CN105165174B - A kind of method for detecting wheat Growth habit and photoperiod characteristic - Google Patents
A kind of method for detecting wheat Growth habit and photoperiod characteristic Download PDFInfo
- Publication number
- CN105165174B CN105165174B CN201510481368.9A CN201510481368A CN105165174B CN 105165174 B CN105165174 B CN 105165174B CN 201510481368 A CN201510481368 A CN 201510481368A CN 105165174 B CN105165174 B CN 105165174B
- Authority
- CN
- China
- Prior art keywords
- wheat
- measured
- vernalization
- days
- seeds
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Pretreatment Of Seeds And Plants (AREA)
Abstract
The invention discloses a kind of method for detecting wheat Growth habit and photoperiod characteristic.The invention provides a kind of method for detecting or aiding in detection wheat Growth habit, comprise the following steps：1) vernalization is conducted batch-wise 0 day in seed to be measured and vernalization is handled for 60 days, obtain 60 days seeds of 0 day seed of wheat vernalization to be measured and wheat vernalization to be measured；2) 60 days seeds of 0 day seed of wheat vernalization to be measured and the wheat vernalization to be measured are transplanted and cultivated successively respectively, 60 days seeds of 0 day seed of the wheat vernalization to be measured and the wheat vernalization to be measured are detected respectively from transplanting to the time spent is opened, and wheat Growth habit to be measured is determined from transplanting to the time spent is opened according to different vernalization time wheat seeds.The inventive method is easier, laborsaving, and accuracy rate is high, can be provided for breeder simply, reliably aid in detection means, raising breeding efficiency.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of method for detecting wheat Growth habit and photoperiod characteristic.
Background technology
For wheat as one of most important cereal crops in the world, its is most basic to be characterized in its extensive adaptability, origin
Wheat in Middle East has been distributed to world's most area.The wheat breed difference planted under the conditions of various Different climates
With specific environmental suitability, wherein vernalization and photoperiod characteristic is that have conclusive hair to Different climate condition adaptability
Educate characteristic.And Climate Fluctuations aggravate in recent years, the stability of Crop development is disturbed, grain-production is greatly affected.Wheat
There is notable difference in the stability of " reproductive phenology ", and vernalization characteristic and photoperiodical reaction etc. are then to influence to be somebody's turn to do " life between kind
Grow phenology " character of stability.
Since vernalization theory being proposed from the former Russian scholar Li Senke early 20th century (Lysenko), its relevant vernalization one
It is directly the focus that botanists study, in recent years, due to the complexity of wheat vernalization reaction and the diversity of reaction type, state
Inside and outside scholar has carried out substantial amounts of research with level to wheat vernalization characteristic from different perspectives.At present, wheat Growth habit identification has
Identify and 2 kinds of molecular markers for identification in crop field.The crop field authentication method of wheat breed Growth habit：The seedling phase in seedling stage is looked first at, typically
Think that seedling stage crawls, partly crawled or upright seedling can mutually think that the kind be winter habit, semi-winterness or spring habit respectively, next from stand up,
Jointing, from the point of view of earing, opening the time spent, early person is spring habit, and late person is winter habit.In being identified in crop field, it is believed that take interval sowing
Method identification Winter-Spring performance accurately reflects the Growth habit of kind, specifically can refer to《New variety of plant specificity, uniformity
With stability test guide-common wheat》The authentication method of (national standard, GB/T19557.3-2004).
Because the field test of wheat Growth habit is easily influenceed by environment and human factor and photoperiodical reaction, qualification result
With certain error and relatively time consuming laborious, the cycle is longer.With the development of molecular biology, different kinds of molecules indicia meanses quilt
For in the research of wheat vernalization gene.The scholar initially having be thought that winter habit to spring habit to be dominant, and later many scholars
It is substantially dominant conclusion to winter habit all to draw spring habit.Current research shows that at least 5 gene control wheat vernalizations are made
With, name in early days and also develop corresponding mark for Vrn1, Vrn2, Vrn3, Vrn4 and Vrn5, major part and be used to put into practice, but often
Normal single method exist identification it is inaccurate, it is necessary to 2 combine could more accurate identification of species Growth habit.
Reaction of the wheat to illumination can be divided into three blunt type, medium sharpening style and responsive type types.Photoperiodical reaction master
To be controlled by 3 homeologous genes, i.e., Ppd-D1, Ppd-B1 and Ppd-A1 (named respectively in the past as Ppdl, Ppd2 and
Ppd3), it is located in respectively on wheat the second chromosome 2D, 2B and 2A the short arm of a chromosome, mark of correlation has also been developed.But for
The identification of Growth habit, photoperiodical reaction also is difficult to carry out simultaneously, and current identification is generally respectively according to respective Markers for Detection
As a result crop field performance data judging is combined, it is bothersome, take a lot of work.Therefore, a kind of simple, quick wheat Growth habit and photoperiod are established
Reaction authentication method is particularly important.
The content of the invention
It is an object of the present invention to provide a kind of method for detecting or aiding in detection wheat Growth habit.
Method provided by the invention, comprises the following steps：
1) vernalization is conducted batch-wise 0 day in seed to be measured and vernalization is handled for 60 days, obtained 0 day seed of wheat vernalization to be measured and treat
Survey 60 days seeds of wheat vernalization；
2) 60 days seeds of 0 day seed of wheat vernalization to be measured and the wheat vernalization to be measured are transplanted successively respectively
And cultivation, 60 days seeds of 0 day seed of the wheat vernalization to be measured and the wheat vernalization to be measured are detected respectively from transplanting to blooming
Time, determine wheat Growth habit to be measured from transplanting to opening the time spent according to different vernalization time wheat seeds.
It is described to determine wheat to be measured from transplanting to the time spent is opened according to different vernalization time wheat seeds in the above method
Growth habit is as follows：
If 60 days seeds of the wheat vernalization to be measured are with 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Difference is less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If 60 days seeds of the wheat vernalization to be measured are with 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Difference is more than 7, then wheat to be measured is or candidate is winter habit wheat.
It is described to determine wheat to be measured from transplanting to the time spent is opened according to different vernalization time wheat seeds in the above method
Growth habit is as follows：
If 60 days seeds of the wheat vernalization to be measured are with 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Difference is less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If 60 days seeds of the wheat vernalization to be measured are transplanted to the difference for number of days of blooming with 0 day seed of wheat vernalization to be measured
Value is more than 7 and less than or equal to 13, then wheat to be measured is or candidate is Semi-winter wheat；
If 60 days seeds of the wheat vernalization to be measured are transplanted to the difference for number of days of blooming with 0 day seed of wheat vernalization to be measured
Value is more than 13 and less than or equal to 19, then wheat to be measured is or candidate is winter habit wheat；
If 60 days seeds of the wheat vernalization to be measured are transplanted to the difference for number of days of blooming with 0 day seed of wheat vernalization to be measured
Value is more than 19, then wheat to be measured is or candidate is strong winter habit wheat.
In the above method, before step 1), also comprise the following steps：It will be sprouted within 2 days before every batch of seed vernalization to be measured
Processing.
In the above method, the temperature of the vernalization is 3 DEG C.
It is a further object to provide a kind of side detected or aid in detection wheat Growth habit and photoperiod characteristic
Method.
Method provided by the invention, comprises the following steps：
1) vernalization is conducted batch-wise 0 day in seed to be measured and vernalization is handled for 60 days, obtained 0 day seed of wheat vernalization to be measured and treat
Survey 60 days seeds of wheat vernalization；
2) 60 days seeds of 0 day seed of wheat vernalization to be measured and the wheat vernalization to be measured are transplanted successively respectively
And cultivation, 60 days seeds of 0 day seed of the wheat vernalization to be measured and the wheat vernalization to be measured are detected respectively from transplanting to blooming
Time, determine wheat Growth habit to be measured and photoperiod from transplanting to opening the time spent according to different vernalization time wheat seeds.
In the above method,
It is described to determine wheat Growth habit and light to be measured from transplanting to the time spent is opened according to different vernalization time wheat seeds
Cycle is as follows：
If 60 days seeds of the wheat vernalization to be measured are with 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Difference is less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If 60 days seeds of the wheat vernalization to be measured are with 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Difference is more than 7, then wheat to be measured is or candidate is winter habit wheat.
If from transplanting to number of days of blooming less than or equal to 63, wheat to be measured is or candidate 60 days kinds of the wheat vernalization to be measured
For the blunt type wheat of light；
If 60 days kinds of the wheat vernalization to be measured are from transplanting to number of days of blooming more than 63, wheat to be measured is or candidate is light
Quick type wheat.
In the above method,
It is described to determine wheat Growth habit and light to be measured from transplanting to the time spent is opened according to different vernalization time wheat seeds
Cycle is as follows：
If 60 days seeds of the wheat vernalization to be measured are with 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Difference is less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If 60 days seeds of the wheat vernalization to be measured are transplanted to the difference for number of days of blooming with 0 day seed of wheat vernalization to be measured
Value is more than 7 and less than or equal to 13, then wheat to be measured is or candidate is Semi-winter wheat；
If 60 days seeds of the wheat vernalization to be measured are transplanted to the difference for number of days of blooming with 0 day seed of wheat vernalization to be measured
Value is more than 13 and less than or equal to 19, then wheat to be measured is or candidate is winter habit wheat；
If 60 days seeds of the wheat vernalization to be measured are transplanted to the difference for number of days of blooming with 0 day seed of wheat vernalization to be measured
Value is more than 19, then wheat to be measured is or candidate is strong winter habit wheat；
If from transplanting to number of days of blooming less than or equal to 63, wheat to be measured is or candidate 60 days kinds of the wheat vernalization to be measured
For the blunt type wheat of light；
If 60 days kinds of the wheat vernalization to be measured are from transplanting to number of days of blooming more than 63, wheat to be measured is or candidate is light
Quick type wheat.
In the above method, before step 1), also comprise the following steps：It will be sprouted within 2 days before every batch of seed vernalization to be measured
Processing.
In the above method, the temperature of the vernalization is 3 DEG C.
The experiment proves that the present invention is handled for 0 day for 60 days by the way that seed to be measured is conducted batch-wise into vernalization with vernalization, more
Different vernalization time wheat seeds are added to determine wheat Growth habit to be measured and photoperiod from transplanting to the time spent is opened；Relative to tradition
Growth habit and photoperiod characteristic detecting method, the present invention is easier, laborsaving, and accuracy rate is high, and letter can be provided for breeder
Easily, detection means is reliably aided in, improves breeding efficiency.
Brief description of the drawings
Fig. 1 is that the crop field of interval sowing material shows.
Fig. 2 is that Ppd-D1a marks detection part material electrophoretogram.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.
Winter habit wheat be temperature at 0~5 DEG C, experience more than or equal to vernalization in 15 days wheat；
Late frost damage be temperature at 0~5 DEG C, experience less than time vernalization in 15 day wheat.
Wherein, winter habit wheat is divided into strong winter habit wheat and Semi-winter wheat again
Strong winter habit wheat be temperature at 0~5 DEG C, wheat of the experience more than or equal to vernalization in 30 days；
Semi-winter wheat be temperature at 0~5 DEG C, experience more than or equal to 15 days and less than vernalization in 30 days wheat；
The blunt type wheat of light refers to the wheat that Wheat Development process is not influenceed by light application time and intensity of illumination；
Photosensitive wheat refers to the wheat that Wheat Development process is influenceed by light application time and intensity of illumination.
The method of embodiment 1, detection wheat Growth habit and photoperiod characteristic determines
First, the establishment of the inventive method
Test material：Taishan No.1, Jinan 13, Jinan 16, Jinan 17, Pseudomonas Jinanensis Cell Wall, Jimai 20, Jimai 21, Jimai 22, river in Shangdong Province
Agriculture 14, river in Shangdong Province agriculture 19,20104188, Shandong original 502, R502 without awns -2, safe agriculture 18, safe agriculture 9236, mountain agriculture 17, mountain agriculture 20, mountain agriculture 22,
Mountain agriculture spoke 63, LS6109, SH5099, SN055849, SN056035, SN086218, Shandong wheat 14, Shandong wheat 21, tobacco grower 19, tobacco grower
25th, tobacco grower 321, cigarette 5158, tobacco grower 5286, continent member 9369,11 mirror 142, mountain agriculture 6343, AR132, agricultural university 3743, agricultural university 3753,
Agricultural university 3744, agricultural university 3588, the small 13-1-1 that lays down, Jagger, Ji Shi 02-1, Ji are glutinous 200, Henan wheat 34, Bai Nuomai, Sumai 3, Chongqing
Wheat 0926, continuous wheat 37, WHEAR, etc. 49 kinds (being).
Test method：Each kind selects the seed 60 of full seed, uniformity, is divided into 3 equal portions (20 every part),
Culture dish is put into, sprouts (soak seed under room temperature condition in water) respectively 2 days, obtain wheat seed after 3 batch processings；
After wheat seed after 3 batch processings is respectively placed at 3 DEG C of refrigerator into vernalization 60,30 and 0 days, crop field is transplanted on the same day,
3rd batch of wheat to be measured first vernalized seed, wheat second batch vernalized seed to be measured, wheat to be measured vernalized seed are counted from shifting
Plant to opening the time spent.
Continuous 2 years of above-mentioned experiment is carried out, and is sprouted, vernalization, transplanting treatment schedule is (respectively in 2012-2013,2013-
2014 years carried out 2 repetitions) it is as follows：
First vernalization treatment time：December 14 sprouted, 20 vernalization 60 days on December 16-2 month；
The second batch vernalization treatment time：January 18 sprouted, 20 vernalization 30 days on January 20-2 month；
3rd batch of vernalization treatment time：Sprout within 18 days 2 months, 20 vernalization 0 day in 20 days 2 months -2 months；
21 days 2 months, 3 batch of materials transplanting crop field.
Each batch seed is counted from transplanting to the time spent is opened and calculates second batch and first transplanting to number of days of blooming
Difference, the 3rd batch transplanted with the difference of first transplanting to number of days of blooming, the 3rd batch with second batch to the difference for number of days of blooming, tie
Fruit is shown in Table 1, it can be seen that and it is most short for mountain agriculture radiation 63 from transplanting to number of days of blooming after first vernalization 60 days, be only
56 days；It is most long for Jagger, up to 69 days, average out to 62 days.It is most short from transplanting to number of days of blooming after second batch vernalization 30 days
It it is 59 days for mountain agriculture radiation 63；It is most long for mountain agriculture 6343, up to 77 days, average out to 66 days；After the 3rd batch of vernalization 0 day, from transplanting
It is most short to radiate 63 for mountain agriculture to number of days of blooming, it is 66 days；It is most long for mountain agriculture 6343, up to 84 days, average out to 72 days.It can be seen that the spring
The change time is longer, shorter to number of days of blooming from transplanting.Therefore, with reference to 3 batches of transplantings to blooming number of days difference and field for many years is educated
Kind experience, sums up the standard for judging Growth habit and photoperiodical reaction.
Judge the standard of Growth habit：
3rd batch is transplanted to the difference for number of days of blooming with first：≤7：Spring habit
7<3rd batch is transplanted to difference≤13 for number of days of blooming with first：Semi-winterness
13<3rd batch is transplanted to difference >=19 for number of days of blooming with first：Winter habit
3rd batch is transplanted to the difference for number of days of blooming with first>19：Strong winter habit
Judge the blunt type of light and Photosensitive reaction criterion：
First is transplanted to number of days≤63 of blooming：The blunt type of light
First is transplanted to number of days ＞ 63 of blooming：Photosensitive.
By above-mentioned standard, the spring winter habit and/or the blunt type of light sensitivity light of kind to be measured are judged, it is as a result also as shown in table 1.
The transplanting of the statistics of table 1 is to the number of days bloomed and transplants to number of days difference and the judgement conclusion of blooming
Therefore, can be by detecting wheat to be measured first vernalized seed, wheat second batch vernalized seed to be measured, to be measured small
The 3rd batch of vernalized seed of wheat is from transplanting to the time spent is opened, according to different batches wheat vernalization seed from transplanting to the time spent is opened
Determine wheat Growth habit, Photosensitive or the blunt type of light to be measured.
2nd, the method for the checking present invention
1st, Growth habit is identified
Growth habit identifies that specific method is：Wheat, Taishan No.1 and China spring is handed over to be used as winter habit, semi-winterness and spring using money respectively
Property control.Above-mentioned material and control material are divided 6 times and sowed, the 1st phase normally sowed (on October 19th, 2013), the 2nd phase
To the 6th phase deferred seedtime, the sowing time is respectively on 2 25th, 2014, March 5, March 19, March 26, April 2, just
Normal field management.
On June 4th, 2014, eared result according to the 2-6 phases of deferred seedtime, with reference to winter habit, semi-winterness, spring varieties
Heading situation, the Growth habit of synthetic determination material to be tested：
Strong winter variety money hands over wheat can not normally to ear in the 4-6 phases, is showed only as the growth of ineffective tillering, it is impossible to by seeking
Health length is changed into reproductive growth；
Semi-winterness kind Taishan No.1 can ear in the 2-3 phases, but it is incomplete to ear, and the 4-6 phases, all individual plants can not be just
Often heading, only show as ineffective tillering growth；
Spring varieties China spring can normally be eared in all 2-4 phase deferred seedtimes, and ineffective tillering is degenerated substantially, 5-
6 phases also can not normally ear, and only show as the growth of ineffective tillering.
Analyzed more than,
The material that 2nd phase can not just ear, it is possible to determine that be strong winter habit；
2nd phase can normally ear, from the material that the heading of the 3rd phase is incomplete or can not ear, it is possible to determine that be winter habit；
2nd, 3 phases can normally ear, and fail normally to ear since the 4th phase, it is possible to determine that be semi-winterness；
The 2-6 phases are remained to ear, and ineffective tillering few ineffective tillering of degenerating or exist substantially is not degenerated completely, can be with
It is determined as spring habit.
According to field investigation result, judge that Winter-Spring type is shown in Table 2.
The results contrast judged with the method for the above-mentioned present invention of a table 1, the only Growth habit of Jimai 21 identify variant, this hair
Bright method is accredited as semi-winterness, and interval sowing is accredited as winter habit.It can be seen that method of the invention has certain accuracy, it is
It is reliable feasible.
Table 2 is the Growth habit qualification result of interval sowing
| The name of an article | Growth habit type | The name of an article | Growth habit type | The name of an article | Growth habit type |
| Taishan No.1 | Semi-winterness | Mountain agriculture 22 | Semi-winterness | Mountain agriculture 6343 | Strong winter habit |
| Jinan 13 | Semi-winterness | Mountain agriculture spoke 63 | Semi-winterness | AR132 | Spring habit |
| Jinan 16 | Semi-winterness | LS6109 | Winter habit | Agricultural university 3743 | Semi-winterness |
| Jinan 17 | Semi-winterness | SH5099 | Semi-winterness | Agricultural university 3753 | Semi-winterness |
| Pseudomonas Jinanensis Cell Wall | Winter habit | SN055849 | Semi-winterness | Agricultural university 3744 | Semi-winterness |
| Jimai 20 | Semi-winterness | SN056035 | Semi-winterness | Agricultural university 3588 | Semi-winterness |
| Jimai 21 | Winter habit | SN086218 | Semi-winterness | The small 13-1-1 that lays down | Semi-winterness |
| Jimai 22 | Semi-winterness | Shandong wheat 14 | Semi-winterness | Jagger | Spring habit |
| River in Shangdong Province agriculture 14 | Semi-winterness | Shandong wheat 21 | Semi-winterness | Ji teacher 02-1 | Semi-winterness |
| River in Shangdong Province agriculture 19 | Semi-winterness | Tobacco grower 19 | Winter habit | Ji glutinous 200 | Spring habit |
| 20104188 | Semi-winterness | Tobacco grower 25 | Semi-winterness | Henan wheat 34 | Spring habit |
| Shandong original 502 | Semi-winterness | Tobacco grower 321 | Winter habit | White glutinous wheat | Spring habit |
| R502 is without awns -2 | Semi-winterness | Cigarette 5158 | Semi-winterness | Sumai 3 | Spring habit |
| Safe agriculture 18 | Semi-winterness | Tobacco grower 5286 | Semi-winterness | Chongqing wheat 0926 | Spring habit |
| Safe agriculture 9236 | Strong winter habit | Continent member 9369 | Semi-winterness | Continuous wheat 37 | Spring habit |
| Mountain agriculture 17 | Winter habit | 11 mirror 142 | Semi-winterness | WHEAR | Spring habit |
| Mountain agriculture 20 | Semi-winterness |
2nd, photoperiodical reaction is identified
Photoperiodical reaction is identified with Ppd-D1 sites allelic variation type Ppd-D1a and Ppd-D1b Marker Identification result
Judge that primer is respectively：Ppd-D1b(F：ACGCCTCCCACTACACTG (sequence 1)；R：TGTTGGTTCAAACAGAGAGC (sequences
Row 2))；Ppd-D1a(F：ACGCCTCCCACTACACTG (sequence 3)；R：CACTGGTGGTAGCTGAGATT (sequence 4)).Carry
Ppd-D1a material is photoperiod insensitive (the blunt type of abbreviation light), is otherwise photoperiod-sensitive type (abbreviation Photosensitive).
Specific method：In the above-mentioned 3 leaf phase of 49 materials, the extraction of genomic DNA is carried out to it using SDS methods, as
The template of Ppd-D1 sites allelic variation type Ppd-D1a and Ppd-D1b mark PCR amplifications.
PCR reaction total systems are 20 μ L, wherein, the μ l of 2 × PCR MIX solution 10, each solution 0.6 μ l, DNA to be detected of primer
Template (DNA concentration 100ng/ μ l, dosage are about 1 μ l), the μ l of final volume 20 are adjusted with ddH2O.Negative control is set simultaneously, it is negative right
According to being not added with template.
PCR response procedures are：94 DEG C first, 3min；Then 94 DEG C of 30s, 52 DEG C of 45s, 72 DEG C of 1min, 30 circulations；Most
72 DEG C of extension 10min afterwards；4 DEG C, preserve, strictly performed by this.PCR primer carries out electrophoresis in 1.2% agarose gel, takes pictures and unites
Count result.
Ppd-D1a genetic tests result is as shown in Fig. 2 1-24 is respectively 1：Jinan 13；2：Jimai 17；3：Jinan 16；4：
20104188；5：Pseudomonas Jinanensis Cell Wall；6：SN086218；7：Jimai 20；8：Jimai 21；9：Continent member 9369；10：Jimai 22；11：11 mirror
142；12：WHEAR；13：LS6109；14：SH5099；15：Mountain agriculture 22；16：Agricultural university 3753；17：Agricultural university 3743；18：AR132；
19：Tobacco grower 321；20：Safe agriculture 9236；21：Chongqing wheat 0926；22：White glutinous wheat；23：Agricultural university 3588；24：Mountain agriculture spoke 63, there is 288bp
Purpose band, then containing Ppd-D1a genes.
The amplified production of Ppd-D1b genes is equally subjected to electrophoresis, there are 414bp purpose bands, then containing Ppd-D1b bases
Cause.
There to be 288bp purpose bands or there are 414bp purpose bands to be defined as 1, no 288bp purpose bands or not have
414bp purpose bands, 0 is defined as, statistical result is shown in Table 2.As a result show：Material containing Ppd-D1a genes is the blunt type of light, is contained
Have Ppd-D1b genes for Photosensitive.Markers for Detection result shows：Tied obtained by only 3 materials and the method for the present invention
By being less consistent, remaining is unanimously (Fig. 1, table 2)；Analysis, may be relevant with the accurate of these molecular labelings, the degree of reliability etc..
Comprehensive interval sowing and molecular labeling result can prove that patent of the present invention is reliable, accurate, and simply, easy to operate, accuracy is high,
A kind of effective simple and easy method is provided for wheat Growth habit, photoperiod identification.
Table 2 is photoperiod gene in the testing result of material of participating in the experiment
Claims (6)
1. a kind of method for detecting or aiding in detection wheat Growth habit, comprises the following steps：
1) vernalization 0 day is conducted batch-wise in seed to be measured and vernalization is handled for 60 days, obtain 0 day seed of wheat vernalization to be measured and to be measured small
60 days seeds of wheat vernalization；
2) 60 days seeds of 0 day seed of wheat vernalization to be measured and the wheat vernalization to be measured are transplanted and trained successively respectively
Educate, detect respectively 60 days seeds of 0 day seed of the wheat vernalization to be measured and the wheat vernalization to be measured from transplanting to bloom when
Between, determine wheat Growth habit to be measured from transplanting to the time spent is opened according to different vernalization time wheat seeds；
It is described according to different vernalization time wheat seeds from transplanting to open the time spent determine wheat Growth habit to be measured for it is following 1)
Or 2)：
1) it is：
If 60 days seeds of the wheat vernalization to be measured and difference of the 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If 60 days seeds of the wheat vernalization to be measured and difference of the 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
More than 7, then wheat to be measured is or candidate is winter habit wheat；
2) it is：
If 60 days seeds of the wheat vernalization to be measured and difference of the 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If the difference that 60 days seeds of the wheat vernalization to be measured and 0 day seed of wheat vernalization to be measured are transplanted to number of days of blooming is big
In 7 and less than or equal to 13, then wheat to be measured is or candidate is Semi-winter wheat；
If the difference that 60 days seeds of the wheat vernalization to be measured and 0 day seed of wheat vernalization to be measured are transplanted to number of days of blooming is big
In 13 and less than or equal to 19, then wheat to be measured is or candidate is winter habit wheat；
If the difference that 60 days seeds of the wheat vernalization to be measured and 0 day seed of wheat vernalization to be measured are transplanted to number of days of blooming is big
In 19, then wheat to be measured is or candidate is strong winter habit wheat.
2. according to the method for claim 1, it is characterised in that：
Before step 1), also comprise the following steps：Sprout process was carried out by 2 days before every batch of seed vernalization to be measured.
3. method according to claim 1 or 2, it is characterised in that：The temperature of the vernalization is 3 DEG C.
4. a kind of method for detecting or aiding in detection wheat Growth habit and photoperiod characteristic, comprises the following steps：
1) vernalization 0 day is conducted batch-wise in seed to be measured and vernalization is handled for 60 days, obtain 0 day seed of wheat vernalization to be measured and to be measured small
60 days seeds of wheat vernalization；
2) 60 days seeds of 0 day seed of wheat vernalization to be measured and the wheat vernalization to be measured are transplanted and trained successively respectively
Educate, detect respectively 60 days seeds of 0 day seed of the wheat vernalization to be measured and the wheat vernalization to be measured from transplanting to bloom when
Between, determine wheat Growth habit to be measured and photoperiod from transplanting to the time spent is opened according to different vernalization time wheat seeds；
It is described to determine wheat Growth habit to be measured and photoperiod from transplanting to the time spent is opened according to different vernalization time wheat seeds
It is following 1) or 2)：
1) it is：
If 60 days seeds of the wheat vernalization to be measured and difference of the 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If 60 days seeds of the wheat vernalization to be measured and difference of the 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
More than 7, then wheat to be measured is or candidate is winter habit wheat；
If 60 days kinds of the wheat vernalization to be measured are from transplanting to number of days of blooming less than or equal to 63, wheat to be measured is or candidate is light
Blunt type wheat；
If 60 days kinds of the wheat vernalization to be measured are from transplanting to number of days of blooming more than 63, wheat to be measured is or candidate is Photosensitive
Wheat；
2) it is：
If 60 days seeds of the wheat vernalization to be measured and difference of the 0 day seed of wheat vernalization to be measured from transplanting to number of days of blooming
Less than or equal to 7, then wheat to be measured is or candidate is Late frost damage；
If the difference that 60 days seeds of the wheat vernalization to be measured and 0 day seed of wheat vernalization to be measured are transplanted to number of days of blooming is big
In 7 and less than or equal to 13, then wheat to be measured is or candidate is Semi-winter wheat；
If the difference that 60 days seeds of the wheat vernalization to be measured and 0 day seed of wheat vernalization to be measured are transplanted to number of days of blooming is big
In 13 and less than or equal to 19, then wheat to be measured is or candidate is winter habit wheat；
If the difference that 60 days seeds of the wheat vernalization to be measured and 0 day seed of wheat vernalization to be measured are transplanted to number of days of blooming is big
In 19, then wheat to be measured is or candidate is strong winter habit wheat；
If 60 days kinds of the wheat vernalization to be measured are from transplanting to number of days of blooming less than or equal to 63, wheat to be measured is or candidate is light
Blunt type wheat；
If 60 days kinds of the wheat vernalization to be measured are from transplanting to number of days of blooming more than 63, wheat to be measured is or candidate is Photosensitive
Wheat.
5. according to the method for claim 4, it is characterised in that：
Before step 1), also comprise the following steps：Sprout process was carried out by 2 days before every batch of seed vernalization to be measured.
6. the method according to claim 4 or 5, it is characterised in that：The temperature of the vernalization is 3 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510481368.9A CN105165174B (en) | 2015-08-03 | 2015-08-03 | A kind of method for detecting wheat Growth habit and photoperiod characteristic |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510481368.9A CN105165174B (en) | 2015-08-03 | 2015-08-03 | A kind of method for detecting wheat Growth habit and photoperiod characteristic |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105165174A CN105165174A (en) | 2015-12-23 |
| CN105165174B true CN105165174B (en) | 2018-01-26 |
Family
ID=54888069
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510481368.9A Active CN105165174B (en) | 2015-08-03 | 2015-08-03 | A kind of method for detecting wheat Growth habit and photoperiod characteristic |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105165174B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106034659A (en) * | 2016-06-07 | 2016-10-26 | 山东省农业科学院作物研究所 | Method for rapidly identifying winterness and springness of wheat indoors |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103404382A (en) * | 2013-08-02 | 2013-11-27 | 西北农林科技大学 | Identification method of photoperiod sensibility quantization of wheat |
| CN104686148A (en) * | 2015-02-25 | 2015-06-10 | 滨州市作物研究所 | Method for identifying the springness and winterness of wheat varieties and regulating flower synchronization |
-
2015
- 2015-08-03 CN CN201510481368.9A patent/CN105165174B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103404382A (en) * | 2013-08-02 | 2013-11-27 | 西北农林科技大学 | Identification method of photoperiod sensibility quantization of wheat |
| CN104686148A (en) * | 2015-02-25 | 2015-06-10 | 滨州市作物研究所 | Method for identifying the springness and winterness of wheat varieties and regulating flower synchronization |
Non-Patent Citations (3)
| Title |
|---|
| 小麦冬春性鉴定研究;张灿军;《中国优秀硕士学位论文全文数据库 农业科技辑》;20101115(第11期);第14-15页第3.3.1.2、3.3.2节 * |
| 春化和光周期基因等位变异在23个国家小麦品种中的分布;杨芳萍等;《作物学报》;20111231;第37卷(第11期);第1917-1925页 * |
| 晚播法量化鉴定冬小麦品种冬春性的探讨;孙道杰等;《安徽农业科学》;20010131;第29卷(第1期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105165174A (en) | 2015-12-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Mapping QTLs for root traits under different nitrate levels at the seedling stage in maize (Zea mays L.) | |
| Zhao et al. | Sugarcane response to water-deficit stress during early growth on organic and sand soils | |
| Namai et al. | Genetic variations in dry matter production and physiological nitrogen use efficiency in rice (Oryza sativa L.) varieties | |
| Adriani et al. | Rice panicle plasticity in Near Isogenic Lines carrying a QTL for larger panicle is genotype and environment dependent | |
| King et al. | A possible relationship between shoot N concentration and the sensitivity of N2 fixation to drought in soybean | |
| Sakoda et al. | Genetic and physiological diversity in the leaf photosynthetic capacity of soybean | |
| Siaga et al. | Morpho-physiological responses of chili peppers ('Capsicum annuum') to short-term exposure of water-saturated rhizosphere | |
| Azhar et al. | Heat tolerance in cotton: Morphological, physiological, and genetic perspectives | |
| Abbasi et al. | Genetic analysis of sugar yield and physiological traits in sugar beet under salinity stress conditions | |
| Zhou et al. | High temperature reduces the viability of pollen from upland cotton in china | |
| CN105165174B (en) | A kind of method for detecting wheat Growth habit and photoperiod characteristic | |
| Sandhu et al. | Root plasticity: an effective selection technique for identification of drought tolerant maize (Zea mays L.) inbred lines | |
| Sen et al. | Salinity effect at seedling and flowering stages of some rice lines and varieties (Oryza sativa L.) | |
| Kobayasi et al. | Effects of free-air CO2 enrichment on heat-induced sterility and pollination in rice | |
| CN107750509A (en) | Barley moisture-proof simple Identification method | |
| Harihar et al. | Temperature induction response technique—a physiological approach to identify thermotolerant genotypes in rice | |
| CN108707692B (en) | Method and primer for rapidly identifying purity of hybrid seed of watermelon variety' Hubei watermelon No. 16 | |
| Chen et al. | QTL analysis of drought tolerance traits in rice during the vegetative growth period | |
| CN110199854A (en) | A kind of identification method of Seedling Stage Salt Tolerance of Barley | |
| Yang et al. | Optimizing the evaluation of root system architectural traits in Brassica napus | |
| Berghuijs et al. | Catching-up with genetic progress: Simulation of potential production for modern wheat cultivars in the Netherlands | |
| CN106034659A (en) | Method for rapidly identifying winterness and springness of wheat indoors | |
| Salifu et al. | Effects of plant density on photosynthetic characteristics and yield of maize under irrigation condition | |
| Sáenz-Rodríguez et al. | Assay system for mesocotyl elongation and hydrotropism of maize primary root in response to low moisture gradient | |
| Kiss et al. | Comparative Study of the Developmental Traits and Yield Components of Bread Wheat under Field Conditions in Several Years of Multi‐Sowing Time Experiments |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |