CN109868315A - For early detection cerebral aneurysm subarachnoid hemorrhage severity and the in-vitro method of prognosis - Google Patents
For early detection cerebral aneurysm subarachnoid hemorrhage severity and the in-vitro method of prognosis Download PDFInfo
- Publication number
- CN109868315A CN109868315A CN201910081959.5A CN201910081959A CN109868315A CN 109868315 A CN109868315 A CN 109868315A CN 201910081959 A CN201910081959 A CN 201910081959A CN 109868315 A CN109868315 A CN 109868315A
- Authority
- CN
- China
- Prior art keywords
- microrna
- prognosis
- cerebral aneurysm
- subarachnoid hemorrhage
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The embodiment of the invention discloses a kind of for early detection cerebral aneurysm subarachnoid hemorrhage severity and the in-vitro method of prognosis, passes through the microRNAs expression of measurement blood plasma excretion body.The embodiment of the present invention also provides the product of a kind of early detection cerebral aneurysm subarachnoid hemorrhage severity and prognosis, and the product determines cerebral aneurysm subarachnoid hemorrhage severity and prognosis by measuring the microRNAs expression of blood plasma excretion body.The embodiment of the present invention uses excretion body microRNANA sequencing, real-time PCR method and technology for the first time, the potential source biomolecule marker closely related with aSAH occurrence and development is filtered out from blood excretion body, it is related with prognosis mala to be determined that microRNA-193b-3p and microRNA-486-3p expression is increased, and microRNA-369-3p and microRNA-410-3p expression reduction is related with prognosis mala, new method is provided for the monitoring and evaluation prognosis of aSAH, the treatment effect for improving such disease is provided fundamental basis and experimental basis.
Description
Technical field
The present invention relates to technical field of medical detection, and in particular to one kind is under early detection cerebral aneurysm arachnoid
The in-vitro method of chamber bleeding severity and in-vitro method, the product of prognosis.
Background technique
Cerebral aneurysm subarachnoid hemorrhage (Aneurysmal subarachnoid haemorrhage, aSAH) is
Intracranial subarachnoid hemorrhage caused by cerebral aneurysm bleeding.Clinical onset case fatality rate and disability rate are up to 45%, account for cerebral apoplexy
5%.Majority influences the reason of prognosis predominantly cerebral injury of early stage and vasopasm and resulting Delayed onset brain and lacks
Blood.Many researchers have found that early stage cerebral injury is to lead to the deciding factor of aSAH poor prognosis recently, so early for aSAH
The research of phase pathophysiological change is particularly important.Early stage cerebral injury may with microcirculation deficiency, the destruction of ionic homeostasis, inflammation and
Capilary shrinks related.A kind of discovery of noninvasive biomarker can be possible pre- with early detection patient change of illness state and evaluation
Afterwards.
MicroRNAs (microRNANAs) is the non-coding RNA of 17-24 nucleic acid, by with mRNA combination controlling gene
Post-transcriptional level.Many research prompt microRNANAs participate in many physiology and pathologic process, while being also used as a variety of diseases
Diagnosing and treating means, comprising: stroke, Parkinson's disease, brain trauma and alzheimer's disease.Researcher also prompts
MicroRNANAs unconventionality expression in the cerebrospinal fluid of aSAH patient.And microRNANAs is relative to lincRNAs and mRNAs
It is more stable, it is not degradable, it is prevalent in tissue, peripheral blood and cerebrospinal fluid.
Cerebral aneurysm subarachnoid hemorrhage (aSAH) is a kind of serious age of onset cerebral apoplexy earlier, after the onset
The death rate and disability rate are all very high.It is considered that cerebral vasospasm after subarachnoid hemorrhage and relevant delayed cerebral ischemia
It is the main reason for influencing prognosis.But it is died of in SAH initial 48 hours more than the inpatient of half, and reverse encephalic
Big vasopasm can not also reduce the death rate and promote neurological functional recovery.What nearest research prompt SAH morbidity early stage occurred
Early stage cerebral injury (EBI) may be to influence patient's prognosis key factor, and basic research and clinic show EBI principal element after SAH
May be related with cerebral ischemia, but how to diagnose the severity of SAH patient EBI SAH is treated it is most important, especially pair
In screening the damage for not causing patient's disturbance of consciousness but so far there are no a kind of reliable, convenient and accurate monitoring method, this is just
So that more accurate, sensitive, the noninvasive EBI diagnostic method of research and development is particularly important, and prediction well can be played to prognosis and is made
With.But prior art means can only be by the consciousness situation and head CT amount of bleeding that judge patient come subjective judgement.Urgently research and develop
A kind of in-vitro method and cerebral aneurysm arachnoid for early detection cerebral aneurysm subarachnoid hemorrhage severity
Cavity of resorption bleeding prognosis.
Summary of the invention
Being designed to provide for the embodiment of the present invention is a kind of tight for early detection cerebral aneurysm subarachnoid hemorrhage
Weight degree and the in-vitro method of prognosis, can only be by judging the consciousness situation and head CT bleeding of patient to solve the prior art
Amount carrys out the subjective judgement state of an illness and causes forecasting inaccuracy true, is unable to the defect of look-ahead.
To achieve the above object, the embodiment of the present invention provides a kind of goes out for early detection cerebral aneurysm cavum subarachnoidale
Blood severity and the in-vitro method of prognosis, by the microRNAs expression for measuring blood plasma excretion body.
Preferably, the microRNAs is microRNA-193b-3p, microRNA-486-3p, microRNA-369-
One or more of 3p, microRNA-410-3p.
Preferably, microRNA-193b-3p, microRNA-486-3p expression quantity increases and cerebral aneurysm spider web
Film lower cavity hemorrhage severity and prognosis mala are related.
Preferably, the microRNA-369-3p and microRNA-410-3p expression reduces and cerebral aneurysm arachnoid
Cavity of resorption bleeding severity and prognosis mala are related.
The embodiment of the present invention also provides a kind of early detection cerebral aneurysm subarachnoid hemorrhage severity and prognosis
Product, the product by measure blood plasma excretion body microRNAs expression determine cerebral aneurysm cavum subarachnoidale
Bleeding severity and prognosis.
Preferably, the product is detection chip or detection kit；
The chip includes being fixed with specificity on solid phase carrier to correspond to microRNA-193b-3p, microRNA-
Some or all of at least one of 486-3p, microRNA-369-3p, microRNA-410-3p microRNA few nucleosides
Acid sequence；
The kit includes for detecting microRNA-193b-3p, microRNA-486-3p, microRNA-369-
The reagent of the expression of at least one of 3p, microRNA-410-3p microRNA.
Preferably, the microRNA-193b-3p primer sequence is as shown in SEQ ID NO.1； microRNA-486-3p
Primer sequence is as shown in SEQ ID NO.2；The primer sequence of microRNA-369-3p is as shown in SEQ ID NO.2；
The primer sequence of microRNA-410-3p is as shown in SEQ ID NO.4.
Preferably, the detection kit includes reverse transcription agents useful for same, and the reagent includes that total serum IgE is template, reverses
Record buffer, triphosphoric acid base deoxynucleotide, RNAase inhibitor, MMLV reverse transcriptase, ploy A tailing enzyme.
Preferably, the detection kit further includes real-time quantitative PCR agents useful for same, and the reagent includes microRNA-
It is the positive PCR primer of 193b-3p, microRNA-486-3p, microRNA-369-3p and microRNA-410-3p specificity, outer
Join cel-microRNA-39 primer, general reverse primer, real time fluorescent quantitative SYBR dyestuff, without enzyme water.
In the embodiment of the present invention, it includes albumen, lipid, mRNA and non-volume that excretion body, which is the 30 lipid membrane vesicles for arriving 100nm,
Code RNA etc. can pass through blood-brain barrier, can also carry out the cell-cell communication of specific long range.Brain cell can discharge outer
It secretes body and enters circulation across blood-brain barrier, enter blood circulation similar to endothelial cell and peripheral cells secretion excretion body.So
Excretion body can be detected in peripheral blood.
The miRNA that miRNA of the invention is primarily referred to as people can also be write as microRNA.For example, in inventive embodiments,
" microRNA-193b-3p " also represents " hsa-miR-193b-3p ".
The embodiment of the present invention has the advantages that
The embodiment of the present invention uses excretion body microRNANA sequencing, real-time PCR method and technology for the first time, from blood
The potential source biomolecule marker microRNANA closely related with aSAH occurrence and development, its work of clinical verification are filtered out in liquid excretion body
For the specificity, sensitivity and feasibility of aSAH, and inquire into the correlation of itself and patient's aSAH prognosis, it is determined that microRNA-
, and microRNA-369-3p and microRNA- related with prognosis mala is increased in 193b-3p and microRNA-486-3p expression
410-3p expression reduction is related with prognosis mala, provides new method for the monitoring and evaluation prognosis of aSAH, improves such disease
Treatment effect provide fundamental basis and experimental basis.
Detailed description of the invention
Fig. 1 is the excretion body electron microscope of the embodiment of the present invention；
Fig. 2 is the expression electrophoretogram of the mark memebrane protein of the embodiment of the present invention, is respectively CD63 albumen and Alix egg in figure
It is white；
Fig. 3 is the differential expression schematic diagram of the microRNANAs of the embodiment of the present invention；
Fig. 4 is the expression schematic diagram of the candidate microRNANAs of the embodiment of the present invention；
Fig. 5 is the ROC curve figure of 4 kinds of candidate microRNANAs of the embodiment of the present invention；
Fig. 6 is the relation schematic diagram of four kinds of candidate microRNANAs of the embodiment of the present invention and severity of being admitted to hospital；
Fig. 7 is the relation schematic diagram of four kinds of candidates microRNANAs and patient's prognosis of the embodiment of the present invention.
Specific embodiment
Embodiments of the present invention are illustrated by particular specific embodiment below, those skilled in the art can be by this explanation
Content disclosed by book is understood other advantages and efficacy of the present invention easily.
The embodiment of the present invention is provided through detection cerebral aneurysm subarachnoid hemorrhage marker blood plasma excretion body
MicroRNAs and its evaluation disease severity and prognosis external detection method, with excretion body microRNANA sequencing,
Real-time PCR method filters out and cerebral aneurysm subarachnoid hemorrhage aSAH occurrence and development from blood excretion body
Closely related potential source biomolecule marker microRNAs, its specificity, sensitivity and feasibility as aSAH of clinical verification,
Pass through monitoring the severity of disease and prognosis to aSAH.
1 experimental design of embodiment and collection of specimens
1, experimental design
Subject signs informed consent form by oneself or family members, and all samples that research process uses pass through ethics
The committee passes through, and the embodiment of the present invention divides three phases: discovery phase, coach group, Qualify Phase.To cerebral aneurysm arachnoid
Cavity of resorption bleeding (Aneurysmal subarachnoid haemorrhage, aSAH) and control group blood plasma excretion body carried out for two generations
Sequencing, finding differences property microRNANAs.The research for carrying out coach group by the small sample of 10 pairs of blood plasma again is determined to enter and be tested
The candidate microRNANAs in card stage.The verifying of large sample is then carried out to candidate microRNANAs.Function outcome is logical
Cross improvement Rankin scoring evaluation.Wherein, 0-2 points are prognosis bona, and 3-6 points are prognosis mala.
2, collection of specimens
All blood specimens are all to be acquired with EDTA anticoagulant tube, and blood plasma is centrifuged in 2 hours.Blood specimen first exists
500 turns of centrifugations, 10 minutes removal haemocytes at 4 DEG C, the rear 1.5mlEP for shifting supernatant to no enzyme is managed, and 300 turns of centrifugations 10 at 4 DEG C
Minute removal blood platelet and cell fragment.Transfer supernatant deposits in -80 DEG C of refrigerators.
Extraction, Electronic Speculum observation and the WB verifying of 2 excretion body of embodiment
1, excretion body separates
Excretion body passes through exoEasy Maxi Kit (from plasma；Qiagen, Valencia, CA) it is separated.First
Sample is filtered by 0.8 μm of screen pipe.By sample and buffer XBP carries out isometric mixing by 1:1 and room temperature is incubated
It educates 5 minutes.It is then transferred in the centrifuge tube of filter membrane, 500g is centrifuged 1 minute removal centrifugate.Isolated excretion body application
Buffer XWP carries out cleaning 5000g and is centrifuged 5 minutes removal foreign proteins.Finally, carrying out the outer of dissolution collection with buffer XE
Secrete body.Utilize the amount of the excretion body of BCA method measurement concentration.Transmission electron microscopy, excretion body are carried out by carbon coating nickel screen lattice
Absorb 1 hour, after washed three times with PBS, 5 minutes every time, then fix ten minutes with 2% formaldehyde.Use uranium acetate and citric acid
Lead negative staining is cleaned three times with deionized water, and 80kV transmission electron microscope JEOL JEM-1400 observe and taken pictures after drying.
2, protein immunoblotting first carries out race glue to excretion body with 10%SDS-PAGE, then carries out transferring film.At 4 DEG C
CD63 albumen and Alix albumen primary antibody are incubated overnight, then show to immune complex using ECL after two anti-bindings and determine
Amount.
3, excretion body characteristics confirm that excretion body about between 30-100nm, is marked as shown in Fig. 1, and to it by Electronic Speculum
Will memebrane protein carries out protein imprinted check as shown in Figure 2.
3 NGS of embodiment sequencing, data collection and otherness microRNAs analysis
1, NGS is sequenced
Tiny RNA library construction: the extraction of total serum IgE is carried out using Trizol.Using Bioanalyzer 2100 to total serum IgE into
Row is quantitative and detects purity, and it is qualified for purity that RIN is greater than 7.0.About 1ug total serum IgE can build library, using Illumina
Hiseq2500 is sequenced.
2, data collection
Initial data is acquired by ACGT101-microRNA, and remove dimer, rRNA, tRNA, snRNA,
SnoRNA and repetitive sequence.Then retrieved by BLAST by the unique sequences application in 18~26 nucleotide
MicroRNABase 21.0 identifies known microRNANAs and new 3p- or 5p-microRNANAs.
3, otherness microRNANAs is analyzed
It is accurately examined using Fisher, X22*2 inspection, X2N*n is examined, t is examined or the variance analysis based on experimental design
Differentiation inspection is carried out to sequencing result.Conspicuousness threshold value is respectively 0.01 and 0.05.
Excretion body microRNA express spectra: sequencing result, which is shown, reads human genomic sequence 9,000,000-1 1,005,000,000 times
It takes.There are > 50,000 kinds of different RNA sequences.There is microRNAs in 746 to be read in microRNAs known to 2139 kinds.Analysis
ASAH and control group find the difference of their express spectras.According to correction p value<0.05, | log2 (fold change) |>1 and table
Up to it is horizontal be not low standard, there are six kinds of microRNAs to be considered expressing variant, six kinds of microRNAs are respectively as follows: hsa-
MicroRNA-369-3p, hsa-microRNA-136-3p, hsa-microRNA-410-3p, hsa-microRNA-195-5p,
Hsa-microRNA-486-3p, and hsa-microRNA-193b-3p.
The sequence of above-mentioned six kinds of microRNAs is as follows:
4 reverse transcription of embodiment and RT-PCR
1, reverse transcription
Using (the Beijing microRNAcute Plus microRNANA First-Strand cDNA Synthesis Kit
Tiangeng biology) synthesize cDNA and tailing.2×microRNANA RT Reaction Buffer(10μl),2μl microRNANA
RT Enzyme Mix,4μl total RNA and 4μl RNase-Free ddH2O, 20 μ l volume altogether, 42 DEG C keep 60
Minute, 95 DEG C are kept for 3 minutes, and it is spare that the cDNA of synthesis is stored in -20 DEG C of refrigerators.
2、Real time PCR
Using microRNAcute Plus microRNANA qPCR Detection kit, (SYBR Green, Tiangeng are raw
Object) it is detected in CFX96TouthTM Real-Time PCR machine (Bio-rad Lab, Inc.).According to 20 μ l reaction systems
Solution is configured, 2 μ l forward primers:
MicroRNA-193b-3p (SEQ ID NO.1):
5'AACTGGCCCTCAAAGTCCCGCT 3'；
MicroRNA-486-3p (SEQ ID NO.2):
5'gCGGGGCAGCTCAGTACAGGAT 3'；
MicroRNA-369-3p (SEQ ID NO.3):
5'accggccgcggAATAATACATGGTTGATCTTTT 3'；
MicroRNA-410-3p (SEQ ID NO.4):
5'ccgcgggAATATAACACAGATGGCCTGT 3'；
MicroRNA-136-3p (SEQ ID NO.5):
5'ccgcggCATCATCGTCTCAAATGAGTCT 3'；
MicroRNA-195-5p (SEQ ID NO.6):
5'cgccggTAGCAGCACAGAAATATTGGC 3'；
10μl microRNAcute Plus microRNANA Premix；The general reverse primer of 0.4 μ l (SEQ ID
NO.7:5 ' CAGGTCCAGTTTTTTTTTTTTTTTCGT3 ')；2 μ lcDNA and 5.6 μ lddH2O.Then it is maintained according to 95 DEG C
15min, 5 circulations: 25sec maintains 94 DEG C, and 30sec maintains 65 DEG C and 34sec to maintain 72 DEG C, then 45 circulations: 20sec
94 DEG C are maintained, 34sec maintains 60 DEG C.Ct value, which is greater than 30, to be considered utilizing 2 to express in vain-△CtCarry out result calculating.
Embodiment 5
1, it statisticallys analyze
Data are analyzed using statistics software MedCalc version 15.0.0.Data are averaged ± standard deviation, answer
It is examined with Mann-Whitney U or Kruskal-Wallis inspection is compared two or more sets differences.Two groups of related coefficients
Using Spearman rank sum test.ASAH feature can be inquired into using diagnostics method ROC curve.First by prognosis in 1 year
Using single factor analysis, the results of univariate logistic analysis is subjected to multiplicity using the standard of P < 0.2 afterwards, calculating aSAH prognosis may
Correlative factor, and obtain risk factors OR and its 95% credibility interval.P < 0.05 is considered to have statistical significance.
The relationship of 6 miRNAs of embodiment expression and cerebral aneurysm subarachnoid hemorrhage aSAH severity
Express spectra is verified: first with 10 aSAH patient's samples and 10 normal controls, to this six species diversity
MicroRNANAs carries out qRT-PCR test, wherein as shown in figure 3, hsa-microRNA-369-3p, hsa-microRNA-
410-3p, hsa-microRNA-193b-3p and hsa-microRNA-486-3p expression have statistical difference, subsequent large sample
These four candidate microRNANAs are studied, sample includes 113 aSAH and 20 normal controls.Relative to control
Group, wherein as shown in figure 4,4 kinds of microRNANAs expression are all variant, and application ROC curve is studied, as shown in figure 5, hair
Now their AUC area is respectively as follows: microRNA-369-3p:0.994；microRNA-410-3p:0.987；microRNA-
193b-3p:0.999；And microRNA-486-3p:0.976.Candidate microRNANAs and patient's early stage coincident with severity degree of condition
With the relationship of prognosis: WFNS classification I-III being turned to light-duty aSAH, IV-V is heavy type aSAH.MicroRNA- as the result is shown
193b-3p and microRNA-486-3p expresses increase in heavy aSAH, and microRNA-369-3p and microRNA-
410-3p expresses reduction in heavy aSAH, as shown in Figure 6.4 kinds of microRNANAs of the embodiment of the present invention are expressed and WFNS
The degree of correlation of severity is respectively as follows: microRNA-369-3p (ρ=- 0.660；P<0.001；95% CI:-0.753---
0.541), microRNA-410-3p (ρ=- 0.626；P<0.001；95%CI:-0.727---0.499), microRNA-
(ρ=0.774 193b-3p；P<0.001；95%CI:0.688 -- 0.839) and microRNA-486-3p (ρ=0.818；P<
0.001；95%CI:0.746-- 0.871).According to prognosis bona's standard, analysis shows that microRNA-193b-3p and
, and microRNA-369-3p and microRNA-410-3p related with aSAH prognosis mala is increased in microRNA-486-3p expression
Expression reduces related with aSAH prognosis mala.
7 qRT-PCR of embodiment verifies the relationship of miRNAs expression and aSAH prognosis
In the embodiment of the present invention, the reagent of early detection cerebral aneurysm subarachnoid hemorrhage severity and prognosis
Box, the primer including detecting four kinds of miRNAs,
MiR-193b-3p (SEQ ID NO.1): 5 ' AACTGGCCCTCAAAGTCCCGCT 3 '；miR-486-3p(SEQ
ID NO.2): 5 ' gCGGGGCAGCTCAGTACAGGAT 3 '；MiR-369-3p (SEQ ID NO.3): 5 ' accggccgcgg
AATAATACATGGTTGATCTTTT 3'；MiR-410-3p (SEQ ID NO.4): 5 '
CcgcgggAATATAACACAGATGGCCTGT 3 ') qRT-PCR primer.
Excretion body is extracted from blood plasma and is extracted RNA and is carried out reverse transcription and all reagents of qRT-PCR.Extract RNA's
Method is the same as embodiment 1, comprising: from all reagents for extracting RNA in excretion body in blood plasma: excretion body settling agent is adsorbed with film
Test tube, RNA stablizing solution, Trizol reagent, metaformaldehyde, isopropanol, without enzyme water, outer ginseng cel-miR-39.Reverse transcription, with
It by miR-193b-3p, miR-486-3p, miR-369-3p and miR-410-3p reverse transcription is cDNA, reverse transcription that total serum IgE, which is template,
Agents useful for same includes RT Buffer, triphosphoric acid base deoxynucleotide, RNAase inhibitor, MMLV reverse transcriptase, ploy
A tailing enzyme.
Real-time quantitative PCR is carried out, agents useful for same includes miR-193b-3p, miR-486-3p, miR-369-3p and miR-
410-3p specificity positive PCR primer, outer ginseng cel-miR-39 primer (SEQ ID NO.8:5 '
CgUCACCGGGUGUAAAUCAGCUUG3 '), general reverse primer (SEQ ID NO.7:5 '
CAGGTCCAGTTTTTTTTTTTTTTTCGT3 '), real time fluorescent quantitative SYBR dyestuff, without enzyme water.
It is analyzed by blood plasma of the qRT-PCR to 113 aSAH patients and 20 normal controls, as shown in figure 4, excretion
Body miR-193b-3p, miR-486-3p, miR-369-3p and miR-410-3p differential expression in the two are anticipated with statistics
Justice, and by logistics regression analysis, as shown in fig. 7, excretion body miR-193b-3p, miR-486-3p, miR-369-3p
It is closely related with patient's prognosis with miR-410-3p variation, according to prognosis bona's standard, analysis shows that microRNA-193b-3p
Increase, and microRNA-369-3p and microRNA-410-3p related with prognosis mala with microRNA-486-3p expression
Expression reduces related with prognosis mala.
As shown in figure 4, in the embodiment of the present invention, the data statistics of 40 and 20 testing results or atlas analysis.
Embodiment 8miRNA pcr chip verifies microRNA-193b-3p, microRNA-486-3p, microRNA-
The differential expression of 369-3p, microRNA-410-3p
In the embodiment of the present invention, the method that miRNA is extracted is such as embodiment 1, microRNAcute Plus
MicroRNANA First-Strand cDNA Synthesis Kit (Beijing Tiangeng biology) synthesis cDNA and tailing, obtain
Then complete cDNA will be added to after the dilution of cDNA template containing microRNA-193b-3p, microRNA-486-3p,
In tetra- species-specific primer of microRNA-369-3p, microRNA-410-3p and the chip of PCR reaction solution, carry out real-time
Quantitative PCR reaction.Ct value is calculated, utilizes 2-△CtCarry out result calculating.
By measuring microRNA-193b-3p, microRNA-486-3p, microRNA-369-3p, microRNA-
410-3p can be with the severity and prognosis of early detection cerebral aneurysm subarachnoid hemorrhage, i.e. microRNA-193b-
, and microRNA-369-3p and microRNA-410-3p related with prognosis mala is increased in 3p and microRNA-486-3p expression
Expression reduces related with prognosis mala.
As transformable embodiment, microRNA-193b-3p, microRNA-486-3p can choose,
Any one or a few in microRNA-369-3p, microRNA-410-3p is made into PCR detection kit or chip progress
Detection.
The early detection cerebral aneurysm subarachnoid hemorrhage severity of the embodiment of the present invention and the chip of prognosis or
Kit, the seriously ill degree and prognosis to cerebral aneurysm subarachnoid hemorrhage aSAH are related, cerebral aneurysm arachnoid
The closely related potential source biomolecule marker of cavity of resorption bleeding aSAH occurrence and development, microRNA:miR-193b-3p, miR-486-3p,
MiR-369-3p and miR-410-3p is in its specificity, sensitivity and feasibility as aSAH marker of clinical verification
The monitoring and evaluation prognosis of aSAH provides new method.
Although above having used general explanation and specific embodiment, the present invention is described in detail, at this
On the basis of invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Therefore,
These modifications or improvements without departing from theon the basis of the spirit of the present invention are fallen within the scope of the claimed invention.
SEQUENCE LISTING
<110>the first affiliated hospital, Wannan Medical College (mountain Wannan Medical College Ge Ji hospital)
<120>for early detection cerebral aneurysm subarachnoid hemorrhage severity and the in-vitro method of prognosis
<130> GG18424318A
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
aactggccct caaagtcccg ct 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gcggggcagc tcagtacagg at 22
<210> 3
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
accggccgcg gaataataca tggttgatct ttt 33
<210> 4
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ccgcgggaat ataacacaga tggcctgt 28
<210> 5
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ccgcggcatc atcgtctcaa atgagtct 28
<210> 6
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cgccggtagc agcacagaaa tattggc 27
<210> 7
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
caggtccagt tttttttttt ttttcgt 27
<210> 8
<211> 24
<212> RNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cgucaccggg uguaaaucag cuug 24
<210> 9
<211> 22
<212> RNA
<213> Homo sapiens
<400> 9
aacuggcccu caaagucccg cu 22
<210> 10
<211> 21
<212> RNA
<213> Homo sapiens
<400> 10
cggggcagcu caguacagga u 21
<210> 11
<211> 21
<212> RNA
<213> Homo sapiens
<400> 11
aauaauacau gguugaucuu u 21
<210> 12
<211> 21
<212> RNA
<213> Homo sapiens
<400> 12
aauauaacac agauggccug u 21
<210> 13
<211> 21
<212> RNA
<213> Homo sapiens
<400> 13
aucaucgucu caaaugaguc u 21
<210> 14
<211> 21
<212> RNA
<213> Homo sapiens
<400> 14
uagcagcaca gaaauauugg c 21
Claims (9)
1. a kind of for early detection cerebral aneurysm subarachnoid hemorrhage severity and the in-vitro method of prognosis, feature
It is, by the microRNAs expression for measuring blood plasma excretion body.
2. the method as described in claim 1, which is characterized in that
The microRNAs is microRNA-193b-3p, microRNA-486-3p, microRNA-369-3p, microRNA-
One or more of 410-3p.
3. method according to claim 2, which is characterized in that
MicroRNA-193b-3p, microRNA-486-3p expression quantity increases and cerebral aneurysm subarachnoid hemorrhage
Severity and prognosis mala are related.
4. method according to claim 2, which is characterized in that
The microRNA-369-3p and microRNA-410-3p expression reduces tight with cerebral aneurysm subarachnoid hemorrhage
Severe and prognosis mala are related.
5. a kind of early detection cerebral aneurysm subarachnoid hemorrhage severity and the product of prognosis, which is characterized in that
The product determines cerebral aneurysm subarachnoid hemorrhage by measuring the microRNAs expression of blood plasma excretion body
Severity and prognosis.
6. product as claimed in claim 5, which is characterized in that
The product is detection chip or detection kit；
The chip includes being fixed with specificity on solid phase carrier to correspond to microRNA-193b-3p, microRNA-486-3p,
Some or all of at least one of microRNA-369-3p, microRNA-410-3p microRNA oligonucleotide sequence；
The kit include for detecting microRNA-193b-3p, microRNA-486-3p, microRNA-369-3p,
The reagent of the expression of at least one of microRNA-410-3p microRNA.
7. product as claimed in claim 6, which is characterized in that
The microRNA-193b-3p primer sequence is as shown in SEQ ID NO.1；MicroRNA-486-3p primer sequence is such as
Shown in SEQ ID NO.2；The primer sequence of microRNA-369-3p is as shown in SEQ ID NO.2；MicroRNA-410-3p's
Primer sequence is as shown in SEQ ID NO.4.
8. product as claimed in claim 6, which is characterized in that
The detection kit includes reverse transcription agents useful for same, and the reagent includes that total serum IgE is template, RT Buffer, three
Phosphoric acid base deoxynucleotide, RNAase inhibitor, MMLV reverse transcriptase, ploy A tailing enzyme.
9. product as claimed in claim 8, which is characterized in that
The detection kit further includes real-time quantitative PCR agents useful for same, the reagent include microRNA-193b-3p,
MicroRNA-486-3p, microRNA-369-3p and microRNA-410-3p specificity positive PCR primer, outer ginseng cel-
MicroRNA-39 primer, general reverse primer, real time fluorescent quantitative SYBR dyestuff, ROX contrast dye, without RNA enzyme distilled water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910081959.5A CN109868315B (en) | 2019-01-28 | 2019-01-28 | In vitro method for early detection of severity and prognosis of cerebral aneurysm subarachnoid hemorrhage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910081959.5A CN109868315B (en) | 2019-01-28 | 2019-01-28 | In vitro method for early detection of severity and prognosis of cerebral aneurysm subarachnoid hemorrhage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109868315A true CN109868315A (en) | 2019-06-11 |
| CN109868315B CN109868315B (en) | 2022-09-02 |
Family
ID=66918167
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910081959.5A Active CN109868315B (en) | 2019-01-28 | 2019-01-28 | In vitro method for early detection of severity and prognosis of cerebral aneurysm subarachnoid hemorrhage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109868315B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110734956A (en) * | 2019-10-31 | 2020-01-31 | 山东大学 | Biomarker for early detection of severity of aneurysmal subarachnoid hemorrhage and prognosis evaluation and application thereof |
| CN111621558A (en) * | 2020-06-10 | 2020-09-04 | 南通大学 | Application of blood brain barrier damage degree-related serum exosome miR-410-3p and detection method thereof |
| CN112410417A (en) * | 2020-11-19 | 2021-02-26 | 旭和（天津）医药科技有限公司 | Annular circRNA AFF1 and application thereof |
| CN113588968A (en) * | 2021-08-03 | 2021-11-02 | 皖南医学院第一附属医院（皖南医学院弋矶山医院） | IL-6 in NDSEV as a marker for diagnosis and/or treatment of subarachnoid hemorrhage |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728525A (en) * | 2017-04-19 | 2018-11-02 | 香港中文大学 | The cycle microRNA biomarkers of subarachnoid hemorrhage and its application |
-
2019
- 2019-01-28 CN CN201910081959.5A patent/CN109868315B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728525A (en) * | 2017-04-19 | 2018-11-02 | 香港中文大学 | The cycle microRNA biomarkers of subarachnoid hemorrhage and its application |
Non-Patent Citations (4)
| Title |
|---|
| KIKKAWA Y等: "Altered Expression of MicroRNA-15a and Kruppel-Like Factor 4 in Cerebrospinal Fluid and Plasma After Aneurysmal Subarachnoid Hemorrhage", 《WORLD NEUROSURG》 * |
| LAI N等: "Systemic exosomal miR-193b-3p delivery attenuates neuroinflammation in early brain injury after subarachnoid hemorrhage in mice", 《J NEUROINFLAMMATION》 * |
| SHENG B等: "Persistent High Levels of miR-502-5p Are Associated with Poor Neurologic Outcome in Patients with Aneurysmal Subarachnoid Hemorrhage", 《WORLD NEUROSURG》 * |
| STYLLI SS等: "miRNA expression profiling of cerebrospinal fluid in patients with aneurysmal subarachnoid hemorrhage", 《J NEUROSURG》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110734956A (en) * | 2019-10-31 | 2020-01-31 | 山东大学 | Biomarker for early detection of severity of aneurysmal subarachnoid hemorrhage and prognosis evaluation and application thereof |
| CN110734956B (en) * | 2019-10-31 | 2021-06-01 | 山东大学 | Biomarker for early detection of severity of aneurysmal subarachnoid hemorrhage and prognosis evaluation and application thereof |
| CN111621558A (en) * | 2020-06-10 | 2020-09-04 | 南通大学 | Application of blood brain barrier damage degree-related serum exosome miR-410-3p and detection method thereof |
| CN111621558B (en) * | 2020-06-10 | 2023-04-07 | 南通大学 | Application of blood brain barrier damage degree-related serum exosome miR-410-3p and detection method thereof |
| CN112410417A (en) * | 2020-11-19 | 2021-02-26 | 旭和（天津）医药科技有限公司 | Annular circRNA AFF1 and application thereof |
| CN113588968A (en) * | 2021-08-03 | 2021-11-02 | 皖南医学院第一附属医院（皖南医学院弋矶山医院） | IL-6 in NDSEV as a marker for diagnosis and/or treatment of subarachnoid hemorrhage |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109868315B (en) | 2022-09-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109868315A (en) | For early detection cerebral aneurysm subarachnoid hemorrhage severity and the in-vitro method of prognosis | |
| JP7413455B2 (en) | Biomarkers of traumatic brain injury | |
| EP2628013B1 (en) | Biomarkers of brain injury | |
| EP2904118B1 (en) | Urine exosome mrnas and methods of using same to detect diabetic nephropathy | |
| CN104540963B (en) | For the method and kit classified with prognosis wound | |
| JP2016526888A (en) | Sepsis biomarkers and their use | |
| CN104981548A (en) | Diagnostic mirna markers for alzheimer | |
| Bukauskas et al. | Value of serum miR-23a, miR-30d, and miR-146a biomarkers in ST-elevation myocardial infarction | |
| CN113493829B (en) | Application of biomarker in pulmonary hypertension diagnosis and treatment | |
| KR101895767B1 (en) | A biomarker composition for diagnosis of atherosclerosis | |
| JP7463351B2 (en) | Blood Biomarkers for Stroke | |
| CN108300788A (en) | A kind of micro RNA combination and its application for detecting light-duty brain trauma | |
| CN109735612B (en) | Biomolecule marker of Kawasaki disease coronary aneurysm complication and kit thereof | |
| JP2022510488A (en) | Nucleic acid biomarker for placental insufficiency | |
| CN107447008A (en) | For the enhancer RNA combinations of acatalepsia reason recurrent miscarriage, primer sets and application and kit | |
| KR20190113033A (en) | Method for diagnosing parkinson's disease using nasal mucus, composition therefore, and kit comprising the same | |
| CN114959001A (en) | Product for diagnosing acute myocardial infarction and application thereof | |
| Nateghi et al. | Circulating miR-193b-3p and miR-376a-3p involved in Iranian patients with multiple sclerosis | |
| US11655507B2 (en) | Method for diagnosing Parkinson's disease using nasal mucus, composition therefore, and kit comprising the same | |
| CN114990216B (en) | Application of micro RNA molecule as biomarker in prognosis of cholangiocarcinoma | |
| CN108220427B (en) | Plasma microRNA marker for differential diagnosis of BHD syndrome and primary spontaneous pneumothorax and application | |
| WO2020007270A1 (en) | Marker and diagnostic method for non-invasive diagnosis of myocardial infarction | |
| JP2024051168A (en) | How to Test for Rheumatoid Arthritis | |
| US20210388448A1 (en) | Method of determining prognosis in patients with follicular lymphoma | |
| Wu et al. | MicroRNA Candidate Biomarkers for Parkinson’s Disease and Idiopathic REM Sleep Behavior Disorder |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |