CN105154586A - Application method of EB virus encoded microRNA BART10 - Google Patents

Application method of EB virus encoded microRNA BART10 Download PDF

Info

Publication number
CN105154586A
CN105154586A CN201510422892.9A CN201510422892A CN105154586A CN 105154586 A CN105154586 A CN 105154586A CN 201510422892 A CN201510422892 A CN 201510422892A CN 105154586 A CN105154586 A CN 105154586A
Authority
CN
China
Prior art keywords
bart10
ebv
mir
nasopharyngeal carcinoma
situ hybridization
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510422892.9A
Other languages
Chinese (zh)
Inventor
曾朝阳
李桂源
熊炜
李小玲
晏其佳
何宝玉
李夏雨
张文玲
廖前进
石磊
周鸣
马健
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Central South University
Original Assignee
Central South University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Central South University filed Critical Central South University
Priority to CN201510422892.9A priority Critical patent/CN105154586A/en
Publication of CN105154586A publication Critical patent/CN105154586A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an application of EB virus encoded microRNA BART10 (EBV-miR-BART10) in preparing a prediction preparation for recurrence and metastasis of nasopharyngeal carcinoma. The research proves that the expression level of EBV-miR-BART10 in the nasopharyngeal carcinoma tissue is in positive correlation with the lymphatic metastasis and the distant metastasis of the nasopharyngeal carcinoma patient; if the expression of the EBV-miR-BART10 in the nasopharyngeal carcinoma tissue is up-regulated, the nasopharyngeal carcinoma patient with higher EBV-miR-BART10 expression have larger possibilities of recurrence and metastasis than the nasopharyngeal carcinoma patient with lower EBV-miR-BART10 expression, and the prognosis is worse, therefore, the application of the expression of the EBV-miR-BART10 in the predication of recurrence and metastasis of the nasopharyngeal carcinoma patient can provide powerful biomolecular basis for the prognosis of the nasopharyngeal carcinoma patient, and thus the application method has profound clinical significances and important popularization and application prospects.

Description

The application method of the microRNA BART10 of Epstein-Barr virus coding
Technical field
The invention belongs to oncomolecularbiology field, being specifically related to a kind of in situ hybridization probe of microRNABART10 (EBV-miR-BART10) expression level and recurrent nasopharyngeal carcinoma and transfer relationship for detecting Epstein-Barr virus coding in nasopharyngeal carcinoma paraffin-embedded sample, detection kit and application method thereof.
Background technology
Nasopharyngeal carcinoma (NasopharyngealCarcinoma, NPC) is the common head-neck malignant tumor in south China area, and because site of pathological change is hidden, be difficult to early discovery, and very easily shift, first visit patient metastasic cervical lymph nodes rate is up to 80%.Radiotherapy is the most frequently used clinically treatment means of current nasopharyngeal carcinoma, and the patient of 60 ~ 70% can obtain good curative effect, but still has the patient of 20 ~ 30% to there will be recurrence and transfer.Recurrence and transfer are one of principal elements causing Nasopharyngeal Carcinoma Patients death clinically, and chemicotherapy is to the recurrence for the treatment of nasopharyngeal carcinoma, transfer effect is undesirable, therefore, screen new nasopharyngeal carcinoma early diagnosis and the molecular marked compound of Index for diagnosis, clinical treatment for nasopharyngeal carcinoma has important directive significance, the chemicotherapy means of simultaneously comparing traditional, the method of biotherapy is more suitable for the treatment of recurrence and transition nasopharyngeal carcinoma, wherein gene therapy is to the recurrence preventing and treating nasopharyngeal carcinoma, transfer has more important and wide potential applicability in clinical practice, the target spot of Screening of Nasopharyngeal Carcinoma gene therapy is significant too.
Morbidity and the Epstein-Barr virus (EpsteinBarrvirus, EBV) of nasopharyngeal carcinoma infect closely related.Epstein-Barr virus is a kind of ubiquitous nerpes vinrus hominis, the adult population in the whole world about 95% can be infected, except having sub-fraction people once in a while and also causing communicable mononucleosis, major part infected person there will not be any clinical symptom, in most cases Epstein-Barr virus can in host long-term latent infection.But the Epstein-Barr virus of latent infection can cause the generation of malignant tumour in some cases, comprise Hugh Burkitt and the He Jiejin lymphomas in B cell source, and epithelial cell origin nasopharyngeal carcinoma and cancer of the stomach etc.The mechanism that Epstein-Barr virus causes malignant tumour to occur is not yet completely clear at present, may be relevant with the encode expression of series of genes of Epstein-Barr virus itself, as the Latent membrane protein1 (LatentMembraneProtein1 of Epstein-Barr virus coding, LMP1) as a kind of tumorigenesis albumen, the expression of oncogene in many host cells can be activated, suppress the structure and function of cyclin dependent kinase inhibitors.
EBV is about 170kb as its Genome Size of double-stranded DNA virus, except transcribed a series of protein coding gene, nearest discovery Epstein-Barr virus is codified one class Microrna (microRNA also, miRNA) molecule, EBV codified 25 miRNAs precursors are found at present, be processed into 44 ripe miRNAs, and the miRNAs of EBV coding cluster distribution on EBV genome, BART and BHRF1 two groups can be divided into.The miRNAs of Epstein-Barr virus coding by the gene in the gene of regulation and control Epstein-Barr virus coding itself or host cell, thus can take part in the nasopharyngeal epithelium vicious transformation of EBV mediation, affects developing of nasopharyngeal carcinoma.But be not also very thorough for the encode research of miRNAs of EBV in nasopharyngeal carcinoma, in 44 ripe EBVmiRNAs, major part does not also have the report of functional study, such as about the effects anb Mechanism of EBV-miR-BART10 research just seldom.There is the relation of developing effect about EBV-miR-BART10 and nasopharyngeal carcinoma up to now and all there is no bibliographical information in the early screening, auxiliary diagnosis or outcome prediction etc. of nasopharyngeal cancer patient.We are shown by research, the expression of EBV-miR-BART10 in tissues of nasopharyngeal carcinoma significantly raises, the Nasopharyngeal Carcinoma Patients of high expression level EBV-miR-BART10 is than easier the generations recurrence of the Nasopharyngeal Carcinoma Patients of low expression EBV-miR-BART10 and shift, prognosis is poorer, therefore, for EBV-miR-BART10 design specialized in situ hybridization probe and detection kit, be expected to provide reference for the prediction of recurring nasopharyngeal carcinoma clinically and shift for detecting the expression level of EBV-miR-BART10 in tissues of nasopharyngeal carcinoma.In addition, and during the EBVmiRNAs high expression level of not all more easily occur recurrence and transfer, prognosis is poorer, positive correlation; Applicant have studied the expression of other EBVmiRNAs multiple and the relation of recurrence and transfer simultaneously, such as: EBER-1 does not express or low expression in normal nasopharyngeal epithelium, and in tissues of nasopharyngeal carcinoma up-regulated, but the patient of high expression level EBER-1, than the patient of low expression EBER-1, recurrence and transfer is less likely to occur in tissues of nasopharyngeal carcinoma, prognosis is better, negative correlation.The expression of EBVmiRNAs and the relation of recurrence and transfer are described, can not infer.
The EBV-miR-BART10 of our transfection synthetic in nasopharyngeal carcinoma cell, confirms that process LAN EBV-miR-BART10 can promote the Invasion and Metastasis of nasopharyngeal carcinoma cell in the human nasopharyngeal epithelioma 1 of EBV feminine gender; By designing and synthesizing the antisense oligonucleotide of target EBV-miR-BART10, confirming that antisense oligonucleotide effectively can suppress the expression of EBV-miR-BART10, and the invasion inhibition ability of nasopharyngeal carcinoma cell can be suppressed; The nano silicon particles antisense oligonucleotide of EBV-miR-BART10 being loaded to polylysine modification makes Nanoparticulate Carriers for Gene Delivery; the nano silicon particles of polylysine modification can protect the antisense oligonucleotide of EBV-miR-BART10 from nuclease degradation; extend action time, and have higher transfection efficiency.
Summary of the invention
The in situ hybridization probe of the EBV-miR-BART10 that the object of the present invention is to provide a kind of Epstein-Barr virus to encode, reagent and application method thereof, utilize the sequence of EBV-miR-BART10 for the preparation of the prediction preparation of recurrent nasopharyngeal carcinoma and transfer, and the detection kit that a kind of cost performance is high, be easy to the EBV-miR-BART10 applied can be provided.
The application method of microRNABART10 of Epstein-Barr virus coding, described EBV-miR-BART10 is for the preparation of the prediction preparation of recurrent nasopharyngeal carcinoma and transfer; The expression level of EBV-miR-BART10 and the nodus lymphoideus transferring rate of Nasopharyngeal Carcinoma Patients and distant metastasis correlation in tissues of nasopharyngeal carcinoma; The sequence of EBV-miR-BART10: UACAUAACCAUGGAGUUGGCUGU (SEQNO.1).
The prediction preparation of described recurrent nasopharyngeal carcinoma and transfer is that in situ hybridization detects preparation.
The prediction preparation of described recurrent nasopharyngeal carcinoma and transfer comprises the in situ hybridization probe detecting Epstein-Barr virus miR-BART10, and sequence is: ACAGCCAACUCCAUGGUUAUGUA (SEQNO.2).
Described in situ hybridization detection reagent is test kit.
Test kit comprises: the in situ hybridization probe detecting Epstein-Barr virus miR-BART10, and sequence is: ACAGCCAACUCCAUGGUUAUGUA; Detect the in situ hybridization probe of reference gene GAPDH, sequence is: CAGUAGAGGCAGGGAUGAUGUUCU (SEQNO.3).
Test kit also comprises:
Also contain in test kit: digoxin oligonucleotide tailing reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB staining reagent;
Other conventional biochemical reagent, comprise 20x sodium citrate buffer (salinesodiumcitrate, SSC), T 500 (Dextransulphate), deionized formamide (DeionizedFormamide), polyadenylic acid (polyadenylicacid, PolyA), poly deoxyadenylic acid (polydeoxyadenylicacid, PolydA), the frog essence DNA (denaturedandshearedsalmonspermDNA that sex change is sheared, ssDNA), yeast transfer RNA (yeastt-RNA, tRNA), dithiothreitol (DTT) (DTT), Deng 50x Han Shi damping fluid (Denhardts ' ssolution), phosphoric acid buffer (PBSbuffer), stomach en-K, bovine serum albumin (BSA), trolamine (TEA), acetic anhydride, block reagent (Blockingreagentagent), TNB damping fluid (that is: the 0.1MTris-Cl+0.15MNaCl+0.5% of pH7.5 blocks reagent), TNT damping fluid (that is: the 0.1MTris-Cl+0.15MNaCl+0.05%Tween20 of pH7.5).
By in situ hybridization, we find that in the nasopharyngeal carcinoma paraffin organization sample filed the prognosis of the expression of EBV-miR-BART10 and Nasopharyngeal Carcinoma Patients is closely related, the expression level of EBV-miR-BART10 and the nodus lymphoideus transferring rate of Nasopharyngeal Carcinoma Patients and distant metastasis correlation detected in tissues of nasopharyngeal carcinoma.It is shorter that EBV-miR-BART10 expresses the high survival of patients time, and prompting EBV-miR-BART10 can be used as the predictive molecule mark of recurrent nasopharyngeal carcinoma and transfer.The present invention is that the auxiliary diagnosis of lung cancer and prognosis prediction provide strong biology tool, has far-reaching clinical meaning and important popularizing application prospect.
Accompanying drawing explanation
Fig. 1 is that Real-Time Fluorescent Quantitative PCR Technique detects the expression of EBV-miR-BART10 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium;
Significantly improve in the expression ratio normal nasopharyngeal epithelium (N) of EBV-miR-BART10 in nasopharyngeal carcinoma (T).
Fig. 2 is that in situ hybridization detects the expression of EBV-miR-BART10 in nasopharyngeal carcinoma and normal nasopharyngeal epithelium;
In normal nasopharyngeal epithelium (NPE), EBV-miR-BART10 expresses and substantially can't detect (negative), and 39 examples detect the low expression (Low) of EBV-miR-BART10 in 106 routine nasopharyngeal carcinoma (NPC), all the other 67 examples are high expression level (high), P<0.001.
Fig. 3 is the dependency that the expression level of EBV-miR-BART10 and nasopharyngeal carcinoma shift;
The expression level of EBV-miR-BART10 and nodus lymphoideus transferring rate (the left figure of Nasopharyngeal Carcinoma Patients is detected in tissues of nasopharyngeal carcinoma, N0 is not for having nodus lymphoideus transferring rate, N1 ~ 3 are nodus lymphoideus transferring rate clinical scale) and distant metastasis (right figure, insiturelapse: original position recurs, Metastasis: distant metastasis) correlation.
Fig. 4 is the expression of EBV-miR-BART10 in nasopharyngeal carcinoma and the relation of Nasopharyngeal Carcinoma Patients prognosis
In nasopharyngeal carcinoma the expression of EBV-miR-BART10 and the prognosis of Nasopharyngeal Carcinoma Patients closely related, namely the survival of patients time of EBV-miR-BART10 high expression level (High) will be significantly shorter than the patient of the low expression of EBV-miR-BART10 (Low).
Fig. 5 imports EBV-miR-BART10 oligonucleotide sequence in the nasopharyngeal carcinoma cell HNE2 of EBV feminine gender, and the expression of EBV-miR-BART10 in nasopharyngeal carcinoma cell significantly raises.
Import EBV-miR-BART10 oligonucleotide sequence (BART10) in the Nasopharyngeal Carcinoma Cell Line HNE2 of EBV feminine gender after, real time fluorescence quantifying PCR method have detected the expression of EBV-miR-BART10 in nasopharyngeal carcinoma cell, and the expression of EBV-miR-BART10 significantly raises.Negative control (NC) is for importing scramble sequence.
Fig. 6 is that the invasive ability of cell import EBV-miR-BART10 oligonucleotide sequence in the nasopharyngeal carcinoma cell HNE2 of EBV feminine gender after improves,
Cell-penetrating (transwell) experiment confirms, EBV-miR-BART10 oligonucleotide sequence is imported in the nasopharyngeal carcinoma cell HNE2 of EBV feminine gender, after the expression of artificial promotion EBV-miR-BART10, significantly can increase through the nasopharyngeal carcinoma cell number of matrix glued membrane, show that cell invasion ability strengthens, negative control (NC) is for importing scramble sequence.
Fig. 7 is that import EBV-miR-BART10 oligonucleotide sequence in the nasopharyngeal carcinoma cell HNE2 of EBV feminine gender after, cell migration ability improves,
Cell scratch experiment confirms, EBV-miR-BART10 oligonucleotide sequence is imported in the nasopharyngeal carcinoma cell HNE2 of EBV feminine gender, after the expression of artificial promotion EBV-miR-BART10, from cut both sides toward cut, central authorities' travelling speed significantly improves nasopharyngeal carcinoma cell, the time shorten of cut healing, shows that cell movement transfer ability improves.
Fig. 8 is the antisense oligonucleotide importing EBV-miR-BART10 in the nasopharyngeal carcinoma cell C666-1 of the EBV positive, significantly can suppress the expression of EBV-miR-BART10 in nasopharyngeal carcinoma cell,
Import the antisense oligonucleotide (BART10In) of EBV-miR-BART10 in the Nasopharyngeal Carcinoma Cell Line C666-1 of the EBV positive after, real time fluorescence quantifying PCR method have detected the expression of EBV-miR-BART10 in C666-1 cell, the expression of EBV-miR-BART10 is all subject to obvious suppression, the antisense oligonucleotide that negative control (NC) is scramble.
Fig. 9 is that the invasive ability of antisense oligonucleotide (BART10In) cell afterwards importing EBV-miR-BART10 in the nasopharyngeal carcinoma cell C666-1 of the EBV positive reduces,
Cell-penetrating (transwell) experiment confirms, import the antisense oligonucleotide (BART10In) of EBV-miR-BART10 in Nasopharyngeal Carcinoma Cell Line C666-1 after, significantly can reduce through the nasopharyngeal carcinoma cell number of matrix glued membrane, show that cell invasion ability reduces.
Figure 10 is that the transfer ability of antisense oligonucleotide (BART10In) cell afterwards importing EBV-miR-BART10 in the nasopharyngeal carcinoma cell C666-1 of the EBV positive reduces,
Cell scratch experiment confirms, import the antisense oligonucleotide (BART10In) of EBV-miR-BART10 in Nasopharyngeal Carcinoma Cell Line C666-1 after, the speed of nasopharyngeal carcinoma cell central authorities' migration from cut both sides toward cut slows down, the time lengthening of cut healing, shows that cell movement transfer ability reduces.
Embodiment
The present invention is further illustrated below in conjunction with embodiment, and unrestricted the present invention.
Embodiment 1, quantitative real-time PCR detects and confirms that EBV-miR-BART10 raises at nasopharyngeal carcinoma
1. materials and methods:
Collect 5 routine normal nasopharyngeal epithelium and 18 routine tissues of nasopharyngeal carcinomas, by Trizol (invitrogen Products) extracted total RNA, after 2 μ gRNA miScript Reverse Transcriptase kit (Qiagen Products) reverse transcriptions become cDNA, carry out with QuantiTectSYBRGreenPCR test kit (Qiagen Products) expression that real-time fluorescence quantitative PCR detects EBV-miR-BART10 and reference gene RNU6.The common primers (UniversalPrimer) of microRNA and the Auele Specific Primer of EBV-miR-BART10 and RNU6 are by Qiagen company designs and synthesize.
Real-time fluorescence quantitative PCR reaction system
Real-time fluorescence quantitative PCR reactions steps
Reaction terminates amplification curve and the melting curve of rear confirmation real-time fluorescence quantitative PCR, the expression intensity of each gene, according to after CT value (thresholdcyclevalues), reference gene (RNU6) markization, adopts groupt-test inspection to calculate P value.
2. result
EBV-miR-BART10 does not express or expresses very low in normal control tissue, and in tissues of nasopharyngeal carcinoma high expression level P<0.001 (Fig. 1)
Embodiment 2, in situ hybridization detects and finds that the expression of EBV-miR-BART10 in nasopharyngeal carcinoma is relevant to patient's prognosis
1. MATERIALS METHODS
1.1 design and synthesize hybridization probe
In order to the expression adopting in-situ hybridization method to detect EBV-miR-BART10, we devise the oligonucleotide probe and the positive control in situ hybridization oligonucleotide probe that detect EBV-miR-BART10 expression in situ hybridization.
EBV-miR-BART10 probe: ACAGCCAACUCCAUGGUUAUGUA
Positive control probe (detecting house-keeping gene GAPDH):
GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU
Adopt chemical synthesis process to synthesize each gene specific oligonucleotides probe sequence of above-mentioned design, in building-up process middle probe sequence, uridylic has marked vitamin H (bio-U).
1.2 oligonucleotide probe labelling kits and in situ hybridization detection reagent
Digoxin oligonucleotide tailing reagent (DigOligonucleitideTailingKit2 ndgeneration, Roche company), anti-digoxin-horseradish peroxidase complex detection kit (Anti-Digoxigenin-POD, Fabfragments, Roche company), strengthen the TSA signal amplifying system (TSA of expressed in situ detection signal tMbiotinSystem, NEL700 test kit, PerkinElmer company), DAB staining kit (Beijing Zhong Shan company), 20x sodium citrate buffer (salinesodiumcitrate, SSC), T 500 (Dextransulphate), deionized formamide (DeionizedFormamide), polyadenylic acid (polyadenylicacid, PolyA), poly deoxyadenylic acid (polydeoxyadenylicacid, PolydA), the frog essence DNA (denaturedandshearedsalmonspermDNA that sex change is sheared, ssDNA), yeast transfer RNA (yeastt-RNA, tRNA), dithiothreitol (DTT) (DTT), Deng 50x Han Shi damping fluid (Denhardts ' ssolution), phosphoric acid buffer (PBSbuffer), stomach en-K, bovine serum albumin (BSA), trolamine (TEA), TNBBuffer (0.1MTris-HCl, pH7.5, 0.15MNaCL, 0.5%BlockingReagent), TNTBuffer (0.1MTris-HCl, pH7.5, 0.15MNaCL, 0.05%Tween20), acetic anhydride, block reagent (Blockingreagentagent, Roche company).
1.3 other main agents and materials
Dehydrated alcohol, 90% alcohol, 70% alcohol, 50% alcohol, turps, distilled water, PBS damping fluid (pH7.2 ~ 7.4, NaCl137mmol/L, KCl2.7mmol/L, Na 2hPO 44.3mmol/L, KH 2pO 41.4mmol/L); 3% methyl alcohol-hydrogen peroxide solution (80% methyl alcohol and the configuration of 30% hydrogen peroxide); 0.01mol/L citrate buffer (citratebuffer, CB, pH6.0 ± 0.1,9ml0.1M citric acid solution and 41ml0.1M sodium citrate solution to add in 450ml distilled water after provisional configuration again correction work liquid pH value); 0.1% trypsinase; Hematorylin; 1% hydrochloride alcohol (configuration of 1ml concentrated hydrochloric acid+99ml70% alcohol); Mounting glue (PTSCureMount II); Special cap slide (480 × 240mm 2) customize in Zhengzhou Glassware Factory.Leica low melting point (58 DEG C) paraffin, domestic beeswax, raw spirit, dimethylbenzene, 10% neutral paraformaldehyde (0.01mol/L, pH7.4, DEPC distilled water and PBS buffer), Hematorylin, Yihong, neutral mounting natural gum, cover glass, slide glass.1.4 label probe
Utilize 3-tailingDIGOlignucleutideKit to carry out oligonucleotide probe mark, reaction system is as follows.
100pmololigonucleotide+ddH 2O＝9μl(control:controloligonucleutide5μl+ddH 2O4μl)
Mixing, slightly centrifugal.37 DEG C of water-bath 30min, add 2 μ lEDTA (0.2M, PH8.0) stopped reactions.
Purifying after 1.5 oligonucleotide probe marks
In order to increase the purity of label probe, need carry out purifying to the probe marked, concrete operations are as follows:
1) probe reaction mixture (22 μ l)+2.5 cold ethanol of μ l4MLiCl+75 μ l100% (-20 DEG C).
2)-70 DEG C of precipitations 60min, or-20 DEG C of 2h.
3) 13.000 × g4 DEG C of centrifugal 15min.
4) supernatant is abandoned, by 70% (V/V) washing with alcohol that 50 μ l are ice-cold.
5) 13.000xg4 DEG C, centrifugal 5min.
6) supernatant is abandoned, vacuum 4 DEG C of dryings.
7) with the heavy molten probe of aseptic double-distilled water.
1.6 in situ hybridizations detect the expression of EBV-miR-BART10 in file paraffin section
Paraffin section hybridization pre-treatment
1) 4 DEG C of paraffin sections preserved are placed in 58 DEG C of roasting sheet 30min, melted surface paraffin.
2) dimethylbenzene dewaxes 3 × 5min successively.
3) step ethanol wash, 100% alcohol 2 × 2min → 95% alcohol 1 × 5min → 70% alcohol 1 × 5min → 50% alcohol 1 × 5min → DEPC water washing 2 × 3min → DEPC-PBS washs 2 × 5min.
4) 300 μ l stomach en-K (10 μ g/ml) are dripped in section, 37 DEG C of digestion 20min.
5) cut into slices and wash 1min, stopped reaction into PBS (0.1MPBS+2mg/ml L-glutamic acid).
6) cut into slices into 0.2NHCL, in 37 DEG C of reaction 20-30min, increase the permeability of tissue.
7) section fixes 10min, room temperature afterwards with 4% paraformaldehyde (0.1MPBS dissolving).
8) organize positive intensity for hybridization to increase, acetyl process is carried out to section.Cut into slices into 0.25% diacetyl oxide Buffer I (0.1M trolamine), room temperature 10min.
9) 1MPBS washs 2 × 5min.
Prehybridization and hybridization
Prehybridization :-20 DEG C of prehybridization solutions preserved, be first placed in 37 DEG C and hatch 60min, the consumption of prehybridization solution is 50 μ l, and Parafilm carries out lid section, prehybridization 2 hours in 37 DEG C of wet boxes.(prehybridization solution composition comprises: 2XSSC, 10%Dextransulphate, 1XDenhardt ' ssolution, 50mMPhosphateBuffer (PH7.0), 50mMDTT, 250 μ l, 100 μ g/mlpolyA, 5 μ g/mlpolydA, 250 μ g/mlyeastt-RNA, 500 μ g/mlssDNA, 47%Deionizedformamide).
1) remove Parafilm, get rid of prehybridization solution, section is placed in 2 × SSC 5min.
2) hybridization: 37 DEG C of hybridized overnight (18-20h).Each section adds 250 μ l hybridization solutions and carries out lid with Parafilm.Add corresponding probe in prehybridization solution and just become hybridization solution.Hybridization solution is prepared when prehybridization, and place 37 DEG C and hatch, probe is fully dissolved in hybridization solution, and this experiment is mixed with hybridization solution by 500ng/ml concentration and probe concentration.
3) post-hybridization washing, section immersion 2 × SSC, 10min, throws off Parafilm.Shake washing on shaking table successively, 2 × SSC (0.5%SDS), 2 × 15min → 0.25 × SSC (0.5%SDS), 2 × 15min.
Color developing detection reaction after hybridization
1) Anti-Digoxigenin-POD is adopted to detect digoxigenin-probe with mRNA in conjunction with mixture; TSA amplification system strengthens the positive signal of in situ hybridization reaction solution reaction, and DAB develops the color.
2) section goes in TNT damping fluid, 3 × 5min.
3) drip TNB and block damping fluid, 300 μ l/TMAs, room temperature, 30min.
4) unnecessary blocker is sucked, the Anti-Digoxigenin-POD (TBS+0.1%TritonX-100+1% blocker) of 1:100 dilution, room temperature 4 hours.
5) TNTBuffer (0.1MTris-CL, pH7.5,0.15MNaCL, 0.05%Tween20) washing, 3x5min.
6) section drips signal and amplify reagent BiotinylTyamid, 300 μ l/TMAs, (BiotinylTyramid stock solution: BiotinylTyramid is dissolved in 0.2mlDMSO, BiotinylTyramid working fluid: 1 × diluent, 1:50 dilutes BiotinylTyramid stock solution), room temperature 10 minutes.
7) TNT washes, 3 × 5min.
8) section drips SA-HRP (strepto-avidin-horseradish peroxidase), 300 μ l/TMAs, room temperature 30min.
9) TNT washes, 3 × 5min.
10) aquae destillata washing, 1 × 1min.
11) DAB colour developing, controls color reaction under microscope.
12) Hematorylin is redyed,
13) alcohol step dehydration, chip drying.
14) mounting glue is dripped, the cover glass cover plate of dimension, crosslinked section 1min under ultraviolet lamp.
1.7 results judge and standard
Applied optics microscope is observed respectively under low power and high power lens, and first the positive expression signal of object observing RNA is in the intracellular location of object observing: be positioned at nucleus, cytoplasm or cytolemma.
Carry out comprehensive grading with cell count two kinds of standards of the intensity of this detection rna expression position positive signal and positive expression respectively again, judging criterion is: (1) judges according to positive cell dyeing intensity: a. cell dye-free, remembers 0 point; B. cell dyes light brown is the weak positive, remembers 1 point; C. cell is dyed brown and without background coloration, or cell is dyed dark-brown and has light brown background to be moderate positive, remembers 2 points; D. cell is dyed dark-brown and is strong positive without background coloration, remembers 3 points.(2) express number score according to positive cell: the no positive cell expressing of a., remember 0 point; B. positive expression cell count≤25%, remembers 1 point; C.25% < positive cell number < 50%, remembers 2 points; D. positive expression cell count >=50%, remembers 3 points.
In order to reduce the subjective factor of appraisal result as far as possible, carried out separately judging and marking by one of above-mentioned standard respectively by two pathology experts, then both scorings be multiplied, result is: 1. 0 point of person finally counts 0 point, thinks negative and expresses; 2. 1 point and 2 points of persons finally count 1 point, think weak positive expression; 3. 3 points and 4 points of persons finally count 2 points, think that moderate positive is expressed; 4. 6 assign to 9 points of persons and finally count 3 points, think that strong positive is expressed.
1.8 analyze and statistical software
Application SPSS13.0 statistical software carries out statistical analysis to experimental result, compares between two and uses χ 2test or Fisherexacttest, correlation analysis adopts Spearmencorrelation method; P < 0.05 i.e. difference has statistical significance.Survival curve analysis adopts Kaplan-Meiermethod and log-ranktest; Multivariate analysis adopts Cox ' sproportionalhazardsmodel; P < 0.05 i.e. difference has statistical significance.
2 results
Expression in the expression ratio normal control tissue of 2.1EBV-miR-BART10 in nasopharyngeal carcinoma significantly raises
In normal nasopharyngeal epithelium (NPE), EBV-miR-BART10 expresses and substantially can't detect (negative), and 39 examples detect the low expression (Low) of EBV-miR-BART10 in 106 routine nasopharyngeal carcinoma (NPC), all the other 67 examples are high expression level (high), P<0.001 (Fig. 2).
The expression level of 2.2EBV-miR-BART10 and nasopharyngeal carcinoma shift Close relation
We queried the clinical data of 106 routine Nasopharyngeal Carcinoma Patients, such as age of onset, sex, TNM are by stages etc., and Effect of follow-up visit by telephone has been carried out to them, detailed inquired them start time, treatment situation, with or without recurrence, with or without suffering from other diseases, recurrence and death time etc. again, and register survival time and state.We find in tissues of nasopharyngeal carcinoma, the expression level of EBV-miR-BART10 and nodus lymphoideus transferring rate (Fig. 3 left side of Nasopharyngeal Carcinoma Patients detected, N0 is not for having nodus lymphoideus transferring rate, N1 ~ 3 are nodus lymphoideus transferring rate clinical scale) and distant metastasis (Fig. 3 right side, insiturelapse: original position recurs, Metastasis: distant metastasis) correlation.
The Nasopharyngeal Carcinoma Patients prognosis of 2.3EBV-miR-BART10 high expression level is poor
The survival analysis that we carry out the expression of EBV-miR-BART10 in tissues of nasopharyngeal carcinoma and the survival time of patient and state, find that the expression of EBV-miR-BART10 and the prognosis of Nasopharyngeal Carcinoma Patients are closely related in nasopharyngeal carcinoma, namely the survival of patients time of EBV-miR-BART10 high expression level (High) will be significantly shorter than the patient (Fig. 4) of the low expression of EBV-miR-BART10 (Low).
Embodiment 3, in nasopharyngeal carcinoma cell, process LAN EBV-miR-BART10 promotes the invasion inhibition of nasopharyngeal carcinoma
1. MATERIALS METHODS
1.1 cell cultures and transfection
The Nasopharyngeal Carcinoma Cell Line HNE2 of EBV feminine gender is purchased from Central South University's cell centre, and cell cultures RPMI1640 used trains base and foetal calf serum, and peptic cell trypsinase used is U.S. Gibco Products.
EBV-miR-BART10 is synthesized by chemical synthesis by Invitrogen company, and sequence is:
UACAUAACCAUGGAGUUGGCUGU
By Nasopharyngeal Carcinoma Cell Line HNE2 good for growth conditions by 2 × 10 5individual cells/well is inoculated in 6 orifice plates, 6 orifice plates is placed in 37 DEG C, 5%CO 2in incubator, treat that culturing cell grows to the transfection that 50-70% density can start EBV-miR-BART10; Transfection process is as follows:
The Hiperfect transfection reagent (Qiagen Products) adding 8 μ l in aseptic EP pipe mixes and leaves standstill 5min in 100 μ l serum free mediums;
EBV-miR-BART10 is added in 100 μ l serum free mediums; Then mix with the above-mentioned Hiperfect transfection reagent 100 μ l serum free medium gentleness that comprises, room temperature leaves standstill 30 minutes, makes them form complex body;
With D-Hank's liquid washed cell 3 times;
800 μ l serum free mediums (antibiotic-free) will be added in said mixture, after gentle mixing, add 1 hole in 6 orifice plates;
6 orifice plates are placed in CO 2in incubator, cultivate 6 hours, then abandon supernatant for 37 DEG C, add perfect medium and continue cultivation 48 hours.
1.2 real-time quantitative PCRs detect the effect that EBV-miR-BART10 expresses:
After cell transfecting success, extracted total RNA, reverse transcription, quantitative real-time PCR detects the expression of EBV-miR-BART10, and method and step are with embodiment 1.
1.3 cell-penetrating experiments
((transwell) experiment is the experimental technique of checking tumor cell invasion ability to cell-penetrating.Transwell cell (8 μm, aperture) and matrigel (Matrigel) purchased from American BD company, 4% paraformaldehyde stationary liquid, Viola crystallina dye liquor (0.1%g/ml) available from Sigma.Matrigel is pressed 1:8 dilution, be coated on the face, upper room of Transwell cell bottom film, put 37 DEG C and make Matrigel aggregate into gel in 30 minutes.Matrigel film water is carried out by BD company specification sheets before using.
Serum free medium and 1 × 10 is added on each Transwell cell upper strata 5the individual transfection nasopharyngeal carcinoma cell of EBV-miR-BART10 or contrast (scramble) sequence, adds the substratum containing 20% foetal calf serum in Transwell cell lower floor.Cell continued cultivation after 36 hours, fixes, violet staining, dab off the non-migrating cell in upper strata, wash 3 times with PBS with cotton swab with 4% paraformaldehyde stationary liquid.Examine under a microscope the nasopharyngeal carcinoma cell through matrix glued membrane.
1.4 cell scratch experiments
Cell scratch experiment is the experimental technique of checking tumor cell migration ability.The nasopharyngeal carcinoma cell of transfection EBV-miR-BART10 or contrast (scramble) sequence is inoculated in 6 orifice plates, when cell density reaches 90%, in each 6 orifice plates, (cut) is drawn a straight line with 200ulpipet, cut healing state is examined under a microscope subsequently at each time point (depending on different cell migration ability) such as 0,8,12,16,24,32,48 hour, take pictures, and calculate each group of cell migration rates.
2. result
After 2.1 transfection EBV-miR-BART10, in nasopharyngeal carcinoma cell, the expression level of EBV-miR-BART10 significantly raises
In the nasopharyngeal carcinoma cell HNE2 of EBV feminine gender after transfection EBV-miR-BART10, the expression of EBV-miR-BART10 in nasopharyngeal carcinoma cell significantly raises (Fig. 5), shows EBV-miR-BART10 transfection success.
2.2 cell invasion ability risings after transfection EBV-miR-BART10 in nasopharyngeal carcinoma cell
Cell-penetrating (transwell) experiment confirms, after proceeding to EBV-miR-BART10, significantly can increase through the nasopharyngeal carcinoma cell number of matrix glued membrane, show that cell invasion ability strengthens (Fig. 6) in Nasopharyngeal Carcinoma Cell Line HNE2.
2.3 cell migration ability increases after transfection EBV-miR-BART10 in nasopharyngeal carcinoma cell
Cell scratch experiment confirms, the speed proceeding to the central authorities' migration from cut both sides toward cut of EBV-miR-BART10 posterior nasopharynx cancer cells in Nasopharyngeal Carcinoma Cell Line HNE2 is accelerated, the time shorten of cut healing, shows that cell movement transfer ability strengthens (Fig. 7).
Embodiment 4, the nano particle of load antisense oligonucleotide suppresses the expression of EBV-miR-BART10 in nasopharyngeal carcinoma cell
1. MATERIALS METHODS
The antisense oligonucleotide of 1.1EBV-miR-BART10
The antisense oligonucleotide of EBV-miR-BART10 is synthesized by chemical synthesis, and sequence is as follows:
ACAGCCAACUCCAUGGUUAUGUA
1.2 nano silicon particles preparing poly-lysine bag quilt
The nano silicon particles of poly-lysine bag quilt uses OP10/ hexanaphthene/ammonia microemulsion self-assembling technique to carry out nano silicon particles (silicananoparticle, SiNP) synthesis, and utilize nano silicon particles surface energy and by ion electrostatic interaction, prepare the nano silicon particles of polylysine modification; Described nano particle can be prepared by following methods:
1) OP-10, hexanaphthene and ammoniacal liquor are mixed, the different ester of positive silicic acid (TEOS) is added after stirring at room temperature is even, continue to be stirred to polymerization to complete, add equal-volume acetone, ultrasonic disperse, centrifugal, distilled water washs three times, centrifugal collecting precipitation is in 80 DEG C of dryings, and porphyrize obtains nano silicon particles (SiNP).Wherein H 2o and OP-10 and H 2the mol ratio of O and TEOS is 2 ~ 10, ammonia concn is 1.6 ~ 28%, the volumetric molar concentration of TEOS in hexanaphthene is 0.1 ~ 3mol/L.
2) SiNP is resuspended in 0.6MNaCO by 0.1 ~ 10mg/ml 3in solution, ultrasonic disperse, centrifugal, abandon supernatant, then be resuspended in PBS (pH7.4) by throw out by 0.1 ~ 10mg/ml, ultrasonic disperse, add poly-lysine (final concentration is 4 ~ 15nmol/mL), fully mix, room temperature is mixed shakes; Centrifugal, abandon supernatant, precipitation is resuspended in distilled water, obtains the nano silicon particles of polylysine modification.The final concentration of poly-lysine is 4 ~ 15nmol/mL.
3) by modified nano silicon particles ultrasonic disperse, the antisense oligonucleotide mixing of 5 ~ 30:1 and EBV-miR-BART10 in mass ratio, room temperature leaves standstill and makes it combine.
1.3 cell cultures and transfection
By EBV positive nasopharyngeal carcinoma cell C666-1 good for growth conditions by 2 × 10 5individual cells/well is inoculated in 6 orifice plates, 6 orifice plates is placed in 37 DEG C, 5%CO 2in incubator, treat that culturing cell grows to 50-70% density and can start transfection EBV-miR-BART10 antisense oligonucleotide; Transfection process is as follows:
In aseptic EP pipe, add the nano silicon particles suspension carrying the polylysine modification of EBV-miR-BART10 antisense oligonucleotide that 100 μ l prepare, mix with 100 μ l serum free medium gentlenesses; With D-Hank's liquid washed cell 3 times; 800 μ l serum free mediums (antibiotic-free) will be added in said mixture, after mixed mixing, add 1 hole in 6 orifice plates; 6 orifice plates are placed in CO 2in incubator, cultivate 6 hours, then abandon supernatant for 37 DEG C, add perfect medium and continue overnight incubation.With carrying the polylysine modification nano silicon particles of Scramble sequence antisense oligonucleotide as experiment contrast.
1.4 real-time quantitative PCRs detect the effect that antisense oligonucleotide suppresses EBV-miR-BART10 to express:
After cell transfecting success, extracted total RNA, reverse transcription, quantitative real-time PCR detects the expression of EBV-miR-BART10, and method and step are with embodiment 1.
1.5 cell-penetrating experiments and cell scratch experiment are with embodiment 3.
2. result
2.1 antisense oligonucleotides significantly can suppress the expression of EBV-miR-BART10
Import the antisense oligonucleotide (BART10In) of EBV-miR-BART10 in the Nasopharyngeal Carcinoma Cell Line C666-1 of the EBV positive after, real time fluorescence quantifying PCR method have detected the expression of EBV-miR-BART10 in C666-1 cell, and the expression of EBV-miR-BART10 is all subject to obvious suppression.The antisense oligonucleotide (Fig. 8) that negative control (NC) is scramble.
After 2.2 antisense oligonucleotides suppress the expression of EBV-miR-BART10, cell invasion ability reduces
Cell-penetrating (transwell) experiment confirms, import the antisense oligonucleotide (BART10In) of EBV-miR-BART10 in Nasopharyngeal Carcinoma Cell Line C666-1 after, significantly can reduce through the nasopharyngeal carcinoma cell number of matrix glued membrane, show that cell invasion ability reduces (Fig. 9).
After 2.3 antisense oligonucleotides suppress the expression of EBV-miR-BART10, cell migration ability reduces
Cell scratch experiment confirms, import the antisense oligonucleotide (BART10In) of EBV-miR-BART10 in Nasopharyngeal Carcinoma Cell Line C666-1 after, the speed of nasopharyngeal carcinoma cell central authorities' migration from cut both sides toward cut slows down, the time lengthening of cut healing, shows that cell movement transfer ability reduces (Figure 10).

Claims (10)

  1. The application method of the microRNABART10 of 1.EB encoding viral, is characterized in that, described EBV-miR-BART10 is for the preparation of the prediction preparation of recurrent nasopharyngeal carcinoma and transfer; The expression level of EBV-miR-BART10 and the nodus lymphoideus transferring rate of Nasopharyngeal Carcinoma Patients and distant metastasis correlation in tissues of nasopharyngeal carcinoma; The sequence of EBV-miR-BART10: UACAUAACCAUGGAGUUGGCUGU.
  2. 2. application method according to claim 1, is characterized in that, the prediction preparation of described recurrent nasopharyngeal carcinoma and transfer is that in situ hybridization detects preparation.
  3. 3. application method according to claim 2, is characterized in that, the prediction preparation of described recurrent nasopharyngeal carcinoma and transfer comprises the in situ hybridization probe detecting Epstein-Barr virus miR-BART10, and sequence is: ACAGCCAACUCCAUGGUUAUGUA.
  4. 4. the application method according to Claims 2 or 3, is characterized in that, described in situ hybridization detection reagent is test kit.
  5. 5. application method according to claim 4, is characterized in that, test kit comprises: the in situ hybridization probe detecting Epstein-Barr virus miR-BART10, and sequence is: ACAGCCAACUCCAUGGUUAUGUA; Detect the in situ hybridization probe of reference gene GAPDH, sequence is: CAGUAGAGGCAGGGAUGAUGUUCU.
  6. 6. application method according to claim 5, is characterized in that, test kit also comprises:
    Also contain in test kit: digoxin oligonucleotide tailing reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB staining reagent;
    Other conventional biochemical reagent, comprises 20xSSC, T 500, deionized formamide, polyadenylic acid, poly deoxyadenylic acid, the frog essence DNA that sex change is sheared, yeast transfer RNA, dithiothreitol (DTT), 50xDenhardts ' ssolution, PBSbuffer, stomach en-K, bovine serum albumin, trolamine, acetic anhydride
    The 0.1MTris-Cl+0.15MNaCl+0.5% of TNB damping fluid: pH7.5 blocks reagent;
    The 0.1MTris-Cl+0.15MNaCl+0.05%Tween20 of TNT damping fluid: pH7.5.
  7. 7., for the preparation of the in situ hybridization probe of the in situ hybridization detection reagent of the prediction preparation of recurrent nasopharyngeal carcinoma and transfer, sequence is as follows: ACAGCCAACUCCAUGGUUAUGUA.
  8. 8., for the in situ hybridization detection reagent of the prediction of recurrent nasopharyngeal carcinoma and transfer, be the test kit including in situ hybridization probe according to claim 7.
  9. 9. in situ hybridization detection reagent according to claim 8, is characterized in that, also containing the in situ hybridization probe detecting reference gene GAPDH in test kit, sequence is: CAGUAGAGGCAGGGAUGAUGUUCU.
  10. 10. in situ hybridization detection reagent according to claim 8 or claim 9, is characterized in that,
    Also contain in test kit: digoxin oligonucleotide tailing reagent, anti-digoxin-horseradish peroxidase complex detection reagent, DAB staining reagent;
    Other conventional biochemical reagent, comprises 20xSSC, T 500, deionized formamide, polyadenylic acid, poly deoxyadenylic acid, the frog essence DNA that sex change is sheared, yeast transfer RNA, dithiothreitol (DTT), 50xDenhardts ' ssolution, PBSbuffer, stomach en-K, bovine serum albumin, trolamine, acetic anhydride
    The 0.1MTris-Cl+0.15MNaCl+0.5% of TNB damping fluid: pH7.5 blocks reagent;
    The 0.1MTris-Cl+0.15MNaCl+0.05%Tween20 of TNT damping fluid: pH7.5.
CN201510422892.9A 2015-07-17 2015-07-17 Application method of EB virus encoded microRNA BART10 Pending CN105154586A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510422892.9A CN105154586A (en) 2015-07-17 2015-07-17 Application method of EB virus encoded microRNA BART10

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510422892.9A CN105154586A (en) 2015-07-17 2015-07-17 Application method of EB virus encoded microRNA BART10

Publications (1)

Publication Number Publication Date
CN105154586A true CN105154586A (en) 2015-12-16

Family

ID=54795627

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510422892.9A Pending CN105154586A (en) 2015-07-17 2015-07-17 Application method of EB virus encoded microRNA BART10

Country Status (1)

Country Link
CN (1) CN105154586A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109321655A (en) * 2018-05-17 2019-02-12 福建省肿瘤医院（福建省肿瘤研究所、福建省癌症防治中心） NKIRAS2 gene regulation region sequence, regulating and controlling sequence and its application in nasopharyngeal carcinoma

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140296319A1 (en) * 2011-05-25 2014-10-02 Catholic University Industry Academic Cooperation Foundation Composition For Promoting Apoptosis Or Inhibiting Cell Growth, Comprising Epstein-Barr Virus Microrna

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140296319A1 (en) * 2011-05-25 2014-10-02 Catholic University Industry Academic Cooperation Foundation Composition For Promoting Apoptosis Or Inhibiting Cell Growth, Comprising Epstein-Barr Virus Microrna

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
《胃肠病学和肝病学杂志》 *
高世东: "《实用中西医内科常见疾病诊疗》", 30 June 2015, 兰州大学出版社 *
黄丽丽: "鼻咽癌中EB病毒编码的miRNAs及其宿主靶基因调控网络的构建和初步验证", 《中国优秀硕士学位论文全文数据库.医药卫生科技辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109321655A (en) * 2018-05-17 2019-02-12 福建省肿瘤医院（福建省肿瘤研究所、福建省癌症防治中心） NKIRAS2 gene regulation region sequence, regulating and controlling sequence and its application in nasopharyngeal carcinoma
CN109321655B (en) * 2018-05-17 2022-07-05 福建省肿瘤医院（福建省肿瘤研究所、福建省癌症防治中心） NKIRAS2 gene regulatory region sequence, regulatory sequence and application thereof in nasopharyngeal carcinoma

Similar Documents

Publication Publication Date Title
CN104388543A (en) In situ hybridization probe, reagent and application of long non-coding RNA LOC401317
CN105018498A (en) Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1
CN104383559B (en) The expression vector of long-chain non-coding RNA LOC401317, tumor suppression reagent and application thereof
CN104878009A (en) Interference preparation based on long non-coding RNA AFAP1-AS1 and application method of interference preparation
CN103146693A (en) Long chain non-coding RNA (Ribonucleic Acid) gene and application method thereof
CN105233304A (en) Application of long-chain non-coding RNA gene LOC553103 to preparation of nasopharyngeal darcinoma cell inhibitors
CN104878100A (en) Application of long-chain non-coding RNA AFAP1-AS1 in preparation of auxiliary diagnosis and prognosis judgment preparations for lung cancer
CN105200152A (en) Application of long-chain non-coding RNA (ribonucleic acid) gene LOC553103 in preparation of nasopharynx cancer prognosis preparation
CN105506154A (en) Application of long non-coding RNA LOC284454 reagent in in-situ hybridization detection of nasopharyngeal carcinoma tissues
CN105154446A (en) Application method of EB virus encoded microRNA BART10 antisense oligodeoxynucleotide
CN105602951B (en) The interference preparation of long-chain non-coding RNA LOC284454 and its application
CN105200156A (en) Application of long-chain non-coding RNA (ribonucleic acid) gene LOC553103
CN101928747B (en) Application of E3 ubiquitin ligase CHIP in gliomatosis cerebri disease
CN105154586A (en) Application method of EB virus encoded microRNA BART10
CN106492228A (en) The application of the siRNA of long-chain non-coding RNA LINC00673 and inhibitory preparation
CN105267987A (en) Application of long-chain non-coding RNA gene LOC553103 in preparation of gastric cancer cell inhibitor
CN105238882A (en) Application of EB virus encoded microRNA BART6-3p to preparation of nasopharyngeal cancer prognostic preparation
CN105200155A (en) Application of EBV (Epstein Barr Virus) encoded microRNA (micro ribonucleic acid) BART6-3p
CN105154524A (en) Application method of EB virus encoded EBER-1
CN105483273A (en) Application of reagent for detecting long-chain non-coding RNA LOC284454 expression quantity in serum of patients with nasopharynx cancer
CN106319044A (en) Biomarker for auxiliary diagnosis or curative effect prediction of nasopharyngeal carcinoma and application thereof
CN105288656A (en) Application of EB virus encoded microRNA BART6-3p in preparation of nasopharyngeal carcinoma cell inhibitor
CN105256017A (en) Application method of BTRC gene
CN104313158B (en) Primer, detectable and the application thereof of long-chain non-coding RNA LOC401317
CN104894244A (en) Primer, detection reagent and application of long-chain non-coded RNA AFAP1-AS1

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20151216

RJ01 Rejection of invention patent application after publication