gene therapy clinically.Application the present invention does not introduce any foreign gene while knocking out CCR5 gene, there is not the risk causing insert type to suddenly change in radom insertion to the genome of cell, and TAT-TALEN albumen can not be present in cell by cell degradation after entering cells play effect gradually always.
Description
Technical field:
The invention belongs to biological technical field, be specifically related to the preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene knock out.
Background technology:
Acquired immune deficiency syndrome (AIDS) (AIDS) is the communicable disease being infected a kind of serious threat human health caused by hiv virus (HIV).Research shows that CCR5 is that HIV invades cell most important co-receptor, have the natural disappearance (CCR5 △ 32) that there are 32 bases of the CCR5 gene of sub-fraction crowd in the world, and they not easily can be lived normally by HIV.A leukemia people simultaneously having infected HIV accepts donor hematopoietic stem cell (HSCs) bone marrow transplantation of CCR5 Δ 32/ Δ 32, after stopping HAART treating 20 months, there is not the bounce-back of virus, observe this patient's immunity system successful reconstitution subsequently, viral storage vault is As time goes on also in reduction.This is the first AIDS patient being obtained healing by stem cell transplantation in the world.But this treatment means can not widespread use, because the homozygous people of CCR5 △ 32 only has a little, is difficult to find CCR5 △ 32 donor of same distribution type to carry out marrow hemopoietic stem cells transplanting.
The gene targeting being representative with activating transcription factor sample effector nuclease (TALEN) can realize specifying the targeting of gene to knock out.Utilize the CCR5 CCR5 of wild-type being sported inactivation type that this technology namely can be artificial.Namely the stem-cell therapy strategy of acquired immune deficiency syndrome (AIDS) becomes to utilize and is similar to the CCR5 gene that this nuclease instrument of TALEN knocks out in AIDS patients body in hemopoietic stem cell and carries out autologous hematopoietic stem cell transplantation again.Recent research shows, multipotency induced dry-cell (iPSCs) is because wide material sources, be easy to long-term cultivation in vitro, and the iPSCs having knocked out CCR5 gene directed differentiation can become have the hemopoietic stem cell of Almightiness type, can be used as a kind of alternative obtaining CCR5 absence type hemopoietic stem cell, very promising.But no matter be the CCR5 gene directly knocked out in HSCs, the CCR5 gene still first knocked out in the iPSCs of people obtains the hemopoietic stem cell of CCR5 absence type more indirectly, all needs TALEN to be transported in cell to carry out gene knockout.And existing with virus or plasmid for the method for carrier conveying TALEN likely causes the insert type of genes within cells to suddenly change, dangerous for use clinically.
Summary of the invention:
The first object of the present invention is to provide a kind of penetrating type TAT-TALEN albumen that can knock out cellular endogenous genomic dna.
The present invention can knock out the penetrating type TAT-TALEN albumen of cellular endogenous genomic dna, it is characterized in that, it also has cell penetrating peptide TAT at the L chain of TALEN albumen and the N end of R chain, and the aminoacid sequence of described cell penetrating peptide TAT is: N holds-TyrGlyArgLysLysArgArgGlnArgArgArg-C end.
Above-mentioned penetrating type TAT-TALEN albumen is knocking out the application in cellular endogenous genomic dna.
To encode above-mentioned the L chain of penetrating type TAT-TALEN albumen and the nucleotide sequence of R chain that can knock out cellular endogenous genomic dna.
In order to for endogenous CCR5 gene, the L chain that can knock out the penetrating type TAT-TALEN albumen of endogenous cellular CCR5 gene of the present invention is by the alkali yl coding of sequence shown in SEQ ID NO.1, and the R chain of penetrating type TAT-TALEN albumen is by the alkali yl coding of sequence shown in SEQ ID NO.2.This penetrating type TAT-TALEN albumen can knock out endogenous cellular CCR5 gene and apply in preparation acquired immune deficiency syndrome (AIDS) gene therapy medicament.
The preparation method of the cell that a kind of endogenous CCR5 gene is knocked, it is characterized in that, the L chain of penetrating type TAT-TALEN albumen that can knock out endogenous cellular CCR5 gene by above-mentioned for coding and the nucleotide sequence of R chain insert in prokaryotic expression carrier respectively, then prokaryotic expression goes out to knock out L chain and the R chain of the penetrating type TAT-TALEN albumen of endogenous cellular CCR5 gene, by the L chain of penetrating type TAT-TALEN albumen and R chain with the cell incubation containing endogenous CCR5 gene to knock out CCR5 gene, thus obtain the cell that endogenous CCR5 gene is knocked.
The L chain of penetrating type TAT-TALEN albumen and R chain are preferably hatched 1 hour with the cell containing CCR5 gene at 37 DEG C by described hatching, cell culture fluid is changed to remove penetrating type TAT-TALEN albumen with cell culture complete medium, again 30 DEG C of cellar cultures 24 hours, mix 37 DEG C with the L chain of penetrating type TAT-TALEN albumen and R chain again and hatch 1 hour, cell culture fluid is changed to remove penetrating type TAT-TALEN albumen again with cell culture complete medium, again 30 DEG C of cellar cultures 24 hours, repeat so more once.
TALEN albumen of the present invention refers to activating transcription factor sample effector nuclease, and it comprises TALEN L chain and R chain.
Penetrating type TAT-TALEN albumen of the present invention can knock out cellular endogenous genomic dna, especially can knock out endogenous cellular CCR5 gene, therefore can be applied to the CCR5 gene knockout in acquired immune deficiency syndrome (AIDS) gene therapy clinically.Application the present invention does not introduce any foreign gene while knocking out CCR5 gene, there is not the risk causing insert type to suddenly change in radom insertion to the genome of cell, and TAT-TALEN albumen can not be present in cell by cell degradation after entering cells play effect gradually always.What the present invention can be simple and safe as can be seen here knocks out endogenous cellular CCR5 gene, can as the medicine for the treatment of AIDS, in the gene therapy of acquired immune deficiency syndrome (AIDS).
Accompanying drawing explanation
Fig. 1 is the TAT-TALEN protein structure schematic diagram built; Wherein: standard TALEN L/R: without the standard transcriptional activation increment effector nuclease of transformation; The transcriptional activation increment effector nuclease that TAT-TALEN L/R:TAT modifies; His:6 Histidine purification tag; TAT: cell-penetrating peptides TAT small peptide; NLS: nuclear localization sequence; Transcription activator-likedomain: transcription activator spline structure territory; FokI:FokI nuclease structural domain.
Fig. 2 is the TALEN protein SDS-PAGE detection figure that final purifying obtains; Wherein: the L chain of TALEN L:TALEN albumen; The R chain of TALEN R:TALEN albumen; The L chain of TAT-TALEN L:TAT-TALEN albumen; The R chain of TAT-TALENR:TAT-TALEN.
Fig. 3 is the purified outer Activity determination of TALEN proteoplast: wherein, a pair TALEN that standard TALENs:TALEN L and TALEN R is formed; A pair TALEN that TAT-TALENs:TAT-TALEN L and TAT-TALEN R is formed; The CCR5 fragment comprising TALEN recognition site of substrate:PCR amplification; Products:TALEN specific enzymes cuts the product that CCR5 fragment obtains.
Fig. 4 detects the Western blot of purified TALEN albumen penetration cell: wherein: pre-transduction lysate: the cell sample before hatching with albumen; Post-transduction lysate: the cell sample after hatching with albumen; TALEN L: the cell sample after hatching with TALEN L; TALEN R: the cell sample after hatching with TALEN R; TAT-TALEN L: the cell sample after hatching with TAT-TALEN L; TAT-TALEN R: the cell sample after hatching with TAT-TALEN R; GAPDH: internal reference glyceraldehyde-3-phosphate dehydrogenase.
Fig. 5 cuts detected result to the Surveyor enzyme that endogenous cellular CCR5 gene is knocked situation after TALEN or TAT-TALEN albumen and Hela cell and hiPSCs cell incubation.
Fig. 6 is the sequencing result comparison of the HeLa cellular genome CCR5 after the process of TAT-TALEN albumen: wherein: WT: the CCR5 sequence of wild-type; After Deletions:TAT-TALEN cuts target sequence, cell carries out the nucleotide deletion that DNA repairs introducing; After Insertions:TAT-TALEN cuts target sequence, cell carries out the Nucleotide insertion that DNA repairs introducing.
Embodiment
For making the present invention easier to understand, below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these examples are only not used in for illustration of the present invention to limit the scope of the invention.
Embodiment 1: utilize penetrating type TAT-TALEN protein knockout HeLa cell and hiPSCs endogenous cellular CCR5 gene.
The structure (Fig. 1) of standard type TALEN and TAT-TALEN prokaryotic expression carrier:
1, the structure of CCR5 specificity T ALEN prokaryotic expression carrier.
The encoding sequence of the L chain (TALEN L) of the TALEN sequence of the present embodiment is as shown in the 37-3021 bit base of SEQ ID NO.1, and the encoding sequence of the R chain (TALEN R) of TALEN sequence is as shown in the 37-3021 bit base of SEQ ID NO.2.The encoding sequence of the L chain (TAT-TALEN L) of the TAT-TALEN sequence of the present embodiment is as shown in SEQ ID NO.1, the encoding sequence of the R chain (TAT-TALEN R) of TAT-TALEN sequence is as shown in SEQ ID NO.2, it is the encoding sequence that with the addition of cell penetrating peptide TAT at 5 ' end of TALEN sequence, and its sequence is as shown in the 4-36 bit base of SEQ ID NO.1 or 2.The TALEN L of the target CCR5 that the present embodiment is used and TALEN R all containing 17 repeating units, respectively can 17 Nucleotide in specific recognition CCR5 gene (TALEN L identifies TCATTACACCTGCAGCT; TALEN R identifies CTTCCAGAATTGATACT), wherein HD identifies that C, NI identify that A, NG identify that T, NN identify G.
Reference: the encoding sequence of the L chain (TALEN L) of the TALEN sequence as shown in the 37-3021 bit base of SEQ ID NO.1, encoding sequence with the R chain (TALEN R) of the TALEN sequence shown in the 37-3021 bit base of such as SEQ ID NO.2, adopts GoldenGate plasmid construction from part to build TALEN(TALEN L or TALEN R) eukaryotic vector.
A) each mode bearer (each 150ng)+pFUS_A carrier (150ng) of 1-10 repeating unit or each mode bearer (each 150ng)+pFUS_B carrier (150ng) of 11-16 repeating unit
B) Bsal enzyme (1 μ l)
C) T-4DNA ligase enzyme (1 μ l)
D) 10 × T4DNA ligase enzyme damping fluid (2 μ l)
E) make up water to 20 μ l
Reaction conditions: 10 × (37 DEG C/5min+16 DEG C/10min)+50 DEG C/5min+80 DEG C/5min.
Add a) 10mM ATP; B) Plasmid-Safe nuclease (1 μ l)
1 hour is hatched under 37 DEG C of conditions.By product conversion in TOP-10 competence bacterial strain, containing 10mg/L tsiklomitsin, 50mg/L spectinomycin, 50mg/L penbritin, 40mg/L X-gal, pick out white mono-clonal in the LB flat board of the IPTG of 24mg/L, after enlarged culturing, extract plasmid, obtain containing the pFUS_A plasmid (carrier A) of 1-10 repeating unit and the pFUS_B plasmid (carrier B) of 11-16 repeating unit respectively.
A) carrier A and carrier B (each 150ng)
B) pLR carrier (150ng), comprises the 17th repeating unit
C) skeleton carrier pTAL(75ng)
D) Esp3I enzyme (1 μ l)
E) T-4DNA ligase enzyme (1 μ l)
F) 10 × T4DNA ligase enzyme damping fluid (2 μ l)
G) make up water to 20 μ l
Reaction conditions: 10 × (37 DEG C/5min+16 DEG C/10min)+37 DEG C/15min+80 DEG C/5min
By product conversion in TOP-10 competence bacterial strain, containing 50mg/L penbritin, white mono-clonal bacterium colony is selected in the LB flat board of 40mg/L X-gal and 24mg/LIPTG, extract the pTAL plasmid containing total length TALEN after enlarged culturing, be TALEN L and the TALEN R carrier for expression of eukaryon of final acquisition.
Utilize the method for pcr amplification from above-mentioned TALEN(TALEN L or TALEN R) amplify TALEN(with TALEN L carrier for expression of eukaryon for template then amplifies TALEN L chain carrier for expression of eukaryon, with TALEN R carrier for expression of eukaryon for template then amplifies TALEN R chain) (primer: GGAATTCCATATGGCTCCAAAGAAGAAGCG and CCCAAGCTTTTAAAAGTTTATCTCGCCGTTAT) and TAT-TALEN(with TALEN L carrier for expression of eukaryon for template then amplifies TAT-TALEN L chain, with TALEN R carrier for expression of eukaryon for template then amplifies TAT-TALEN R chain) (primer: GGAATTCCATATGTACGGTCGTAAAAAACGTCGTCAGCGTCGTCGTATGGCTCCAA AGAAGAAGCG and CCCAAGCTTTTAAAAGTTTATCTCGCCGTTAT), be cloned on pET28a prokaryotic expression carrier with NedI and BamHI double digestion.The prokaryotic expression carrier pET28a-TAT-TALEN L(of final acquisition TAT-TALEN L and TAT-TALENR inserts in pET28a prokaryotic expression carrier through the sequence of sequence verification as shown in SEQ ID NO.1) and pET28a-TAT-TALEN R(insert in pET28a prokaryotic expression carrier through the sequence of sequence verification as shown in SEQ ID NO.2) (Fig. 1).In contrast, standard type TAELN L and TALEN R prokaryotic expression carrier pET28a-TALEN L(inserts in pET28a prokaryotic expression carrier through the 37-3021 bit base of the sequence of sequence verification as shown in SEQ ID NO.1) and pET28a-TALEN R(insert in pET28a prokaryotic expression carrier through the 37-3021 bit base of the sequence of sequence verification as shown in SEQ ID NO.2) also together build, and then transform enter in intestinal bacteria Escherichia coli BL21 (DE3).
TALEN L and TALEN R carrier for expression of eukaryon also can use the TALEN L and TALEN R carrier for expression of eukaryon that build according to document Miller JC, et al.2011.A TALE nuclease architecture for efficient genome editing.Nat Biotechnol29:143-148.
Or the sequence of synthetic as shown in SEQ ID NO.1, by adding the mode of Ned I and BamHI restriction enzyme site before and after it respectively, being inserted in pET28a prokaryotic expression carrier, and obtaining prokaryotic expression carrier pET28a-TAT-TALEN L; And the sequence of synthetic as shown in SEQ ID NO.2, by adding the mode of Ned I and BamHI restriction enzyme site before and after it respectively, being inserted in pET28a prokaryotic expression carrier, and obtaining prokaryotic expression carrier pET28a-TAT-TALEN R.
In like manner, the 37-3021 bit base of synthetic sequence as shown in SEQ ID NO.1, by adding the mode of Ned I and BamHI restriction enzyme site before and after it respectively, then insert in pET28a prokaryotic expression carrier, and obtain prokaryotic expression carrier pET28a-TALEN L; And the 37-3021 bit base of synthetic sequence as shown in SEQ ID NO.2, by adding the mode of Ned I and BamHI restriction enzyme site before and after it respectively, insert again in pET28a prokaryotic expression carrier, and obtain prokaryotic expression carrier pET28a-TALEN R.
2, the purifying of TAT-TALEN albumen
Conversion has the Escherichia coliBL21 (DE3) of recombinant expression plasmid (pET28a-TAT-TALEN L or pET28a-TAT-TALEN R) through IPTG16 DEG C of induction of spending the night, and collects the thalline of expression TAT-TALEN L and the TAT-TALEN R albumen obtained.Obtain the supernatant of solubility after centrifugal after high pressure fragmentation, carry out Ni post affinity chromatography.After treating that target protein is combined with Ni post, first use wash buffer (20mM Tris-HCl, 500mM NaCl, 5%(v/v) glycerine, 60mM imidazoles, pH8.0) wash, use elution buffer (20mM Tris-HCl, 500mM NaCl, 5%(v/v) glycerine afterwards, 500mM imidazoles, pH8.0) wash-out.Utilize PD-10 desalting column that the high-salt buffer in elution fraction is replaced as the PBS solution containing 20% glycerine, carry out the detection (Fig. 2) of SDS-PAGE afterwards.Standard type TALEN in contrast, has also carried out the purifying under the same terms.Obtain the TAT-TALEN L of purifying, TAT-TALEN R, TALEN L and TALEN R albumen thus.
3, to the checking alive of the vitro enzyme of purified albumen
CCR5 fragment across TALEN recognition site is gone out from the genomic PCR amplification of people with primer (TCTATTTTATAGGCTTCTTCTCTGG and CAACCTGTTAGAGCTACTGCAA).Be the mixture of 1:1 with the ratio of the standard type TALENs(TALEN L of different concns and the amount of TALEN R proteic substance) and the ratio of amount of TAT-TALENs(TAT-TALENL and TAT-TALEN R proteic substance be the mixture of 1:1) in the enzyme cutting buffering liquid of NEBuffer4, process the CCR5 fragment of amplification, 37 DEG C of enzymes are cut after 1 hour and are carried out nucleic acid electrophoresis PAGE.As shown in Figure 3, as seen from Figure 3, CCR5 fragment can be cut into two bands by specific to result, and description standard type TALENs and TAT-TALENs has activity.
4, the detection of TAT-TALEN albuminous cell penetrativity
Respectively by 1.5 μMs of TALEN albumen (TALEN L or TALEN R albumen) and TAT-TALEN albumen (TAT-TALENL or TAT-TALEN R albumen), 1 hour is hatched, afterwards with 1mg/ml heparin solution washed cell and collecting cell sample carries out Western blot detection with 37 DEG C, HeLa cell.As shown in Figure 4, Fig. 4 illustrates to only have TAT-TALEN albumen to have cell penetrating properties to result.
5, the knocking out of TAT-TALEN protein on cells endogenous CCR5 gene
With the DMEM substratum without FBS, TAT-TALEN albumen (ratio of the amount of TAT-TALEN L and TAT-TALEN R proteic substance is the mixture of 1:1) is diluted, its final concentration is made to be respectively 1 μ Μ, 2 μMs, 3 μMs, hatch with 37 DEG C, HeLa cell respectively again 1 as a child after, cell culture fluid is changed to remove TAT-TALEN albumen with the DMEM perfect medium containing 10%FBS, carry out the follow-up cultivation 24 hours of 37 DEG C or 30 DEG C more respectively, in this, as the albumen process of the first round, carry out second after being disposed again and take turns albumen process, be specially the HeLa cell of follow-up cultivation after 24 hours again with different concns (1 μ Μ, 2 μMs, 3 μMs) 37 DEG C, TAT-TALEN albumen (ratio of the amount of TAT-TALEN L and TAT-TALEN R proteic substance is the mixture of 1:1) hatch 1 hour after, cell culture fluid is changed to remove TAT-TALEN albumen with the DMEM perfect medium containing 10%FBS, carry out the follow-up cultivation 24 hours of 37 DEG C or 30 DEG C more respectively.After three-wheel process, extract the genome of cell, utilize nested PCR amplification across the CCR5 fragment (Outside primer pair: AGTGTCAAGTCCAACCTATGAC and GGATCGGGTGTAAACTGAAC of TALEN recognition site; Inner primer pair: ACAATGTGTCAACTCTTGACAG and CAACCTGTTAGAGCTACTGCAA).Surveyor enzyme is cut to detect and is illustrated to only have TAT-TALEN can knock out the intracellular CCR5 gene of HeLa, and 30 DEG C of subzero treatment can significantly improve and knock out efficiency (Fig. 5).Processed HeLa cellular genome CCR5 gene creates sudden change (Fig. 6) really.(concrete steps are with HeLa cell to adopt similar method, just the substratum of dilution TAT-TALEN albumen is F12/DMEM substratum, it is different for changing cell culture fluid with mTeSR substratum, and other treatment steps are identical) also successful knockout hiPSCs endogenous CCR5 gene (Fig. 5).
Claims (5)
1. one kind can knock out the penetrating type TAT-TALEN albumen of cellular endogenous genomic dna, it is characterized in that, described cellular endogenous genomic dna is endogenous CCR5 gene, the L chain of described penetrating type TAT-TALEN albumen is by the alkali yl coding of sequence shown in SEQ ID NO.1, and the R chain of penetrating type TAT-TALEN albumen is by the alkali yl coding of sequence shown in SEQ ID NO.2.
2. the application of penetrating type TAT-TALEN albumen in preparation acquired immune deficiency syndrome (AIDS) gene therapy medicament that can knock out cellular endogenous genomic dna according to claim 1.
3. the coding nucleotide sequence that can knock out the penetrating type TAT-TALEN albumen of cellular endogenous genomic dna according to claim 1, it is characterized in that, comprise the nucleotide sequence of coding penetrating type TAT-TALEN albumen L chain and the nucleotide sequence of coding penetrating type TAT-TALEN albumen R chain.
4. the preparation method of cell that is knocked of an endogenous CCR5 gene, it is characterized in that, coding can be knocked out the nucleotide sequence of the L chain of the penetrating type TAT-TALEN albumen of endogenous cellular CCR5 gene, its nucleotide sequence is as shown in SEQID NO.1, with the nucleotide sequence of R chain, its nucleotide sequence is as shown in SEQ ID NO.2, insert respectively in prokaryotic expression carrier, then prokaryotic expression goes out to knock out L chain and the R chain of the penetrating type TAT-TALEN albumen of endogenous cellular CCR5 gene, by the L chain of penetrating type TAT-TALEN albumen and R chain with the cell incubation containing endogenous CCR5 gene to knock out CCR5 gene, thus obtain the cell that endogenous CCR5 gene is knocked.
5. preparation method according to claim 4, it is characterized in that, described hatches as the L chain of penetrating type TAT-TALEN albumen and R chain are hatched 1 hour with the cell containing CCR5 gene at 37 DEG C, cell culture fluid is changed to remove penetrating type TAT-TALEN albumen with cell culture complete medium, again 30 DEG C of cellar cultures 24 hours, mix 37 DEG C with the L chain of penetrating type TAT-TALEN albumen and R chain again and hatch 1 hour, cell culture fluid is changed to remove penetrating type TAT-TALEN albumen again with cell culture complete medium, again 30 DEG C of cellar cultures 24 hours, so repeat again once.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310124191.8A CN103255115B (en) | 2013-04-10 | 2013-04-10 | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310124191.8A CN103255115B (en) | 2013-04-10 | 2013-04-10 | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103255115A CN103255115A (en) | 2013-08-21 |
| CN103255115B true CN103255115B (en) | 2015-10-28 |
Family
ID=48959330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310124191.8A Active CN103255115B (en) | 2013-04-10 | 2013-04-10 | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103255115B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101554166B1 (en) * | 2013-11-13 | 2015-09-22 | 건국대학교 산학협력단 | Recombination activating gene 2 gene targeting vector, production of SCID-like miniature pigs by TALEN-mediated gene targeting and use thereof |
| CN104004726A (en) * | 2014-06-17 | 2014-08-27 | 覃启红 | Transmembrane type TALEN-R11 protein with fluorescent label and preparation method and application thereof |
| CN104212778A (en) * | 2014-06-26 | 2014-12-17 | 绍兴市人民医院 | TALEN and pMD18 vector-based site-directed mutagenesis system and its application |
| CN104673820B (en) * | 2015-02-13 | 2018-06-22 | 广东省微生物研究所 | A kind of TALEN carriers and its construction method suitable for sorangium cellulosum |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012047598A1 (en) * | 2010-09-27 | 2012-04-12 | Sangamo Biosciences, Inc. | Methods and compositions for inhibiting viral entry into cells |
-
2013
- 2013-04-10 CN CN201310124191.8A patent/CN103255115B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012047598A1 (en) * | 2010-09-27 | 2012-04-12 | Sangamo Biosciences, Inc. | Methods and compositions for inhibiting viral entry into cells |
Non-Patent Citations (1)
| Title |
|---|
| TAT-PTD 融合蛋白可能存在的跨膜递送作用机制;何火聪等;《中国生物化学与分子生物学报》;20060930;第22卷(第9期);第704-710页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103255115A (en) | 2013-08-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2023030067A (en) | Rna-guided nucleic acid modifying enzymes and methods of use thereof | |
| KR20190071725A (en) | RNA-guided nucleic acid modification enzymes and methods for their use | |
| CN103255115B (en) | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked | |
| Liu et al. | Oral engineered Bifidobacterium longum expressing rhMnSOD to suppress experimental colitis | |
| US9932563B2 (en) | Compositions and methods for inhibiting gene expressions | |
| KR20190089175A (en) | Compositions and methods for target nucleic acid modification | |
| Li et al. | Suppressing Erwinia carotovora pathogenicity by projecting N-acyl homoserine lactonase onto the surface of Pseudomonas putida cells | |
| CN103555756A (en) | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae | |
| CN102766610B (en) | Plant drought-resistant relevant protein PvSnRK 2.3 and encoding gene and application thereof | |
| CN114134211B (en) | Application of USP30 gene as target in inhibiting replication of Seneca Valley virus | |
| Ajji et al. | Purification and functional characterization of recombinant balsamin, a ribosome-inactivating protein from Momordica balsamina | |
| CN110563826A (en) | recombinant embryonic development later-stage abundant protein and anti-freezing solution containing same | |
| CN105154471A (en) | Preparation method of liver cells with low expression or no expression of PERV | |
| JP2016524594A (en) | Gene transfer facilitating factor Protransduzin B | |
| CN107254452A (en) | A kind of preparation and application of the anti-oxidant protease of microbial source | |
| CN102796744B (en) | Cloning of tomato antiviral protein genes | |
| CN102604906B (en) | Bombyx mori glutathione-S-transferase BmGSTD4 and genes thereof | |
| Ravin et al. | Complete sequencing of potato virus X new strain genome and construction of viral vector for production of target proteins in plants | |
| WO2015042556A1 (en) | Targeting non-coding rna for rna interference | |
| CA2948198C (en) | Tal-effector nuclease for targeted knockout of the hiv co-receptor ccr5 | |
| CN109735516A (en) | The guidance of subject nucleotide segment has the PIWI albumen of specific nucleic acid endonuclease activity | |
| CN102229958B (en) | A kind of mankind and mammalian cell expression vector and application thereof | |
| CN108148875B (en) | Gene editing system, expression vector, gene editing kit and application thereof | |
| CN117051043B (en) | Methicillin-resistant staphylococcus aureus endolysin based on cyclic RNA coding and application thereof | |
| Banerjee et al. | Reverse transcriptase activity in bovine bone marrow: purification of a 66-kDa enzyme |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |