CN105154445B - The serum miRNA marker of new muscular dystrophy myopathy - Google Patents

Abstract

The present invention provides the serum miRNA markers of new muscular dystrophy myopathy.Specifically, the present invention provides a kind of miRNA of separation or miRNA to gather, and the miRNA is selected from：Sequence such as SEQ ID NO.:MiRNA shown in 1；Sequence such as SEQ ID NO.:MiRNA shown in 2, and/or the miRNA with the complementation of its sequence.The present invention also provides chips and kit comprising above-mentioned sequence.Inspection proves that microRNA markers of the invention can effectively distinguish muscular dystrophy patient tissue sample and normal sample.And it can effectively distinguish DMD and BMD muscular dystrophy myopathies using the microRNA of the present invention.

Description

The serum miRNA marker of new muscular dystrophy myopathy

Technical field

The invention belongs to biomedicine fields, specifically, the present invention relates to the blood of two new muscular dystrophy myopathies Clear miRNA marker.

Background technology

Microrna (microRNA, abbreviation miRNA) is in recent years in nematode, drosophila and plant, the life of the eukaryons such as mammal A kind of endogenic length found in object is the single-stranded tiny RNA of non-coding of 22 nucleotide or so.It has group in expression The specificity with the time is knitted, the expression of gene is born on post-transcriptional level by the base pair complementarity with said target mrna Regulation and control, lead to degradation or the Translational repression of mRNA, are the important regulating and controlling molecules for adjusting the expression of other functional genes.More and more Evidence shows that miRNA is although small, but it is complete or not exclusively mutually unpaired to organism by being formed with said target mrna Various life processes have vital effect.Some miRNA have been demonstrated it is specific expressed in muscle, and in muscle Highly important effect is played in growth course.Specificity miRNA is by relying on into flesh factor of determination during muscle differentiation The function of MyoD, Mef2 and Myogenin come adjust muscle proliferation and differentiation between balance.MiR-208b and miR-499 In the introne of slow muscle Myosin heavy chain gene (Myh7 and Myh7b), the type of they and the differentiation of muscle fibre has close The relationship cut.

However, it has recently been demonstrated that being whether also able to detect that miRNA in the circulatory system of animal or people Be stabilized, and the variation of the miRNA type and quantity in these circulatory systems, the physiological and pathological situation phase with organism It closes.Thus the Potential feasibility that the miRNAs in the circulatory system has the non-invasive diagnosis marker of disease is disclosed.Pass through serum The discovery of miRNAs and the relationship of disease, and the further research to miRNAs targetings, and then some diseases are designed Novel therapeutic scheme.

There are many method for studying miRNA, and the most commonly used is use high-throughput chip to screen special, the present inventor institute Interested miRNA, the method for then using small throughput, such as real-time PCR, no rthernblot, label detect (glimmering Signal or nanometer particle to mark etc.) come to specific miRNA expression verify, in addition can also by situ hybridization come Detect spatial position and the timing of specific miRNA expression.Functionally, the no ckdown of k or overexpression can be passed through Method studies the relationship of miRNA and target gene, to illustrating concrete functions of the miRNA in organism.

Muscular dystrophy myopathy is a kind of lethal X- sex-linked recessive inheritance nerve muscle diseases.His main pathology is special Sign is that the deformation of skeletal muscle progressive is downright bad, fibrosis, fatty infiltration, then gradually loses locomotor activity finally breathing and heart Failure is dead.Incidence is about 1/3500 life birth boy baby.

This disease is since muscular dystrophy mutation causes protein expression shortage to cause.Dystrophin is one Kind cytoskeletal protein, muscle fibre is connected to the extracellular matrix of surrounding by it by cell membrane.When the hypoproteinosis, initially The weak necrosis of muscle fibre of damage, and along with the activity of a series of complex, including phagocytosis, inflammatory cell infiltration and then Fibrosis and fat substituted muscle so cause the atrophy of follow-up muscle fibre cause breathing or heart failure to make patient's mistake It is early dead.

The mutation of dystrophin gene, if leading to can to give expression to functional defect or lazy weight Dystrophin albumen, and the clinical manifestation of patient is relatively mildly then referred to as becker type muscular dystrophy disease (BMD)；If base Because mutation cause dystrophin hypoproteinosis and clinical manifestation it is serious then be duchenne muscular dystrophy (DMD).

Since currently without effective therapy for DMD patient, early to find, early contact co-treatment extends There is more importantly meaning in the time of its ambulation for the patient.Therefore, those skilled in the art are dedicated to developing It is a kind of accurately, quickly to detect DMD and judge the technology in its clinical development stage.

Invention content

It is an object of the invention to provide it is a kind of it is new, can be used for distinguishing muscular dystrophy patients with myopathy sample and normal sample This microRNA markers and application thereof.

It is a further object of the present invention to provide the chips and kit that detect the disease.

In the first aspect of the present invention, a kind of miRNA or miRNA set of separation is provided, the miRNA is selected from：

(i) sequence such as SEQ ID NO.:MiRNA shown in 1；

(ii) sequence such as SEQ ID NO.:MiRNA shown in 2, and/or

(iii) with (i) or (ii) shown in miRNA sequence complementation miRNA.

In another preferred example, the miRNA is isolated from people.

The second aspect of the present invention, provide a kind of separation or artificial constructed precursor miRNA, the precursor MiRNA can be sheared in people's cell and is expressed as miRNA as described in the first aspect of the invention or miRNA set.

The third aspect of the present invention, provides a kind of polynucleotides of separation, and the polynucleotides can be turned by people's cell Precursor miRNA is recorded into, the precursor miRNA can be sheared in people's cell and be expressed as miRNA as described in claim 1 Or miRNA set.

In another preferred example, the polynucleotides have structure shown in Formulas I：

Seq_{It is positive}-X-Seq_ReverselyFormulas I

In Formulas I,

Seq_{It is positive}For the nucleotide sequence of the miRNA can be expressed as in people's cell；

Seq_ReverselyFor with Seq_{It is positive}It is substantially complementary or the nucleotide sequence of complete complementary；

X is positioned at Seq_{It is positive}And Seq_ReverselyBetween intervening sequence, and the intervening sequence and Seq_{It is positive}And Seq_ReverselyNot mutually It mends；

And structure shown in Formulas I forms secondary structure shown in Formula II after being transferred to people's cell：

Formula II,

In Formula II, Seq_{It is positive}、Seq_ReverselyIt is as defined above and states with X,

| | it indicates in Seq_{It is positive}And Seq_ReverselyBetween the base pair complementarity relationship that is formed.

The fourth aspect of the present invention, provides a kind of carrier, and the carrier contains as described in the first aspect of the invention MiRNA, or the polynucleotides as described in third aspect present invention.

The fifth aspect of the present invention provides the purposes of the miRNA or miRNA set described in first aspect present invention, institute MiRNA or the miRNA set stated are used to prepare the chip or kit for distinguishing DMD samples, BMD samples and normal sample.

The sixth aspect of the present invention, provides a kind of miRNA chips, and the miRNA chips include：

Solid phase carrier；And

The oligonucleotide probe being orderly fixed on the solid phase carrier, the oligonucleotide probe specifically correspond to In SEQ ID NO.:1 and/or SEQ ID NO.:Sequence shown in 2.

In another preferred example, the oligonucleotide probe contains：

Complementary combined area；And/or

The bonding pad being connected with solid phase carrier.

The seventh aspect of the present invention provides a kind of purposes of the miRNA chips described in sixth aspect present invention, described MiRNA chips are used to prepare the kit for distinguishing DMD samples, BMD samples and normal sample.

The eighth aspect of the present invention provides a kind of kit, contains sixth aspect present invention institute in the kit The miRNA chips stated；Or

MiRNA described in first aspect present invention or miRNA set.

The ninth aspect of the present invention provides a kind of side for screening the drug candidate for treating muscular dystrophy myopathy Method, including step：

(a) test group and a control group are provided, wherein candidate substances are applied to test group in the test group Cell or animal, and the expression of miR-499 and/or miR-208b in the test group after application is measured, and pair According to group use condition identical with test group, but candidate substances are not applied to cell or the animal of control group；

(b) by the expression of the miR-499 of test group and/or miR-208b and the miR-499 and/or miR-208b of control group Level is compared；

Wherein, when the expression of the miR-499 of test group and/or miR-208b is substantially less than the expression of control group When, then show that the candidate substances are the drug candidates for treating DMD.

The tenth aspect of the present invention provides a kind of method of diagnosis muscular dystrophy myopathy, including step：

(a) expression of miR-499 and/or miR-208b in sample is detected；

(b) according to the testing result of step (a), judge whether the sample of detection comes from muscular dystrophy patients with myopathy, sentence Disconnected method is：

If miR-499 expressions are higher than the expression in normal sample, and/or

If the expression of miR-208b is higher than the expression in normal sample,

Then judge that the detection sample comes from DMD patient.

In another preferred example, it if the miR-499 expressions are higher than 3 times of normal sample, is preferably higher than just 4 times of normal sample are more preferably higher than 5 times of normal sample, and being most preferably higher than 6.5 times of normal sample, (specificity reaches 100%, 100%) sensitivity reaches；And/or

If the expression of miR-208b is higher than 2 times of normal sample, (specificity reaches 90%, and sensitivity reaches 95%), more preferably it is higher than 3 times of normal sample,

Then judge that the detection sample comes from muscular dystrophy patients with myopathy.

The expression of miR-499 and/or miR-208b in normal sample mentioned in the present invention is normal sample The average value of middle miR-499 and/or miR-208 expressions.

The eleventh aspect of the present invention provides a kind of method that DMD and BMD muscular dystrophy myopathies are distinguished in diagnosis, packet Include step：

(a) expression of miR-499 and/or miR-208b in sample is detected；

(b) according to the testing result of step (a), judge whether the sample of detection comes from DMD patient or BMD patient, sentence Disconnected method is：

If miR-499 expressions are higher than the expression in BMD samples, and/or

If the expression of miR-208b is higher than the expression in BMD samples,

Then judge that the detection sample comes from DMD patient.

In another preferred example, the miR-499 expressions higher than 27 times of normal average value (specificity reaches 92%, 43%) sensitivity reaches；And/or

If the expression of miR-208b is higher than 4.5 times of normal average value, (specificity reaches 83%, and sensitivity reaches 62%),

Then judge that the detection sample comes from DMD patient rather than BMD patient.

It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment) It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist This no longer tires out one by one states.

Description of the drawings

Fig. 1 shows variations of the miRNA in muscular dystrophy patients serum, figure A show miR-499 myotrophy not Variation in good patients serum；Figure B shows variations of the miR-208b in muscular dystrophy patients serum.

Fig. 2 shows miRNA (figure A：miR-499；Scheme B：MiR-208b) for the ROC of normal person, BMD and DMD patients Curve.

Fig. 3 shows correlations of the miRNA with the age.

Fig. 4 shows correlation of the muscle fibre with the age.

Fig. 5 shows expression variations of the miRNA in change lever.

Fig. 6 shows the correlation of serum miRNA and IIc type muscular fiber types in DMD infants.

Fig. 7 shows the correlation of serum miRNA and I type muscular fiber types in DMD infants.

Specific implementation mode

The present inventor widely studies by long-term, by detecting muscular dystrophy clinical samples serum and normal sample The microRNA express spectras of serum are horizontal, therefrom filter out the microRNA of specificity for the first time：MiR-499 and miR-208b.Through Testing identity, miR-499 and miR-208b can effectively distinguish muscular dystrophy patient group as microRNA markers Knit sample and normal sample.And it can effectively distinguish DMD and BMD muscular dystrophy fleshes using the microRNA of the present invention Disease.The present invention is completed on this basis.

The microRNA can be predicted sample be come from DMD samples or normal sample, prediction accuracy reach 80% with On.Based on the microRNA of the present invention, kit can be developed into, for distinguishing DMD samples and normal sample.

MiRNA and its precursor

The present invention provides a new class of miRNA (microRNA) found from people.As used herein, described " miRNA " refers to a kind of RNA molecule, is processed from the transcript that can form miRNA precursors.Ripe miRNA usually has 18-26 nucleotide (nt) (more particularly about 19-22nt), is also not excluded for the miRNA molecule with other number nucleotide. MiRNA can usually be detected by no rthern traces.

MiRNA is a kind of tiny RNA of the sources Inner property, is expressed in post-transcriptional level controlling gene.More and more evidences show MiRNAs plays important regulating and controlling effect in musculature, including the proliferation of muscle, differentiation, development and some are relevant The occurrence and development etc. of muscle disease.Research in recent years is found, in addition to organizing and the miRNA in cell, the expression of peripheral blood miRNA There is significant correlation, specificity and stability with many diseases, meet the requirement of disease diagnosis marker.The present inventor is logical Cross the table for comparing normal mouse and miR-208b and miR-499 in Duchenne muscular dystrophy mouse model mdx mice serums Up to variation, two kinds of muscular dystrophy myopathy DuchenneShi muscular dystrophy (DMD) and Becker'sShi muscular dystrophy (BMD) Patient respectively in the serum of normal infant miRNA expression change, while also analyze the two miRNA serum expressions with The correlation of the different Muscle fiber density of patient, and then miR-208b and miR-499 can be very good identification myotrophy not certainly The patient of good myopathy.Also, it can reflect the Muscular pathology situation of patient in certain age level the two miRNA.

The miRNA (miR-208b and miR-499) being enriched in two kinds of muscle mentioned in the present invention can also be used as DMD and examine Disconnected serum biomarkers.And expression and their age of the miR-208b and miR-499 in 2 to 6 years old patients serums And muscle fibre parting has close correlation.Thus propose that the two miRNA being enriched in muscle act not only as DMD The diagnosis marker of disease and can be also used for speculating the disease pathological change and one of process development it is effective raw Object index.

In a preferred example, miR-208b nucleic acid sequences of the present invention are：

UUAAGACUUGCAGUGAUGUUU(SEQ ID NO.:1)

In enabling a preference, miR-499 nucleic acid sequences of the present invention are：

AUAAGACGAACAAAAGGUUUGU(SEQ ID NO.:2)

The miRNA of people source can be detached from people's cell.As used herein, " separation " refers to substance from its original ring It is separated in border (if it is crude, primal environment is natural surroundings).Under the native state in active somatic cell Polynucleotide and polypeptide do not isolate and purify, but same polynucleotide or polypeptide are deposited together such as from native state Other substances in separate, then isolate and purify.

MiRNA can be processed from precursor miRNA (Precursor miRNA, Pre-miRNA), the precursor miRNA It is can be folded into a kind of stem ring of stabilization (hair clip) structure, the loop-stem structure length is generally between 50-100bp.Described Precursor miRNA can be folded into stable loop-stem structure, and the stem both sides of loop-stem structure include the two sequences being substantially complementary.Institute The precursor miRNA stated can be natural or artificial synthesized.

Precursor miRNA, which can be sheared, generates miRNA, and the miRNA can be at least part of the mRNA of encoding gene Sequence is substantially complementary.As used herein, " be substantially complementary " refer to nucleotide sequence be it is enough complementary, can be with one kind Foreseeable mode interacts, and such as forms secondary structure (such as loop-stem structure).In general, the core of two " being substantially complementary " Nucleotide sequence from each other at least 70% nucleotide be complementary；Preferably, at least 80% nucleotide is complementary； It is furthermore preferred that at least 90% nucleotide is complementary；It is further preferred that at least 95% nucleotide is complementary； Such as 98%, 99% or 100%.Usually, there can be most 40 unmatched nucleosides between two molecules complementary enough Acid；Preferably, there are most 30 unmatched nucleotide；It is furthermore preferred that having most 20 unmatched nucleotide；Into one Step is preferred, has most 10 unmatched nucleotide, such as has 1,2,3,4,5,8,11 unmatched nucleotide.

As used herein, " stem ring " structure is also referred to as " hair clip " structure, refers to a kind of nucleic acid molecule, can form one Kind includes the secondary structure of double-stranded region (stem), and the double-stranded region (is located at same by two regions of the nucleic acid molecule On one molecule) it is formed, the both sides of row double stranded section are divided in two regions；It further includes at least one " ring " structure, including incomplementarity Nucleic acid molecule, i.e. single-stranded regions.Even if two regions of the nucleic acid molecule are not complete complementary, the double-strand of nucleotide Part can also keep double-stranded state.For example, insertion, missing, substitution etc. can lead to not complementary or zonule of a zonule Itself forms the secondary structure of loop-stem structure or other forms, however, two regions can be still substantially complementary, and is being contemplated that Mode in interact, form the double-stranded region of loop-stem structure.Loop-stem structure be it is well-known to those skilled in the art, Usually after the nucleic acid for obtaining a nucleotide sequence with primary structure, those skilled in the art can determine the nucleic acid Whether loop-stem structure can be formed.

MiRNA of the present invention has such as SEQ ID NO.:Sequence shown in 1.In order to improve miRNA stability or Other properties can also add at least one protectiveness base, such as " TT " at least one end of the miRNA.

Antisense oligonucleotides

According to miRNA sequence provided by the present invention, its antisense oligonucleotides, antisense widow's core can be designed that Thuja acid can lower the expression of corresponding miRNA in vivo.As used herein, " antisense oligonucleotides (antisense- Oligonucleotides, AS-Ons or ASO) " be also known as " GEM 132 ", refer to length be about 18-26nt (more particularly About 19-22nt) DNA molecular or RNA molecule or its analog.

In the present invention, " antisense oligonucleotides " further includes using as based on nucleic acid lock or nucleic acid chains backbone modification The modified GEM 132 that the means such as technology obtain, the modification do not change the activity of antisense oligonucleotides substantially, more Goodly, described to modify the stability, activity or therapeutic effect that antisense oligonucleotides can be improved.Nucleic acid locks (locked nucleic Acid, LNA) typically refer to the modification skill for 2 ' oxygen atoms of ribose and 4 ' carbon atoms being connected by a methylene bridge Art.LNA can extend the serum half-life of miRNA, improve to target compatibility, reduce the range and degree of effect of missing the target.It is based on The antisense drug that the modification technique of nucleic acid chain backbone develops is in solubility, and nuclease-resistant degradation etc. is big improvement, and easily In a large amount of synthesis.There are many backbone modification methods of oligonucleotides, including thio method, such as by deoxynucleotide chain thio-modification For thio deoxynucleotide chain.This method is to substitute the oxygen atom of the phosphate bond on DNA skeletons with sulphur atom, can resist nucleic acid Enzyme is degraded.It should be understood that any largely or entirely active modification that can keep the antisense oligonucleotides is included in this In invention.

As the preferred embodiment of the present invention, nucleic acid lock modification is carried out to antisense oligonucleotides；More preferably also carry out thio repair Decorations.

After antisense oligonucleotides of the present invention transfer into the human body, they can obviously lower related miRNA's Expression.

Polynucleotides construction

According to miRNA sequence provided by the present invention, can design can be processed to influence after being imported into accordingly The polynucleotides construction namely the polynucleotides construction of the miRNA of mRNA expression can raise accordingly in vivo The amount of miRNA.Therefore, the present invention provides a kind of polynucleotides of separation (construction), the polynucleotides (construction) Precursor miRNA can be transcribed by people's cell, the precursor miRNA can be sheared by people's cell and be expressed as the miRNA.

As a kind of preferred embodiment of the present invention, the polynucleotides construction contains structure shown in Formulas I：

Seq_{It is positive}-X-Seq_Reversely

Formulas I

In Formulas I,

Seq_{It is positive}For the nucleotide sequence of the miRNA, Seq can be expressed as in cell_ReverselyFor with Seq_{It is positive}Substantially mutually The nucleotide sequence of benefit；Alternatively, Seq_ReverselyFor the nucleotide sequence of the miRNA, Seq can be expressed as in cell_{It is positive}For with Seq_{It is positive}The nucleotide sequence being substantially complementary；

X is positioned at Seq_{It is positive}And Seq_ReverselyBetween intervening sequence, and the intervening sequence and Seq_{It is positive}And Seq_ReverselyNot mutually It mends；

Structure shown in Formulas I forms secondary structure shown in Formula II after being transferred to cell：

Formula II

In Formula II, Seq_{It is positive}、Seq_ReverselyIt is as defined above and states with X；

| | it indicates in Seq_{It is positive}And Seq_ReverselyBetween the base pair complementarity relationship that is formed.

In general, the polynucleotides construction is located on expression vector.Therefore, the invention also includes a kind of carrier, it Contain the miRNA or the polynucleotides construction.The expression vector usually also contains promoter, replicates Point and/or marker gene etc..Method well-known to those having ordinary skill in the art can be used to build the required expression vector of the present invention.This A little methods include recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology etc..The expression vector preferably includes One or more selected markers, to provide the phenotypic character of the host cell for selecting conversion, such as kalamycin, celebrating Big mycin, hygromycin, amicillin resistance.

Chip

MicroRNA chip of expression spectrum usually contains up to hundreds of probes, covers a variety of microRNA, utilizes DNA double chain The principle of homologous complementary detects the content of contained various microRNA in sample in full-length genome level.It therefore, can be same Time is detected the transcriptional level of the microRNA within the scope of full-length genome in sample to be tested.

Using miRNA sequence of the present invention, corresponding miRNA chips can also be prepared, and then study its express spectra And the regulative mode of miRNAs.

On the other hand, the present invention also provides a kind of chip for analyzing miRNA express spectras, the chip can be used for Distinguish DMD samples and normal sample.

The few core that the miRNA chips of the present invention include solid phase carrier and are orderly fixed on the solid phase carrier Thuja acid probe, the oligonucleotide probe include SEQ ID NO.:Sequence shown in 1.

Specifically, can miRNA according to the present invention, design suitable probe, be fixed on solid phase carrier, formed " oligonucleotide arrays "." oligonucleotide arrays " refer to addressable point (i.e. with distinctive, addressablely The position that location is characterized) array, each addressable point contains there are one coupled characteristic oligonucleotides.According to need It wants, oligonucleotide arrays can be divided into multiple sub- battle arrays.

The various common used materials in genetic chip field, such as, but not limited to nylon membrane can be used in the solid phase carrier, through work Property group (such as aldehyde radical, amino) slide modified or silicon chip, unmodified slide, plastic sheet etc..

The conventional manufacturing method of biochip known in the art can be used in the preparation of the miRNA chips.For example, such as Fruit solid phase carrier is gone here and there using modification slide or silicon chip, 5 ' ends of probe containing amido modified poly- dT, can be by oligonucleotides Probe is configured to solution, then uses point sample instrument that its point on modification slide or silicon chip, is arranged in scheduled sequence or array, Then it is fixed by standing overnight, so that it may obtain the miRNA chips of the present invention.If nucleic acid is without amido modified, system Preparation Method can also refer to：Wang Shenwu chief editors'《Gene diagnosis technology-on-radiation operation manual》；J.L.erisi, V.R.Iyer,P.O.BROWN.Exploring the metabolic and genetic control of gene Expression on a ge no mic scale.Science, 1997；278:680 and Ma Li people, Jiang Zhonghua edit biology cores The Beijing piece：Chemical Industry Press, 2000,1-130.

On the other hand, the present invention also provides a kind of sides for detecting miRNA express spectras in people's tissue by miRNA chips Method, including step：

(1) RNA sample for being isolated from people's tissue, the setting flag object on the RNA are provided；

(2) RNA of (1) is contacted with the chip, the oligonucleotide probe on the RNA and solid phase carrier is made to send out Raw hybridization reaction, to form " oligonucleotide probe-RNA " binary complex on solid phase carrier；

(3) marker for the binary complex that detection (2) is formed, so that it is determined that the expression of miRNA accordingly in people's tissue Spectrum.

It is method well known to those skilled in the art, including Trizol methods to extract the method for RNA in being organized from people.

It is furthermore preferred that in step (1), after isolating RNA sample in people's tissue tissue, RNA sample is fitted Work as processing, to be enriched with the RNA with certain length, the length (small fragment RNA) generally between 10-100.By above-mentioned After processing, subsequent hybridization is carried out using these small fragment RNAs, the accuracy of chip capture miRNA can be improved in this way.This field Personnel can be conveniently separated the RNA for providing certain fragment length, for example gel electrophoresis can be used to detach.

It is also method well known to those skilled in the art that RNA, which is marked, can be special with RNA by being added in hybridization The method for the marker that the opposite sex combines realizes that the marker is such as labelling groups.The labelling groups include but unlimited In：Digoxin molecule (DIG), biotin molecule (Bio), fluorescein and its derivative biomolecule (FITC etc.), other fluorescence point Sub (such as Cy3, Cy5), alkaline phosphatase (AP), horseradish peroxidase (HRP) etc..These labels and its labeling method are all It is routine techniques well-known in the art.

When above-mentioned RNA is hybridized with miRNA chips, first miRNA chips and pre-hybridization buffer can be carried out Prehybridization.

Solid-phase hybridization between RNA and miRNA chips of the present invention is carried out according to the classical way of this field, ability Domain general staff is empirically easy to determine related buffer solution, probe and concentration of specimens, prehybridization temperature, hybridization temperature with timely Between equal optimum condition.Or it can also reference《Molecular Cloning:A Laboratory guide》Described in.

Then the acquisition of information such as position, intensity according to marking signal on miRNA chips wait for measurement information.If amplified production It is marked with fluorophor, fluorescence detection device (such as laser confocal scanner Scanarray3000) also can directly be used to obtain Wait for measurement information.

Detection kit

The present invention also provides a kind of kit, the chip containing the present invention in the kit.The kit It can be used for detecting the express spectra of miRNA；Or for distinguishing DMD samples and normal sample, it is preferred that also contain in the kit It is useful for the marker of labeled RNA sample, and substrate corresponding with the marker.

In addition, may also include in the kit for extracting the various reagents needed for RNA, PCR, hybridization, colour developing etc., Including but not limited to：Extract, amplification liquid, hybridization solution, enzyme, comparison liquid, developing solution, washing lotion, antibody etc..

In addition, may also include operation instructions and/or chip image analysis software in the kit.

Diagnostic method

On the one hand, the method for diagnosis muscular dystrophy myopathy provided by the invention, including step：

(a) expression of miR-499 and/or miR-208b in sample is detected；

(b) according to the testing result of step (a), judge whether the sample of detection comes from muscular dystrophy patients with myopathy, sentence Disconnected method is：

If miR-499 expressions are higher than the expression in normal sample, and/or

If the expression of miR-208b is higher than the expression in normal sample,

Then judge that the detection sample comes from muscular dystrophy patients with myopathy.

In another preferred example, it if the miR-499 expressions are higher than 3 times of normal sample, is preferably higher than just 4 times of normal sample are more preferably higher than 5 times of normal sample, and being most preferably higher than 6.5 times of normal sample, (specificity reaches 100%, 100%) sensitivity reaches；And/or

If the expression of miR-208b is higher than 2 times of normal sample, (specificity reaches 90%, and sensitivity reaches 95%), more preferably it is higher than 3 times of normal sample,

Then judge that the detection sample comes from muscular dystrophy patients with myopathy.

The expression of miR-499 and/or miR-208b in normal sample mentioned in the present invention is normal sample The average value of middle miR-499 and/or miR-208 expressions.

On the other hand, the present invention provides a kind of methods that DMD and BMD muscular dystrophy myopathies are distinguished in diagnosis, including step Suddenly：

(a) expression of miR-499 and/or miR-208b in sample is detected；

(b) according to the testing result of step (a), judge whether the sample of detection comes from DMD patient or BMD patient, sentence Disconnected method is：

If miR-499 expressions are higher than the expression in BMD samples, and/or

If the expression of miR-208b is higher than the expression in BMD samples,

Then judge that the detection sample comes from DMD patient.

In another preferred example, the miR-499 expressions higher than 27 times of normal average value (specificity reaches 92%, 43%) sensitivity reaches；And/or

If the expression of miR-208b is higher than 4.5 times of normal average value, (specificity reaches 83%, and sensitivity reaches 62%),

Then judge that the detection sample comes from DMD patient rather than BMD patient.

Main advantages of the present invention

(a) the present invention provides a kind of microRNA marks can be used for distinguishing muscular dystrophy myopathy sample and normal sample Will object.

(b) muscular dystrophy myopathy sample and normal sample can effectively be distinguished by microRNA markers of the present invention This.

(c) microRNA markers of the present invention can also judge that sample to be detected comes from DMD patient or BMD patient.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and Number is calculated by weight.

1 experiment material of embodiment and method

(1) human serum sample collects the detection with clinical indices

23 serum samples of 15 BMD and 52 patients DMD and control group used in experiment acquire big from Fudan University Attached pediatric hospital is learned, this research is approved by paediatrics clinical pharmacology Ethics Committee of Fudan University, and possesses patient's Informed consent form.Serum keeping is in -80 DEG C of refrigerators.ATP enzyme dyeing simultaneously has counted the different types of Muscle fiber density of patient, faces Bed biochemical system has detected the level of creatine kinase CK in infant serum.

(2) extracting of RNA is detected with real-time quantitative PCR

Serum miRNA is extracted by the serum miRNA extraction agent boxes of Tiangeng company.RNA reverse transcriptions pass through neck ring structure Inverting method transcription, finally by real-time quantitative PCR detect serum in miRNA expression change.

(3) statistical method

The variance analysis for comparing two groups of experimental groups is analyzed by t-test, and p value is considered to have notable change less than 0.05 Change.The assessment as diagnosis effect of ROC curve.Region area below ROC curve is used as diagnosis marker discrimination Basic accuracy, correlation pass through perarson check analyses.

2 blood serum designated object of embodiment screens

(1) selection of miRNA

The miRNA expressed from tissue miRNA chip of expression spectrum screening musculature height, analyzes the document reported, determines The miRNA of research is miR-208b and miR-499.

(2) extracting of serum miRNA

4 DEG C of the blood plasma of collection is stood 15 minutes, then 4 DEG C, it is spare that 3000 × rpm centrifugations 30min takes serum to retain.

A. sample treatment：Isometric lysate MZ is often added in pipe serum, oscillator shakes mixing 30s.

B. it is placed at room temperature for 5min so that nucleic acid-protein compound is kept completely separate.

C. room temperature 12,000rpm (~13,400 × g) centrifuge 10min, take supernatant, are transferred to a new EP without RNase Guan Zhong.

D. addition and the isometric chloroform of serum, cover pipe lid, acutely vibrate 15s, be placed at room temperature for 5min.

E. room temperature 12,000rpm (~13,400 × g) centrifuge 15min, and the water phase on upper layer is transferred to newly by three layers of sample point Guan Zhong.

F. the volume for measuring transfer liquid, is slowly added to the absolute ethyl alcohol that transfer liquid accumulates 1/3 volume, and mixing (at this time may It precipitates).Obtained solution and precipitation are transferred to adsorption column miRspin together, are placed at room temperature for 2min, room temperature 12,000rpm (~13,400 × g) centrifuges 30s, and efflux and adsorption column miRspin (adsorption column transfers all to the end are retained after centrifugation Liquid centrifugation discards after completing).

G. effluent volume is measured, the absolute ethyl alcohol of 2/3 volume of effluent volume is slowly added to, mixing (may go out at this time It now precipitates).Obtained solution and precipitation are transferred to adsorption column miRelute together, are placed at room temperature for 2min, room temperature 12,000rpm (~13,400 × g) centrifuges 30s, and efflux is discarded after centrifugation, retains adsorption column miRelute.

H. the protein liquid removal MRD (check whether and ethyl alcohol is added) of 500 μ l is added into adsorption column miRelute, is stored at room temperature 2min, room temperature 12,000rpm (~13,400 × g) centrifuge 30s, abandon waste liquid.

I. the rinsing liquid RW (check whether and ethyl alcohol is added) of 600 μ l is added into adsorption column miRelute, is stored at room temperature 2min, room temperature 12,000rpm (~13,400 × g) centrifuge 30s, abandon waste liquid.

J. step (9) is repeated.

K. adsorption column miRelute is put into collecting pipe, room temperature 12,000rpm (~13,400g) centrifuges 1min, removal Residual liquid.(note：The purpose of this step is to remain remaining rinsing liquid removal in adsorption column, after may influencing if any rinsing liquid The experimental implementations such as continuous RT) while by the ddH of RNase-free₂O is preheating to 50~60 DEG C.

L. adsorption column miRelute is transferred in the EP pipes of a new 1.5ml, is added the RNase-free's of 20 μ l ddH₂O is placed at room temperature for two minutes, room temperature 12, and 000rpm (~13,400g) centrifuges 2min.

M. step l) is repeated, the yield of RNA is improved.- 80 DEG C save backup.

(3) qRT-PCR is detected

A. it inverts

MicrRNA reversions use stem-loop to invert system in this experiment

From miRNA Database：http:It is as follows that sequence is found out in //microrna.sanger.ac.uk/：

miR-208b：AUAAGACGAACAAAAGGUUUGU

miR-499:UUAAGACUUGCAGUGAUGUUU

Then the forward primer and universal primer of the two miRNA are designed

Reverse transcriptase primer (RT-Primer)：

miR-208b RT-primer：

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAAACCT

miR-499RT-primer：

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAACATCA

Real-time PCR primers：

miR-208b primer：ACACTCCAGCTGGGATAAGACGAACAAAAG

miR-499primer：ACACTCCAGCTGGGTTAAGACTTGCAGTGA

Universal primer Universal primer：CTCAAGTGTCGTGGAGTCGGCAA

Prepare PCR reaction systems

(2) RT-PCR response procedures

1	42℃	15min
			2	95℃	2min
3	16℃	0min

After the completion of reversion, cDNA is diluted, mixing, be stored in -20 DEG C it is spare.

b.Real-time PCR

Internal reference used in serum miRNA is miR-223 in relative quantification.

Reaction system and program

(4) muscle fibre parting ATP enzyme dyes

A. the beaker for filling isopentane is put into liquid nitrogen, is not submerged, it is in liquid to be frozen into below isopentane above solid It can start to freeze the musculature that gum tragacanth fixes when state.

B. carefully the organization embedding block of freezing is taken out, is put into rapidly in the container of precooling and is sealed and stored or does in time ice Freeze slice.Or in -80 DEG C or less long-term preservations.

C. frozen section 8-10um is respectively put into the preincubate liquid of three kinds of different PHs, 15 minutes at room temperature, 5 minutes, 5 minutes.PH value is respectively 10.5,4.6 and 4.2.

D. barbital sodium liquid (PH9.4-9.7) is added gently to clean within 30 seconds to 1 minute.

E. Incubating Solution 45 minutes, 37 DEG C is added.

F.1% calcium chloride washes 3 times 3 minutes every time.

G.2% cobalt chloride reacts 3 minutes.

H. 33 minutes/time of distillation washing.

I.1% ammonium sulfide (used time preparation) 1 minute.

J. flowing water rinses.

K. dehydration of alcohol at different levels, transparent, mounting.

L. microscopically observation PH is that 10.5 to dye black be II type muscle fibres, white for I type muscle fibres；PH is 4.6 to dye black be I type muscle fibres, and white is IIa type muscle fibres, in view of between the two for IIb and IIc muscle fibres；PH It is IIa or IIb muscle fibres for 4.2 white colourings, in view of between the two for IIc muscle fibres.

M. preincubate liquid：

Barbital sodium PH is 10.5：20mM barbital sodiums, the calcium chloride of 18mM；

Acetate buffer solution PH is 4.6：50mM sodium acetates, the barbital sodium of 30mM are adjusted to pH value with hydrochloric acid and are adjusted to 4.6.

Acetate buffer solution PH is 4.2：Ibid only pH value is adjusted to 4.2.

Experimental result

Variations of 1 miRNA in muscular dystrophy patients serum

The present inventor have collected the age from 1 to 14 year old between 23 healthy childrens and two classes of muscular dystrophy suffer from The serum sample of the BMD and 52 DMD patient in youngster i.e. 15, the information such as related infant gene diagnosis are summarised in table 1.Fig. 1 is shown Variations of the miRNA in muscular dystrophy patients serum.It can be seen from the figure that miR-208b and miR-499 are in BMD and DMD Notable raising is expressed in patients serum.Further prompt these serum of the present inventor miRNA can be as the latent of this kind of disease New serum biological marker possibility.

1 patient information of table

Patient code

Disease type

Age (moon)

Whether can walk about

Hormone therapy

Muscle biopsy

Annotation

BMD-01

BMD

11

It is

It is no

It is

MFT:N/A

BMD-02

BMD

24

It is

It is no

It is

MFT:N/A

BMD-03

BMD

36

It is

It is no

It is

MFT:N/A

BMD-04

BMD

36

It is

It is no

It is

BMD-05

BMD

36

It is

It is no

It is

BMD-06

BMD

40

It is

It is no

It is

MFT:N/A

BMD-07

BMD

48

It is

It is no

It is

BMD-08

BMD

55

It is

It is no

It is

MFT:N/A

BMD-09

BMD

56

It is

It is no

It is

MFT:N/A

BMD-10

BMD

75

It is

It is no

It is

MFT:N/A

BMD-11

BMD

98

It is

It is no

It is

MFT:N/A

BMD-12

BMD

101

It is

It is no

It is

BMD-13

BMD

110

It is

It is no

It is

BMD-14

BMD

120

It is

It is no

It is

BMD-15

BMD

165

It is

It is no

It is

MFT:N/A

DMD-01

DMD

7

It is

It is no

It is

DMD-02

DMD

8

It is

It is no

It is

DMD-03

DMD

15

It is

It is no

It is

DMD-04

DMD

17

It is

It is no

It is

DMD-05

DMD

18

It is

It is no

It is

MFT:N/A

DMD-06

DMD

22

It is

It is no

It is

DMD-07

DMD

24

It is

It is no

It is

DMD-08

DMD

24

It is

It is no

It is

MFT:N/A

DMD-09

DMD

31

It is

It is no

It is

MFT:N/A

DMD-10

DMD

36

It is

It is no

It is

DMD-11

DMD

36

It is

It is no

It is

DMD-12

DMD

36

It is

It is no

It is

DMD-13

DMD

40

It is

It is no

It is

MFT:N/A

DMD-14

DMD

43

It is

It is no

It is

DMD-15

DMD

43

It is

It is no

It is

DMD-16

DMD

46

It is

It is no

It is

DMD-17

DMD

46

It is

It is no

It is

DMD-18

DMD

48

It is

It is no

It is

DMD-19

DMD

51

It is

It is no

It is

DMD-20

DMD

52

It is

It is no

It is

MFT:N/A

DMD-21

DMD

55

It is

It is no

It is

DMD-22

DMD

55

It is

It is no

It is

MFT:N/A

DMD-23

DMD

59

It is

It is no

It is

DMD-24

DMD

62

It is

It is no

It is

MFT:N/A

DMD-25

DMD

65

It is

It is no

It is

DMD-26

DMD

66

It is

It is no

It is

DMD-27

DMD

67

It is

It is no

It is

MFT:N/A

DMD-28

DMD

68

It is

It is no

It is

DMD-29

DMD

73

It is

It is no

It is

DMD-30

DMD

77

It is

It is no

It is

DMD-31

DMD

77

It is

It is no

It is

DMD-32

DMD

79

It is

It is no

It is

DMD-33

DMD

82

It is

It is no

It is

MFT:N/A

DMD-34

DMD

83

It is

It is no

It is

MFT:N/A

DMD-35

DMD

84

It is

It is no

It is

DMD-36

DMD

90

It is

It is no

It is

DMD-37

DMD

90

It is

It is no

It is

DMD-38

DMD

90

It is

It is no

It is

MFT:N/A

DMD-39

DMD

92

It is

It is no

It is

MFT:N/A

DMD-40

DMD

92

It is

It is no

It is

MFT:N/A

DMD-41

DMD

93

It is

It is no

It is

MFT:N/A

DMD-42

DMD

94

It is

It is no

It is

MFT:N/A

DMD-43

DMD

96

It is

It is no

It is

MFT:N/A

DMD-44

DMD

96

It is

It is no

It is

MFT:N/A

DMD-45

DMD

96

It is

It is no

It is

MFT:N/A

DMD-46

DMD

98

It is

It is no

It is

MFT:N/A

DMD-47

DMD

104

It is

It is no

It is

DMD-48

DMD

104

It is

It is no

It is

MFT:N/A

DMD-49

DMD

125

It is

It is no

It is

DMD-50

DMD

128

It is

It is no

It is

DMD-51

DMD

138

It is no

It is no

It is

MFT:N/A

DMD-52

DMD

144

It is

It is no

It is

DMD-53

DMD

41

It is

It is no

It is

miRNAs:N/A

DMD-54

DMD

56

It is

It is no

It is

miRNAs:N/A

DMD-55

DMD

60

It is

It is no

It is

miRNAs:N/A

DMD-56

DMD

92

It is

It is no

It is

miRNAs:N/A

DMD-57

DMD

151

It is

It is no

It is

miRNAs:N/A

Note：N/A:In vain；MFT:Muscular fiber type

Assessments of the 2 serum miRNA as the diagnostic marker of muscular dystrophy

It is analyzed by Receiver Operating Characteristics (ROC) curve (Fig. 2), miR-499 and miR-208b can be good at distinguishing Normal child and muscular dystrophy patient, especially DMD infants (AUC：0.9913 and 0.9130, P is equal<0.0001), at the same he Can also distinguish BMD and DMD patient (AUC well:0.6987 and 0.7115, P=0.0198 and P=0.0131).

Fig. 2 shows ROC curves of the miRNA for normal person, BMD and DMD patients, as shown, 52 DMD patients 15 The ROC curve of example BMD patient and 23 normal children, that the numerical value in figure indicates is area under a curve AUC.It is wherein blue, Red and green curve indicates DMD and normal child, the ROC curve of BMD and normal child and BMD and DMD respectively.From Fig. 2A In it can be seen that the horizontal height of serum miR-499 can be very good to distinguish DMD and normal child (AUC=0.99, p<0.0001), BMD and normal child (AUC=0.9913, p can also be distinguished well<0.001), also have for differentiation BMD and DMD certain It is worth (AUC=0.6987, p=0.0198)；It can be seen that the horizontal height of serum miR-208b can be very good area from Fig. 2 B Divide DMD and normal child (AUC=0.9323, p<0.001) BMD and normal child (AUC=, can also be distinguished well 0.913, p<0.001) slightly higher (AUC=0.7115, p=, are worth for miR-499 for distinguishing BMD and DMD 0.0131).These results indicate that the level of serum miR-499 and miR-208b can not only distinguish normal child and DMD/ BMD, and also have clinical reference value for distinguishing DMD and BMD.

The correlation of 3 serum miRNA, muscle fibre and age

DMD patient's cardinal symptom is that gradual degeneration of skeletal muscle is downright bad, and cardiac muscle is gradually by fibrous tissue replacement, fat leaching Profit, it is dead eventually by breathing or heart failure.In order to further confirm that, the horizontal of miRNA can be with the process phase of disease in serum Association, the present inventor analyzes the correlation between age and serum miRNA first.As miR-499 in the serum that Fig. 3 is shown It is just proportionate with the age when (2-6 Sui) in the period of infant early diagnoses with the expression of miR-208b, and at this section The fast muscle fiber percentage (IIa types and IIb types) of interior patient is reduced, this with clinically observe in patient's early stage fast muscle fiber It necroses first consistent.Simultaneously the inventors discovered that the IIc types Muscle fiber density with regenerated fiber characteristic is at this age (Fig. 4) is gradually increased in section, thus illustrates that the two miRNA levels in serum may be with muscle damage severity and muscle The case where regeneration, is related.

Fig. 3 shows correlations of the miRNA with the age, as can be seen from the figure with the increase miR-499 at age and MiR-208b expressions increase.

Fig. 4 shows correlation of the muscle fibre with the age, as can be seen from the figure with the increase fast muscle fiber hundred at age Divide and is reduced than (IIa types and IIb types) and the IIc type Muscle fiber densities with regenerated fiber characteristic increase.

Table 2 and table 3 respectively illustrate between the level and muscle fiber types and different age group of the two serum miRNA Correlation summarize.As can be seen from the table, CK in different age brackets with the age do not have correlation, miR-499 and MiR-208b has positive correlation, and IIa+IIb types Muscle fiber density during this period during DMD patient is 2-6 Sui with the age It is negatively correlated with the age, and IIc types muscle fibre is proportionate with the age.

The correlation of table 2 miRNA and age

The correlation of table 3 muscular fiber type and age

The correlation of 4 serum miRNA and muscle fibre

According to the pathological change of DMD, patient's initial stage muscular death occurs mainly in fast muscle fiber, and then the present inventor pushes away Whether related to muscle fiber types survey these miRNA.As shown in figure 5, Fig. 5 shows expression variations of the miRNA in change lever, As can be seen from the figure miR-1 and miR-133 expression in the tibialis anterior (TA) based on fast muscle fiber is higher, and miR- 499, then expression is very high in the musculus soleus (SOL) based on slow switch fibers by miR-208b and miR-206.Myocardium special MiR-208a and be not that specifically expressed miR-21 expresses no significant difference in two kinds of muscle fibres in muscle.These tables of data The expression of the miR-499 and miR-208b that are detected in bright serum mainly just come from slow muscle.Following the present inventor analyzes The correlation of miR-499 and miR-208b and different muscular fiber types in the different age group of DMD patient, as a result, it has been found that In the infant of DMD early stages (2 to 6 years old), level and the IIc type muscle fibre positive correlations (Fig. 6) of serum miR-499 and miR-208b. And it is in positive (to be more than 6 years old) muscle fibre (I type) of miR-499 and miR-208b and slow muscle in serum in older infant It closes (Fig. 7).

Fig. 6 shows the correlation of serum miRNA and IIc type muscular fiber types in DMD infants, as can be seen from the figure with The expression quantity of the increase miR-499 and miR-208b of IIc Muscle fiber densities increases.

Fig. 7 shows the correlation of serum miRNA and I type muscular fiber types in DMD infants.As can be seen from the figure with I The expression quantity of the increase miR-499 and miR-208b of type Muscle fiber density is also significantly raised.Thus explanation has a high proportion of slow Flesh can just secret out of miRNAs specific expressed in more slow muscles.

DMD patient serum miRNA and correlation of muscular fiber type in different age group are summarized in table 4.Integrate these Information is the inventors discovered that serum miRNA expressions are not fully consistent in different age bracket variations.It can from table Go out, the pathology of the two expressions and patient of the miRNA (miR-499 and miR-208b) in serum of high expression in slow muscle Situation is more related.It is fine in patient's early stage (2 to 6 years old) the two miRNA and the IIc types flesh with regenerated muscle fibers characteristic Dimensional ratio is proportionate, it may be said that the expression of the two miRNA is higher in bright serum, and the anathrepsis ability of patient is got over By force, the expression and IIa of the two miRNA (are more than 6 years old) in older patient, IIb type Muscle fiber densities are in Negative correlation, and be proportionate with I type muscle fibres, illustrate that the expression of the two miRNA in serum in this age bracket is got over Gao Ze represents patient muscle mainly based on I type muscle fibres.

The correlation of serum miRNA and CK and muscle fibre in 4 DMD infants of table

It discusses

This patent describes expressions of two miRNA in serum can be as the biological marker of muscular dystrophy Object.This research in the inventors discovered that in the mouse models of muscular dystrophy and muscular dystrophy patients serum this Two miRNA are significantly increased.

Although creatine kinase CK's is horizontal by the common major bio-markers for doing muscle disease in serum, to evaluate flesh The damage of meat and degree of necrosis, but it is not always reliable, because the influence that it is often subject to extraneous factor such as moves, and At this time its variation is just not necessarily related with disease.And the level of serum miRNA is less by outer compared with CK levels Influence of boundary's factor to the pressure of body.

The present inventor further study show that in the DMD patient from 2 to 6 years old fast muscle fiber percentage reduce it is same When, the serum expression of the miRNA (miR-208b and miR-499) being enriched in slow switch fibers and age and and regenerated IIc type muscle fibres are proportionate.In addition, previous research report is shown, TNF-α, IL-6 and GPX are in DMD patient muscles Up-regulated expression.In conclusion the present inventor speculates the miRNA that these are enriched in slow switch fibers in DMD early stage infant serum Why increase, it may be possible to which come from inflammatory cytokine stimulation degree of injury lighter slow switch fibers and the increasing that is activated The secretion for the muscle satellite cell grown.Therefore, expression of the miRNA being enriched in patient's early stage slow switch fibers in serum can be anti- The corresponding inflammatory reaction level of muscle should be gone out and anathrepsis is horizontal.In addition, inventors have also demonstrated that in the infant more than 6 years old The expression of miR-499 and miR-208b and slow switch fibers ratio are proportionate in serum.Thus speculate in serum at this time These miRNA expressions are then the indexs for indicating remaining muscle quality.

These results allow the present inventor obtain some miRNA in serum as valuable prognostic marker to Monitor DMD progression of disease.The inventors have discovered that an early stage patient during analyzing data (age was at 4 years old or so) Serum miRNA expressions it is low compared with the abnormal expression of same age bracket other people and age smaller patient, thus it is speculated that its disease The stage (being more than 6 years old) that end of love has reached more late period finds this patient (8 years old or so) state of an illness at present by follow-up investigation Variation is more serious with the patient of age bracket compared with other.This case it is stronger illustrate that serum miRNA can be used for monitoring The pathological change of DMD patient.Since currently without effective therapy for DMD patient, early to find, early contact is assisted There are more importantly meaning in treatment, the time for extending its ambulation for the patient.

MiR-499 and miR-208b is the special miRNA of skeletal muscle slow muscle.The level of serum miR-499 and miR-208b Represent the total amount of skeletal muscle slow muscle.It is first damaged in morbidity early stage skeletal muscle fast muscle, causes the special miRNA of fast muscle in serum Content increases rapidly, will remain unchanged as after quickly reaching peak value, or even can cause under its serum levels because fast muscle total amount is reduced Drop, so the special miRNA of fast muscle is not suitable for judging disease.On the contrary, skeletal muscle slow muscle is impaired slow, disease can be preferably reacted Cheng Fazhan, serum miR-499 and miR-208b level is higher, illustrates to be in a bad way or develop fast.In the morbidity later stage, skeletal muscle is total Amount is reduced, and contents of all special miRNA of skeletal muscle in serum declines, and the skeletal muscle remained at this time is mostly slow muscle, because This slow muscle means that disease is slow more.If serum miR-499 and miR-208b are horizontal relatively high, illustrate that progression of the disease is slow. Clinically, it can judge its disease phase according to specific period difference infant serum miR-499 and miR-208b level For all infants be it is fast or slow, can also be according to same infant in specific period serum miR-499 and miR-208b Level is stabilized or is degrading judging its course of disease and whether drug therapy is effective.

Therefore, the biomarker for the serum miRNA that the present inventor proposes is that muscular dystrophy patient early diagnoses not It can only propose clinical diagnosis opinion, and their treatment is handled, can also propose to suggest accordingly or assess.

Embodiment 3 prepares miRNA chips

By miRNA sequence provided by the invention (SEQ ID NO.:1) it is converted into complementary series, according to the GC for generating sequence Than etc. features sequence both ends add 10-20nt catenation sequence；Core sequence is different, and catenation sequence is also different.Catenation sequence It can be randomly generated by program, the probe that catenation sequence and core sequence are formed meets the following conditions：

1) in probe sequence, 50% of quantity no more than sequence sum of same nucleotide (A, C, G, T)；

2) 25% of quantity no more than sequence sum of any continuous A, T or C, G；

3) G, C content account for the 40%-60% of sequence sum；

4) probe sequence cannot be from hybridizing, i.e., the length of complementary fragment is no more than probe length in probe sequence 30%.

For make synthesis probe steady combination on slide, carried out using 5 ' ends of conventional method probe in post synthesis It is glycosyl modified.

The point system of chip：The surface of slide is first alkylated modification, to improve binding ability.Using conventional chip Spotting methods carry out point sample, in order to detect the repeatability of cross experiment, each probe 3-6 hybridization point of point on slide.

Embodiment 4

It is prepared by kit

The chip package prepared in embodiment 3 is good, it is placed in together with operation instructions in a box, constitutes kit.

Embodiment 5

The detection of chip is verified

To from infection from hospital multiple samples (including 30 muscular dystrophy myopathy samples and 30 normal samples, wherein In 30 muscular dystrophy myopathy samples, 15 be DMD samples, 15 be BMD samples), by embodiment 1-2 method prepare with MicroRNA, the chip prepared as described in Example 3 is marked to be detected with double-blind study.Shown in the present invention The presence or absence of microRNA markers and upper reconciliation lower situation and carry out judgement sample.Wherein, positive control and negative control Respectively known DMD samples and normal sample.

The result shows that including the chip of species specificity microRNA of the invention, correctness 90% can be with effective district Divide DMD samples and normal sample.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To be made various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Claims (5)

1. a kind of nucleic acid sequence, which is integrated into, prepares the chip for distinguishing DMD samples, BMD samples and normal sample or the use in kit On the way, which is characterized in that the nucleic acid sequence collection is combined into：

(i) sequence such as SEQ ID NO:MiRNA shown in 1, or with SEQ ID NO:The sequence of the complementation of miRNA sequence shown in 1； With

(ii) sequence such as SEQ ID NO:MiRNA shown in 2, or with SEQ ID NO:The sequence of the complementation of miRNA sequence shown in 2.

2. purposes as described in claim 1, which is characterized in that the chip is miRNA chips, and miRNA cores Piece includes：

Solid phase carrier；And

The oligonucleotide probe being orderly fixed on the solid phase carrier, the oligonucleotide probe specific detection SEQ ID NO:1 and SEQ ID NO:Sequence shown in 2.

3. purposes as claimed in claim 2, which is characterized in that the oligonucleotide probe contains：

Complementary combined area；With

The bonding pad being connected with solid phase carrier.

4. a kind of miRNA chips purposes in preparing the chip or kit of distinguishing DMD samples, BMD samples and normal sample, It is characterized in that, the miRNA chips include：

Solid phase carrier；And

The oligonucleotide probe being orderly fixed on the solid phase carrier, the oligonucleotide probe specific detection SEQ ID NO:1 and SEQ ID NO:Sequence shown in 2.

5. purposes as claimed in claim 4, which is characterized in that the oligonucleotide probe contains：

Complementary combined area；With

The bonding pad being connected with solid phase carrier.