CN103255115A - Penetrating TAT-TALEN protein, and preparation method and application of cell with knocked endogenous gene - Google Patents
Penetrating TAT-TALEN protein, and preparation method and application of cell with knocked endogenous gene Download PDFInfo
- Publication number
- CN103255115A CN103255115A CN2013101241918A CN201310124191A CN103255115A CN 103255115 A CN103255115 A CN 103255115A CN 2013101241918 A CN2013101241918 A CN 2013101241918A CN 201310124191 A CN201310124191 A CN 201310124191A CN 103255115 A CN103255115 A CN 103255115A
- Authority
- CN
- China
- Prior art keywords
- talen
- cell
- chain
- tat
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a penetrating TAT-TALEN protein and a preparation method and application of a cell with a knocked endogenous gene. The penetrating TAT-TALEN protein is characterized in that N terminals of an L chain and an R chain of the TALEN protein have cell-penetrating polypeptide TAT, and the amino acid sequence of the cell-penetrating polypeptide TAT is N terminal-TyrGlyArgLysLysArgArgGlnArgArgArg-C terminal. The penetrating TAT-TALEN protein provided by the invention can knock out the endogenous gene of a cell, especially the endogenous CCR 5 gene of the cell, so the penetrating TAT-TALEN protein can be used for knockout of the CCR 5 gene in AIDS gene therapy clinically. No exogenous gene is introduced when the penetrating TAT-TALEN protein is used for knockout of the CCR 5 gene, so the risk of insertion mutation caused by random insertion of an exogenous gene into the genome of the cell is avoided, and the TAT-TALEN protein is gradually degraded after entering into the cell and exerting an effect and does not exist in the cell all the time.
Description
Technical field:
The invention belongs to biological technical field, be specifically related to the preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene knock out.
Background technology:
Acquired immune deficiency syndrome (AIDS) (AIDS) is the communicable disease that is infected a kind of serious threat human health that causes by hiv virus (HIV).Studies show that CCR5 is the most important co-receptor of HIV invasion cell, sub-fraction crowd's the natural disappearance (CCR5 △ 32) that exists 32 bases of CCR5 gene is arranged in the world, they are difficult for being infected by HIV and can living normally.A leukemia people who has infected HIV simultaneously accepts donor hematopoietic stem cell (HSCs) bone marrow transplantation of CCR5 Δ 32/ Δ 32, stop the HAART treatment after 20 months, the bounce-back of virus does not appear, observe this patient's immunity system subsequently and successfully rebuild, As time goes on viral storage vault is also reducing.This is world's the first obtains healing by stem cell transplantation AIDS patient.But this treatment means can not widespread use, and is a little because CCR5 △ 32 homozygous people have only, and is difficult to find carry out marrow hemopoietic stem cells with CCR5 △ 32 donors of joining type and transplant.
Be that the gene targeting of representative can realize specifying the targeting of gene to knock out with activating transcription factor sample effector nuclease (TALEN).Utilize the CCR5 with wild-type that this technology namely can be artificial to sport the CCR5 of inactivation type.The stem-cell therapy strategy of acquired immune deficiency syndrome (AIDS) has namely become to utilize and is similar to TALEN this nuclease instrument and knocks out in the acquired immune deficiency syndrome (AIDS) patient body CCR5 gene in the hemopoietic stem cell and carry out autologous stem cell again and transplant.Recent studies show that, multipotency induced dry-cell (iPSCs) is because wide material sources, be easy in external long-term cultivation, and the iPSCs that has knocked out the CCR5 gene can directed differentiation becomes to have the hemopoietic stem cell of Almightiness type, can be used as a kind of alternative of obtaining CCR5 absence type hemopoietic stem cell, very promising.But no matter be the CCR5 gene that directly knocks out in the HSCs, still knock out the hemopoietic stem cell that CCR5 gene in people's the iPSCs obtains the CCR5 absence type more indirectly earlier, all need TALEN is transported to and carry out gene knockout in the cell.And existing be that carrier carries the method for TALEN might cause the intragentic insert type sudden change of cell with virus or plasmid, for clinically use and dangerous.
Summary of the invention:
First purpose of the present invention provides a kind of penetrating type TAT-TALEN albumen that can knock out cellular endogenous genomic dna.
The present invention can knock out the penetrating type TAT-TALEN albumen of cellular endogenous genomic dna, it is characterized in that, it is also to have cell-penetrating peptide T AT at the N of the L of TALEN albumen chain and R chain end, and the aminoacid sequence of described cell-penetrating peptide T AT is: N end-TyrGlyArgLysLysArgArgGlnArgArgArg-C end.
The application of above-mentioned penetrating type TAT-TALEN albumen in knocking out cellular endogenous genomic dna.
Encode the L chain of the above-mentioned penetrating type TAT-TALEN albumen that can knock out cellular endogenous genomic dna and the nucleotide sequence of R chain.
For at endogenous CCR5 gene, the L chain that can knock out the penetrating type TAT-TALEN albumen of cell endogenous CCR5 gene of the present invention is by the alkali yl coding of sequence shown in the SEQ ID NO.1, and the R chain of penetrating type TAT-TALEN albumen is by the alkali yl coding of sequence shown in the SEQ ID NO.2.This penetrating type TAT-TALEN albumen can knock out cell endogenous CCR5 gene and use in preparation acquired immune deficiency syndrome (AIDS) gene therapy medicament.
The preparation method of the cell that a kind of endogenous CCR5 gene is knocked out, it is characterized in that, insert the L chain of the above-mentioned penetrating type TAT-TALEN albumen that can knock out cell endogenous CCR5 gene of coding and the nucleotide sequence of R chain in the prokaryotic expression carrier respectively, prokaryotic expression goes out to knock out L chain and the R chain of the penetrating type TAT-TALEN albumen of cell endogenous CCR5 gene then, L chain and the R chain of penetrating type TAT-TALEN albumen are hatched to knock out the CCR5 gene with the cell that contains endogenous CCR5 gene, thereby obtain the cell that endogenous CCR5 gene is knocked out.
The described L chain and the R chain that are preferably penetrating type TAT-TALEN albumen of hatching hatched 1 hour at 37 ℃ with the cell that contains the CCR5 gene, change cell culture fluid to remove penetrating type TAT-TALEN albumen with the cell perfect medium, again 30 ℃ of conventional cultivations 24 hours, mixing 37 ℃ with the L chain of penetrating type TAT-TALEN albumen and R chain again hatched 1 hour, change cell culture fluid to remove penetrating type TAT-TALEN albumen with the cell perfect medium again, 30 ℃ of conventional cultivations 24 hours, repeat once so more again.
TALEN albumen of the present invention refers to activating transcription factor sample effector nuclease, and it comprises TALEN L chain and R chain.
Penetrating type TAT-TALEN albumen of the present invention can knock out cellular endogenous genomic dna, especially can knock out cell endogenous CCR5 gene, therefore can be applied to the CCR5 gene knockout in the acquired immune deficiency syndrome (AIDS) gene therapy clinically.Use the present invention and when the CCR5 gene is knocked out, do not introduce any foreign gene, do not have the risk that causes insert type sudden change in the genome that is inserted into cell at random, and TAT-TALEN albumen can or not be present in the cell gradually always after entering cell and playing a role by cell degradation.What this shows that the present invention can be simple and safe knocks out cell endogenous CCR5 gene, can be used as the medicine for the treatment of AIDS, is used for the gene therapy of acquired immune deficiency syndrome (AIDS).
Description of drawings
Fig. 1 is the TAT-TALEN protein structure synoptic diagram that makes up; Wherein: standard TALEN L/R: without the standard transcriptional activation increment effector nuclease of transforming; The transcriptional activation increment effector nuclease that TAT-TALEN L/R:TAT modifies; His:6 Histidine purification tag; TAT: cell-penetrating peptides TAT small peptide; NLS: nuclear localization sequence; Transcription activator-like domain: transcription activator spline structure territory; FokI:FokI nuclease structural domain.
Fig. 2 is the TALEN protein SDS-PAGE detection figure that final purifying obtains; Wherein: the L chain of TALEN L:TALEN albumen; The R chain of TALEN R:TALEN albumen; The L chain of TAT-TALEN L:TAT-TALEN albumen; The R chain of TAT-TALENR:TAT-TALEN.
Fig. 3 is that purified TALEN albumen external activity detects: wherein, and a pair of TALEN that standard TALENs:TALEN L and TALEN R constitute; The a pair of TALEN that TAT-TALENs:TAT-TALEN L and TAT-TALEN R constitute; The CCR5 fragment that comprises the TALEN recognition site of substrate:PCR amplification; The products:TALEN specific enzymes is cut the product that the CCR5 fragment obtains.
Fig. 4 is the Western blot detection to purified TALEN albumen penetration cell: wherein: pre-transduction lysate: the cell sample before hatching with albumen; Post-transduction lysate: the cell sample after hatching with albumen; TALEN L: the cell sample after hatching with TALEN L; TALEN R: the cell sample after hatching with TALEN R; TAT-TALEN L: the cell sample after hatching with TAT-TALEN L; TAT-TALEN R: the cell sample after hatching with TAT-TALEN R; GAPDH: confidential reference items glyceraldehyde-3-phosphate dehydrogenase.
Fig. 5 is that TALEN or TAT-TALEN albumen and Hela cell and hiPSCs cell are hatched the back cell endogenous CCR5 gene is cut detected result by the Surveyor enzyme of the situation of knocking out.
Fig. 6 is the sequencing result comparison of the HeLa cellular genome CCR5 after TAT-TALEN albumen is handled: wherein: WT: the CCR5 sequence of wild-type; Cell carries out the nucleotide deletion that DNA repairs introducing behind the Deletions:TAT-TALEN cutting target sequence; Cell carries out the Nucleotide insertion that DNA repairs introducing behind the Insertions:TAT-TALEN cutting target sequence.
Embodiment
For making the present invention easier to understand, below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these examples only to be used for explanation the present invention and be not used in and limit the scope of the invention.
Embodiment 1: utilize penetrating type TAT-TALEN albumen to knock out HeLa cell and hiPSCs cell endogenous CCR5 gene.
Standard type TALEN and TAT-TALEN construction of prokaryotic expression vector (Fig. 1):
1, CCR5 specificity T ALEN construction of prokaryotic expression vector.
The encoding sequence of the L chain of the TALEN sequence of present embodiment (TALEN L) is shown in the 37-3021 bit base of SEQ ID NO.1, and the encoding sequence of the R chain of TALEN sequence (TALEN R) is shown in the 37-3021 bit base of SEQ ID NO.2.The encoding sequence of the L chain of the TAT-TALEN sequence of present embodiment (TAT-TALEN L) is shown in SEQ ID NO.1, the encoding sequence of the R chain of TAT-TALEN sequence (TAT-TALEN R) is shown in SEQ ID NO.2, it is the encoding sequence that has added cell-penetrating peptide T AT at 5 ' end of TALEN sequence, and its sequence is shown in the 4-36 bit base of SEQ ID NO.1 or 2.The TALEN L of the target CCR5 that present embodiment is used and TALEN R all contain 17 repeating units, and (TALEN L identifies TCATTACACCTGCAGCT to 17 Nucleotide in respectively can specific recognition CCR5 gene; TALEN R identifies CTTCCAGAATTGATACT), wherein HD identifies C, and NI identifies A, and NG identifies T, and NN identifies G.
Reference: the encoding sequence of the L chain of the TALEN sequence shown in the 37-3021 bit base of SEQ ID NO.1 (TALEN L), encoding sequence with the R chain (TALEN R) of TALEN sequence shown in the 37-3021 bit base of SEQ ID NO.2 adopts GoldenGate plasmid construction from part to make up TALEN(TALEN L or TALEN R) eukaryotic vector.
A) each mode bearer (each 150ng)+pFUS_B carrier (150ng) of each mode bearer of 1-10 repeating unit (each 150ng)+pFUS_A carrier (150ng) or 11-16 repeating unit
B) Bsal enzyme (1 μ l)
C) T-4DNA ligase enzyme (1 μ l)
D) 10 * T4DNA ligase enzyme damping fluid (2 μ l)
E) make up water to 20 μ l
Reaction conditions: 10 * (37 ℃/5min+16 ℃/10min)+50 ℃/5min+80 ℃/5min.
Add a) 10mM ATP; B) Plasmid-Safe nuclease (1 μ l)
Hatched 1 hour under 37 ℃ of conditions.Product is transformed in the TOP-10 competence bacterial strain, containing the 10mg/L tsiklomitsin, the 50mg/L spectinomycin, the 50mg/L penbritin, 40mg/L X-gal, pick out white mono-clonal in the LB flat board of the IPTG of 24mg/L, extract plasmid after the enlarged culturing, obtain to contain the pFUS_A plasmid (carrier A) of 1-10 repeating unit and the pFUS_B plasmid (carrier B) of 11-16 repeating unit respectively.
A) carrier A and carrier B (each 150ng)
B) pLR carrier (150ng) comprises the 17th repeating unit
C) skeleton carrier pTAL(75ng)
D) Esp3I enzyme (1 μ l)
E) T-4DNA ligase enzyme (1 μ l)
F) 10 * T4DNA ligase enzyme damping fluid (2 μ l)
G) make up water to 20 μ l
Reaction conditions: 10 * (37 ℃/5min+16 ℃/10min)+37 ℃/15min+80 ℃/5min
Product is transformed in the TOP-10 competence bacterial strain, containing the 50mg/L penbritin, select white mono-clonal bacterium colony in the LB flat board of 40mg/L X-gal and 24mg/LIPTG, extract the pTAL plasmid that contains total length TALEN after the enlarged culturing, be TALEN L and the TALEN R carrier for expression of eukaryon of final acquisition.
Utilizing the method for pcr amplification from above-mentioned TALEN(TALEN L or TALEN R) to amplify TALEN(the carrier for expression of eukaryon be that template then amplifies TALEN L chain with TALEN L carrier for expression of eukaryon, being that template then amplifies TALEN R chain with TALEN R carrier for expression of eukaryon) (primer: GGAATTCCATATGGCTCCAAAGAAGAAGCG and CCCAAGCTTTTAAAAGTTTATCTCGCCGTTAT) and TAT-TALEN(be that template then amplifies TAT-TALEN L chain with TALEN L carrier for expression of eukaryon, be that template then amplifies TAT-TALEN R chain with TALEN R carrier for expression of eukaryon) (primer: GGAATTCCATATGTACGGTCGTAAAAAACGTCGTCAGCGTCGTCGTATGGCTCCAA AGAAGAAGCG and CCCAAGCTTTTAAAAGTTTATCTCGCCGTTAT), be cloned on the pET28a prokaryotic expression carrier with NedI and BamHI double digestion.The final prokaryotic expression carrier pET28a-TAT-TALEN L(that obtains TAT-TALEN L and TAT-TALENR has inserted in the pET28a prokaryotic expression carrier through the sequence of sequence verification shown in SEQ ID NO.1) and pET28a-TAT-TALEN R(inserted in the pET28a prokaryotic expression carrier through the sequence of sequence verification shown in SEQ ID NO.2) (Fig. 1).In contrast, standard type TAELN L and TALEN R prokaryotic expression carrier pET28a-TALEN L(have inserted in the pET28a prokaryotic expression carrier through the 37-3021 bit base of the sequence of sequence verification shown in SEQ ID NO.1) and pET28a-TALEN R(inserted in the pET28a prokaryotic expression carrier through the 37-3021 bit base of the sequence of sequence verification shown in SEQ ID NO.2) also together make up, and then transform and enter among the intestinal bacteria Escherichia coli BL21 (DE3).
TALEN L and TALEN R carrier for expression of eukaryon also can use the JC according to document Miller, TALEN L and TALEN R carrier for expression of eukaryon that et al.2011.A TALE nuclease architecture for efficient genome editing.Nat Biotechnol29:143-148 makes up.
Perhaps the sequence of synthetic shown in SEQ ID NO.1 can be inserted in the pET28a prokaryotic expression carrier, and obtain prokaryotic expression carrier pET28a-TAT-TALEN L by add the mode of Ned I and BamHI restriction enzyme site respectively before and after it; And the sequence of synthetic shown in SEQ ID NO.2, can be inserted in the pET28a prokaryotic expression carrier, and obtain prokaryotic expression carrier pET28a-TAT-TALEN R by before and after it, adding the mode of Ned I and BamHI restriction enzyme site respectively.
In like manner, the 37-3021 bit base of synthetic sequence shown in SEQ ID NO.1, can insert again in the pET28a prokaryotic expression carrier, and obtain prokaryotic expression carrier pET28a-TALEN L by before and after it, adding the mode of Ned I and BamHI restriction enzyme site respectively; And the 37-3021 bit base of synthetic sequence shown in SEQ ID NO.2, can be by before and after it, adding the mode of Ned I and BamHI restriction enzyme site respectively, insert again in the pET28a prokaryotic expression carrier, and obtain prokaryotic expression carrier pET28a-TALEN R.
2, the purifying of TAT-TALEN albumen
Conversion has the Escherichia coliBL21 (DE3) of recombinant expression plasmid (pET28a-TAT-TALEN L or pET28a-TAT-TALEN R) to spend the night through IPTG16 ℃ to induce, and collects the thalline of resulting expression TAT-TALEN L and TAT-TALEN R albumen.Supernatant through centrifugal back after the high pressure fragmentation obtains solubility carries out Ni post affinity chromatography.Treat that target protein is after the Ni post is combined, earlier with rinsing damping fluid (20mM Tris-HCl, 500mM NaCl, 5%(v/v) glycerine, 60mM imidazoles, pH8.0) washing, use elution buffer (20mM Tris-HCl, 500mM NaCl, 5%(v/v) glycerine afterwards, 500mM imidazoles, pH8.0) wash-out.Utilize the PD-10 desalting column that the high-salt buffer in the elution fraction is replaced as the PBS solution that contains 20% glycerine, carry out the detection (Fig. 2) of SDS-PAGE afterwards.Standard type TALEN has also carried out the purifying under the same terms in contrast.Obtain TAT-TALEN L, TAT-TALEN R, TALEN L and the TALEN R albumen of purifying thus.
3, to the checking alive of the vitro enzyme of purified albumen
Go out to stride the CCR5 fragment of TALEN recognition site from people's genome pcr amplification with primer (TCTATTTTATAGGCTTCTTCTCTGG and CAACCTGTTAGAGCTACTGCAA).Ratio with the amount of the standard type TALENs(TALEN L of different concns and TALEN R proteic substance is the mixture of 1:1) and the ratio of the amount of TAT-TALENs(TAT-TALENL and TAT-TALEN R proteic substance be the mixture of 1:1) in the enzyme cutting buffering liquid of NEBuffer4, handle the CCR5 fragment of amplification, 37 ℃ of enzymes are cut after 1 hour and are carried out nucleic acid electrophoresis PAGE.The result as shown in Figure 3, as seen from Figure 3, the CCR5 fragment can be by specific two bands that cut into, description standard type TALENs and TAT-TALENs have activity.
4, the detection of TAT-TALEN albuminous cell penetrativity
Respectively with 1.5 μ M TALEN albumen (TALEN L or TALEN R albumen) and TAT-TALEN albumen (TAT-TALENL or TAT-TALEN R albumen), hatched 1 hour with 37 ℃ in HeLa cell, carry out Western blot with 1mg/ml heparin solution washed cell and collecting cell sample afterwards and detect.The result as shown in Figure 4, Fig. 4 explanation has only TAT-TALEN albumen to have cell-penetrating character.
5, TAT-TALEN albumen knocking out cell endogenous CCR5 gene
DMEM substratum with no FBS dilutes TAT-TALEN albumen (ratio of the amount of TAT-TALEN L and TAT-TALEN R proteic substance is the mixture of 1:1), make its final concentration be respectively 1 μ Μ, 2 μ M, 3 μ M, again respectively with 37 ℃ in HeLa cell hatch 1 as a child after, change cell culture fluid to remove TAT-TALEN albumen with the DMEM perfect medium that contains 10%FBS, carry out the follow-up cultivation 24 hours of 37 ℃ or 30 ℃ more respectively, handle with this albumen as the first round, carry out second after disposing again and take turns the albumen processing, be specially the HeLa cell of follow-up cultivation after 24 hours again with different concns (1 μ Μ, 2 μ M, 3 μ M) after 37 ℃ in TAT-TALEN albumen (ratio of the amount of TAT-TALEN L and TAT-TALEN R proteic substance is the mixture of 1:1) is hatched 1 hour, change cell culture fluid to remove TAT-TALEN albumen with the DMEM perfect medium that contains 10%FBS, carry out the follow-up cultivation 24 hours of 37 ℃ or 30 ℃ more respectively.After the three-wheel processing, extract the genome of cell, (outside primer is right: AGTGTCAAGTCCAACCTATGAC and GGATCGGGTGTAAACTGAAC for the CCR5 fragment of striding the TALEN recognition site to utilize nest-type PRC to increase; Inboard primer is right: ACAATGTGTCAACTCTTGACAG and CAACCTGTTAGAGCTACTGCAA).The Surveyor enzyme is cut and is detected explanation, has only TAT-TALEN can knock out the intracellular CCR5 gene of HeLa, and 30 ℃ of subzero treatment can significantly improve and knock out efficient (Fig. 5).Processed HeLa cellular genome CCR5 gene has produced sudden change (Fig. 6) really.(concrete steps are with the HeLa cell to adopt similar method, the substratum that just dilutes TAT-TALEN albumen is the F12/DMEM substratum, it is different changing cell culture fluid with the mTeSR substratum, and other treatment steps are identical) also successfully knocked out hiPSCs endogenous CCR5 gene (Fig. 5).
Claims (7)
1. penetrating type TAT-TALEN albumen that can knock out cellular endogenous genomic dna, it is characterized in that, it is also to have cell-penetrating peptide T AT at the N of the L of TALEN albumen chain and R chain end, and the aminoacid sequence of described cell-penetrating peptide T AT is: N end-TyrGlyArgLysLysArgArgGlnArgArgArg-C end.
2. penetrating type TAT-TALEN albumen according to claim 1, it is characterized in that, described cellular endogenous genomic dna is endogenous CCR5 gene, the L chain of described penetrating type TAT-TALEN albumen is by the alkali yl coding of sequence shown in the SEQ ID NO.1, and the R chain of penetrating type TAT-TALEN albumen is by the alkali yl coding of sequence shown in the SEQ ID NO.2.
3. the described penetrating type TAT-TALEN of claim 2 albumen knocks out the application of cell endogenous CCR5 gene in preparation acquired immune deficiency syndrome (AIDS) gene therapy medicament.
4. the application of the described penetrating type TAT-TALEN of claim 1 albumen in knocking out cellular endogenous genomic dna.
5. the L chain of the described penetrating type TAT-TALEN albumen that can knock out cellular endogenous genomic dna of coding claim 1 and the nucleotide sequence of R chain.
6. the preparation method of the cell that knocked out of an endogenous CCR5 gene, it is characterized in that, the nucleotide sequence of the L chain of the penetrating type TAT-TALEN albumen that can knock out cell endogenous CCR5 gene with encoding, its nucleotide sequence is shown in SEQID NO.1, nucleotide sequence with the R chain, its nucleotide sequence is shown in SEQ ID NO.2, insert in the prokaryotic expression carrier respectively, prokaryotic expression goes out to knock out L chain and the R chain of the penetrating type TAT-TALEN albumen of cell endogenous CCR5 gene then, L chain and the R chain of penetrating type TAT-TALEN albumen are hatched to knock out the CCR5 gene with the cell that contains endogenous CCR5 gene, thereby obtain the cell that endogenous CCR5 gene is knocked out.
7. preparation method according to claim 6, it is characterized in that, described hatching to L chain and the R chain of penetrating type TAT-TALEN albumen were hatched 1 hour at 37 ℃ with the cell that contains the CCR5 gene, change cell culture fluid to remove penetrating type TAT-TALEN albumen with the cell perfect medium, again 30 ℃ of conventional cultivations 24 hours, mixing 37 ℃ with the L chain of penetrating type TAT-TALEN albumen and R chain again hatched 1 hour, change cell culture fluid to remove penetrating type TAT-TALEN albumen with the cell perfect medium again, 30 ℃ of conventional cultivations 24 hours, repeat once so more again.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310124191.8A CN103255115B (en) | 2013-04-10 | 2013-04-10 | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310124191.8A CN103255115B (en) | 2013-04-10 | 2013-04-10 | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103255115A true CN103255115A (en) | 2013-08-21 |
| CN103255115B CN103255115B (en) | 2015-10-28 |
Family
ID=48959330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310124191.8A Active CN103255115B (en) | 2013-04-10 | 2013-04-10 | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103255115B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004726A (en) * | 2014-06-17 | 2014-08-27 | 覃启红 | Transmembrane type TALEN-R11 protein with fluorescent label and preparation method and application thereof |
| CN104212778A (en) * | 2014-06-26 | 2014-12-17 | 绍兴市人民医院 | TALEN and pMD18 vector-based site-directed mutagenesis system and its application |
| CN104673820A (en) * | 2015-02-13 | 2015-06-03 | 广东省微生物研究所 | Novel TALEN carrier suitable for sorangium cellulosum and construction method of novel TALEN carrier |
| CN105813456A (en) * | 2013-11-13 | 2016-07-27 | 建国大学校产业学校协力团 | Recombination activating gene 2 gene targeting vector, production of scid-like miniature pigs by talen-mediated gene targeting and use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012047598A1 (en) * | 2010-09-27 | 2012-04-12 | Sangamo Biosciences, Inc. | Methods and compositions for inhibiting viral entry into cells |
-
2013
- 2013-04-10 CN CN201310124191.8A patent/CN103255115B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012047598A1 (en) * | 2010-09-27 | 2012-04-12 | Sangamo Biosciences, Inc. | Methods and compositions for inhibiting viral entry into cells |
Non-Patent Citations (1)
| Title |
|---|
| 何火聪等: "TAT-PTD 融合蛋白可能存在的跨膜递送作用机制", 《中国生物化学与分子生物学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105813456A (en) * | 2013-11-13 | 2016-07-27 | 建国大学校产业学校协力团 | Recombination activating gene 2 gene targeting vector, production of scid-like miniature pigs by talen-mediated gene targeting and use thereof |
| CN105813456B (en) * | 2013-11-13 | 2019-05-28 | 建国大学校产业学校协力团 | The cell of production method and the diallele mutation of SCID sample miniature pig |
| CN104004726A (en) * | 2014-06-17 | 2014-08-27 | 覃启红 | Transmembrane type TALEN-R11 protein with fluorescent label and preparation method and application thereof |
| CN104212778A (en) * | 2014-06-26 | 2014-12-17 | 绍兴市人民医院 | TALEN and pMD18 vector-based site-directed mutagenesis system and its application |
| CN104673820A (en) * | 2015-02-13 | 2015-06-03 | 广东省微生物研究所 | Novel TALEN carrier suitable for sorangium cellulosum and construction method of novel TALEN carrier |
| CN104673820B (en) * | 2015-02-13 | 2018-06-22 | 广东省微生物研究所 | A kind of TALEN carriers and its construction method suitable for sorangium cellulosum |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103255115B (en) | 2015-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7306696B2 (en) | RNA-guided nucleic acid-modifying enzyme and method of use thereof | |
| KR20190071725A (en) | RNA-guided nucleic acid modification enzymes and methods for their use | |
| CN102199196B (en) | Gene engineering antibacterial peptide and preparation method and application thereof | |
| CN103255115B (en) | The preparation method and application of the cell that a kind of penetrating type TAT-TALEN albumen and endogenous gene are knocked | |
| Qin et al. | Identification of candidates for cyclotide biosynthesis and cyclisation by expressed sequence tag analysis of Oldenlandia affinis | |
| US20160194613A1 (en) | Compositions and methods for inhibiting gene expressions | |
| AR067425A1 (en) | IMMUNOGENIC FORMULATION, BECAUSE IT INCLUDES A DAMAGED RECOMBINING CEPA OF MYCOBACTERIUM, PREFERENTLY THE RECOMBINENT CEPA BACILO DE CALMETTE AND GUERIN (BCG), WHICH EXPRESSES AT LEAST ONE IMMUNOGENATORY PROTEIN OR FRAGMENT OF THE VIRUS IN HIS SOLVIRU IN ONE SINGLE SALE | |
| CN103555756A (en) | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae | |
| CN102311500B (en) | Antiviral fusion protein and application thereof | |
| CN103088050B (en) | Mature human beta-defensin-2 (HBD-2) and preparation method thereof | |
| WO2016130024A1 (en) | Endolysin expression platform | |
| CN102731658B (en) | Tat PTD-Endostatin recombination protein, preparation method and application thereof | |
| CN110563826B (en) | Recombinant embryonic development later-stage abundant protein and anti-freezing solution containing same | |
| CN117384267A (en) | Exopalaemon carinicauda antibacterial peptide, encoding gene EcCrustin, recombinant strain and application thereof | |
| CN101967469B (en) | Production and application of high stability recombinant trypsin | |
| Ajji et al. | Purification and functional characterization of recombinant balsamin, a ribosome-inactivating protein from Momordica balsamina | |
| JP6667432B2 (en) | Gene transfer promoting factor Protransduzin B | |
| CN103848914A (en) | Bufrudin polypeptide with anticoagulant activity and preparation method and purpose thereof | |
| CN102094024A (en) | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application | |
| CN103484487B (en) | A kind of small cabbage moth N,O-Diacetylmuramidase II and preparation method thereof and application | |
| CN102021161A (en) | Preparation method for bacteriophage lyase of streptococcus pneumonia | |
| CN102604906A (en) | Bombyx mori glutathione-S-transferase BmGSTD4 and genes thereof | |
| CN105732792A (en) | Yeast expressed chicken Cathelicidin antibacterial peptide as well as preparation method and application thereof | |
| CN101892252B (en) | Gene for encoding muramidase and application of same | |
| CN108148875B (en) | Gene editing system, expression vector, gene editing kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |