CN105112509A - Gene liquid chip and detection method for detecting six capsule serotypes of Haemophilus influenzae - Google Patents
Gene liquid chip and detection method for detecting six capsule serotypes of Haemophilus influenzae Download PDFInfo
- Publication number
- CN105112509A CN105112509A CN201510464704.9A CN201510464704A CN105112509A CN 105112509 A CN105112509 A CN 105112509A CN 201510464704 A CN201510464704 A CN 201510464704A CN 105112509 A CN105112509 A CN 105112509A
- Authority
- CN
- China
- Prior art keywords
- seqidno
- hemophilus influenzae
- sequence
- gene
- capsular serotypes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a Gene liquid chip and a detection method for detecting six serotypes of Haemophilus influenzae. A capsule specific gene of Haemophilus influenzae is used as a target gene, the liquid chip and the detection method for detecting six capsule serotypes of Haemophilus influenzae are established, and a novel reliable way to detect capsule types of Haemophilus influenzae is provided. Detection of the six capsule serotypes of Haemophilus influenzae by the gene chip has the advantages such as operational simplicity, high sensitivity, high specificity and high accuracy.
Description
Technical field
The present invention relates to and a kind ofly detect gene liquid chip of capsular serotypes in hemophilus influenzae whole 6 and preparation method thereof.The present invention's gene liquid chip also designed described in utilization carries out the method detected.
Background technology
Liquid-phase chip is the multifunction chip platform based on xMAP (flexibleMulti-AnalyteProfiling) technological development of Luminex company of the U.S..It is on the microballoon of different coding, carry out Ag-Ab, enzyme-substrate, the association reaction of ligand-receptor and nucleic acid hybridization reaction, microballoon coding is detected respectively and reporter fluorescence reaches the object of quantitative and qualitative analysis by red, green two bundle laser, can complete nearly 100 kinds of different biologicallies in a reacting hole, be the high-throughput molecular detection technology platform of new generation after gene chip, protein chip.Compared with traditional detection method, liquid-phase chip technology has that high-throughput, handiness are good, highly sensitive, high specificity, the advantage such as reproducible.Based on above-mentioned plurality of advantages, liquid-phase chip technology has immeasurable application potential.
The polystyrene microsphere that the whole system matrix of liquid-phase chip is 5 μm by diameter forms, and often kind of microballoon mixes red and orange two kinds of fluorescence dyes in different ratios in making processes, is numbered, microballoon can be divided into 100 kinds with this to microballoon.Often kind of microballoon, due to the difference of fluorescence dye ratio, has different spectral signatures, can by laser specific identification in testing process.When utilizing liquid-phase chip to detect, microballoon defiled, one by one through sense channel, detecting instrument sends red and green two bundle laser simultaneously.Red laser, by exciting the color in microsphere matrices, identifies the numbering of microballoon, thus determines the kind of target molecule, carry out qualitative to target molecule.Green laser identifiable design reporter molecules, through digital signal processor, generates fluorescent value in digital form, due to reporter molecules coupled microballoon, therefore just can carry out quantitatively the target molecule that will detect according to the size of fluorescent value.Therefore, by detecting while red and green color laser, real-time, the qualitative and quantitative analysis to reaction is completed.
Hemophilus influenzae (
haemophilusinfluenza, Hi) be take the mankind as the gram negative pathogenic bacteria of only parasitic objects, extensively parasitize human nasopharynx portion.In children, often cause respiratory tract infection, also can invade the diseases such as blood secondary septicemia, meningitis.According to the difference of the outer capsular polysaccharide antigen of cell walls, hemophilus influenzae is divided into a, b, c, d, these six kinds of serotypes of e, f.Hemophilus influenzae capsule loci comprises three parts, and region I and region III guards at all encapsulated hemophilus influenzae camber, and major function participates in pod membrane component and transports out epicyte; Region II encodes pod membrane type specificity albumen.By consulting pertinent literature, we to determine the type of capsular polysaccharide with the specific gene of region II.
At present, detect the mainly traditional slide agglutination experiment of the method for hemophilus influenzae capsular serotypes and antiserum(antisera) is tested, but shortcoming is also obvious easily occurs cross agglutination and false positive.Also occur that some Molecular strain typing methods are as PCR detection technique in recent years successively, and the real-time fluorescence quantitative PCR be derived by PCR detection technique and multiple PCR technique are also applied to hemophilus influenzae Capsular typing.Although the method specificity of real-time fluorescence quantitative PCR is high, accurately convenient, convenient operation, expensive equipment, fluorescent probe synthesis difficulty, strongly limit its application.Multiple PCR technique can detect multiple cause of disease simultaneously, but easily forms non-specific amplification and cross reaction.The liquid-phase chip detection system of the whole 6 kinds of pod membrane types of detection hemophilus influenzae that the present invention sets up, easy and simple to handle, highly sensitive, high specificity, accuracy is good.Fill up the deficiency of somatotype detection technique in the past.
Summary of the invention
One object of the present invention is just to provide a kind of gene liquid chip detecting infant's respiratory tract common pathogen hemophilus influenzae six kinds of capsular serotypes, this chip comprises: fluorescence-encoded microballoon, capture probe, primer, PCR reaction system, SA-PE, is primarily characterized in that described capture probe comprises one or more sequences chosen from following sequence:
(1) selected from the special gene sequence of hemophilus influenzae capsular serotypes a nucleotide sequence; See SEQIDNO:13;
(2) selected from the special gene sequence of hemophilus influenzae capsular serotypes b nucleotide sequence; See SEQIDNO:14;
(3) selected from the special gene sequence of hemophilus influenzae capsular serotypes c nucleotide sequence; See SEQIDNO:15;
(4) selected from the special gene sequence of hemophilus influenzae capsular serotypes d nucleotide sequence; See SEQIDNO:16;
(5) selected from the special gene sequence of hemophilus influenzae capsular serotypes e nucleotide sequence; See SEQIDNO:17;
(6) selected from the special gene sequence of hemophilus influenzae capsular serotypes f nucleotide sequence is shown in SEQIDNO:18.
A kind of DNA sequence dna in the DNA sequence dna of nucleotide sequence selected from the pod membrane special gene sequence of hemophilus influenzae serotype a, these 6 kinds of bacterial strains of b, c, d, e and f difference of the present invention shown in corresponding SEQIDNO:13-SEQIDNO:18;
Primer sequence of the present invention is the primer order of shown in corresponding SEQIDNO:1-SEQIDNO:12 respectively.
Gene liquid chip of the present invention, the DNA fragmentation of primer sequence wherein or the DNA fragmentation of its complementation.
The preparation method of gene liquid chip of the present invention, comprises nucleic acid extraction, microballoon coupling, pcr amplification and upper machine testing.
The present invention further discloses liquid-phase chip in the application for hemophilus influenzae six kinds of capsular serotypes context of detection.Particularly at detection childrens respiratory tract infection, the application in secondary septicemia, meningococcal disease.The detection probes applied comprises at least one in the DNA sequence dna shown in SEQIDNO:13-SEQIDNO:18.
As seen from the above technical solutions, liquid-phase chip technology is introduced the detection field of respiratory tract common pathogen hemophilus influenzae six kinds of capsular serotypes by the present invention first, establish a kind of quick, sensitive, accuracy is high, repeatability strong liquid-phase chip and detection method thereof, due to easy and simple to handle, accuracy is high, repeatability is strong, and this liquid-phase chip has important using value in field of medical examination.
Accompanying drawing explanation
Figure 16 plants pod membrane type specific gene probe specificity and compares;
Fig. 2 comprises: the sensitivity technique of Fig. 2 A capsular serotypes b; The sensitivity technique of Fig. 2 B capsular serotypes d;
The sensitivity technique of Fig. 2 C capsular serotypes e;
The detection of any 2 kinds of capsular serotypes of Fig. 3;
The detection of any 3 kinds of capsular serotypes of Fig. 4;
The detection of any 4 kinds of capsular serotypes of Fig. 5;
The detection of any 5 kinds of capsular serotypes of Fig. 6;
Figure 76 plants capsular serotypes and detects simultaneously;
Caption: Hia, Hib, Hic, Hid, Hie, Hif represent a serotype respectively
haemophilusinfluenza, b serotype
haemophilusinfluenza, c serotype
haemophilusinfluenza, d serotype
haemophilusinfluenza, e serotype
haemophilusinfluenza, f serotype
haemophilusinfluenza.* 62 etc. represent microballoon numbering.
Hemophilus influenzae bacterial classification source used by the present invention is as shown in table 1 below:
Bacterial classification used by this experiment of table 1
a,NationalCollectionofTypeCultures(NCTC),CentralPublicHealthLaboratory,London,UnitedKingdom.
b,AmericanTypeCultureCollection(ATCC),USA.
the Design & preparation of embodiment 1 primer, probe
1, the screening of probe
Specific probe is whole liquid-phase chip technology core, and general employing first designs specific probe, and then designs corresponding primer according to probe location.
Due to the requirement of later stage multiplex PCR, therefore when designing probe in early stage, should focus on ensureing all probe Tm values within the specific limits, this research chooses Tm value scope 55
+3 DEG C.During designing probe by the cut to lengthen of probe between 18-25bp, GC content controls at 30-60%.Devise many specific probes for each target gene during design in early stage so not only to ensure to filter out conservative special again probe, more can also guarantee the reliability of detected result.
Expect that not only conservative but also special probe is iff being far from being enough by bioinformatic analysis, the probe sometimes meeting very much above-mentioned condition but can not get stable positive signal in actual crossover process.Therefore the probe designed has to pass through machine testing in actual chips and carries out screening repeatedly, guarantee really probe effectively.
This research, through repeated multiple times experiment screening, finally obtains often kind of serotype special
a kind ofprobe sequence, as shown in table 2:
The sequence oligonucleotide probe that table 2 gene chip of the present invention is selected and detectable capsular serotypes
2, the design of primer
By reading lot of documents, this research is finally determined with the specific gene of region II in hemophilus influenzae capsule loci for target gene.PrimerPremier5.0 is utilized to design primer, set operating software after the parameters such as the length of primer, Primer type, base number, from Output rusults, find out ° C ± 2, Tm value=62 ° C, base number inner without secondary structure and amplified fragments comprises the primer of probe sequence without dimer, primer between 18-30bp, between primer.And finally to ensure that the object fragment that all primer PCRs increase out is being less than 300bp.
Primer used by table 3 chip
the preparation of embodiment 2, gene liquid chip
1, coding microball (bio-rad or Luminex company) is chosen, the corresponding microballoon numbering of each probe, 6 kinds of capsular serotypes microballoon numberings that just needs 6 are different, as the hemophilus influenzae of No. 061 microballoon coupling a serotype and the probe of Hia, get about 1.25 × 10
6individually be placed in centrifuge tube, 12000rpm/min, centrifugal 3-5 minute, carefully removes supernatant;
2, the MES(2-(n-morpholino of 10uL0.1M is added) ethyl sulfonic acid solution), fully shake mixing, centrifugal a little;
3, with distilled water, the oligonucleotide probe of synthesis is diluted to 0.1mmol/L; Add the Hia probe of 4uL dilution in No. 061 microsphere suspension liquid, vibration mixing;
4, add the EDC solution of the freshly prepared 10mg/mL of 2.5uL in microballoon and probe mixed solution, vibration, room temperature lucifuge hatches 30 minutes, and this step requires fast operating;
5, repeating step 4;
6, wash once with 1mL0.02%Tween20, the centrifugal 3-5 minute of 12000rpm/min;
7, carefully abandon supernatant, microballoon is resuspended in 1mL0.1%SDS, vibration mixing;
8, the centrifugal 3-5 minute of 12000rpm/min, carefully abandons supernatant, and microballoon is resuspended in 30uLpH8.0TE, and mixing has been hanged in vibration, namely obtains the detection microballoon that coupling is good;
9, by the quantity of Hematocyte Counter counting microballoon, the unit concentration of often kind of microballoon is conversed;
10, detection microballoon good for coupling is placed on 4 DEG C to keep in Dark Place, the microballoon of often kind of probe conjugate is preserved separately, during use, selects the microballoon kind that will mix according to test item.
the extraction of embodiment 3, sample nucleic acid
1, get in 1.5mL bacterium liquid centrifuge tube, centrifugal 5 minutes of 8000rpm, abandons supernatant, repeats to wash once.
2, add 250 μ L50mMTris-HCl damping fluids (pH8.0) resuspended, centrifugal 5 minutes of 12000rpm, abandons supernatant.
3, add 250 μ L50mMTris-HCl damping fluids (pH8.0) resuspended, then add 10 μ L0.45MEDTA (pH8.0), fully suspend, 37 DEG C of temperature are bathed 20 minutes.
4, add 10 μ L20mg/mL N,O-Diacetylmuramidases, 37 DEG C of temperature are bathed 20 minutes.
5, add 1.5 μ L20mg/mL Proteinase Ks, softly mix.
6, add 15 μ L10%SDS, 50 DEG C of water-baths 2 are little of solution clarification, and period puts upside down mixing several times gently.
7,2 μ L20mg/mLRNAse are added, 65 DEG C of water-baths 30 minutes.
8, with the rifle head cutting off tip, above-mentioned solution is moved on in new clean centrifuge tube.
9, in stink cupboard, add 250 μ L phenol: chloroform: primary isoamyl alcohol (25:24:1), fully mixes, 12000rpm, 4 DEG C centrifugal 10 minutes, and new centrifuge tube transferred to by supernatant liquor, repeats once.
10, in stink cupboard, add 250 μ L chloroforms: primary isoamyl alcohol (24:1), fully mixes, 12000rpm, 4 DEG C centrifugal 10 minutes, and new centrifuge tube transferred to by supernatant liquor.
11, the dehydrated alcohol of the precooling in advance of 2.5 times of volumes is added, jog, in-80 DEG C of precipitation DNA.12000rpm, 4 DEG C of centrifugal 15min.
12, by 1mL70% ice washing with alcohol DNA precipitation, then at 65 DEG C, 10min is dried.
13, dissolve with 30 μ LTE, and for subsequent use in-20 ° of C refrigerators.
embodiment 4, sample pcr amplification
Using the template that the supernatant liquor reclaimed reacts as PCR, PCR reaction system and reaction conditions:
PCR reaction system:
With the agarose gel electrophoresis inspection amplification situation of 2% after reaction terminates
embodiment 5, detection
1, outstandingly to shake, supersound process microballoon (crosslinked probe) 20 seconds with resuspended it;
2, preparation mixing microballoon working fluid: each group of microballoon is diluted to 150/ul with 1.5 х TMAC hybridization solutions; (note: each reaction needed 33ul mixing microballoon working fluid)
3, outstandingly to shake, supersound process microballoon 20 seconds to be to mix working fluid;
4, in each reacting hole and blank control wells, 33ul working fluid is added;
5, in each blank well, 17ulTE(pH8.0 is added); And in each sample well, add biotinylated amplified production 17ul respectively;
6, with the upper and lower pressure-vaccum of rifle for several times to mix each reacting hole;
7, build Sptting plate with prevent volatilization, be placed on 95-100 DEG C 5 minutes to make PCR primer denatured double stranded;
8, again Sptting plate is placed in afterwards 57 DEG C 15 minutes;
9, fresh nitrite ion is prepared: with 1 х TMAC hybridization solution by streptavidin-R-phycoerythrin(SA-PE) be made into 2-4ug/ml; (note: every hole needs 75ul nitrite ion)
10, prewet with 1 х TMAC hybridization solution by the Milliporefilterplate of 1.2um, negative pressure is found time again afterwards; The reaction solution of having hybridized is moved in the hole of having prewetted afterwards, find time to remove supernatant by negative pressure; Every hole adds 75ul nitrite ion more afterwards, and with the upper and lower pressure-vaccum of the volley of rifle fire for several times with resuspended reaction solution; Rapidly reaction solution is retracted in PCR plate;
11, Sptting plate is placed in hybridization temperature 120r/min again and hatches 15 minutes;
12, after having reacted, on 57 DEG C, detect with Luminex100 machine;
13, BIO-Plex detection system, by red, green two bundle laser detection, red laser excites the dyestuff of microsphere matrices thus identifies microballoon numbering, and green laser identifies the fluorescence dye that microsphere surface combines, and realizes the quantitative analysis of the PCR primer that capture probe is caught.
When detecting, carry out detection as detection background using PCR negative control simultaneously.For each detection system and detection background, the data that instrument exports are fluorescence intensity median (MedianFluorescenceIntensity of a kind of numbering population of microspheres in respective reaction system, MFI), the statistical average value of each microballoon strength of signal of the population of microspheres (>100) of this numbering namely read.Result interpretation: be judged to the positive when the MFI value of sample to be detected is more than 5 times of the detection background strength of signal of its correspondence.
embodiment 6, capsular serotypes sensitivity technique
In order to probe into the detection sensitivity of this invention, we carry out sensitivity technique experiment to 3 kinds (Hib, Hid, Hie) in 6 kinds of capsular serotypes, and concrete grammar is as follows:
1. with NanoDropOD instrument, the genome concentration extracted is measured, and dilution is 100ng/ μ L, 10ng/ μ L, 1ng/ μ L, 100pg/ul, 10pg/ul, 1pg/ul, 100fg/ul, 10fg/ul, 1fg/ul respectively.
2. pcr amplification is carried out to genome, chip hybridization, upper machine testing.
3. detected result is shown in Fig. 2 A, 2B, 2C.
the detection of embodiment 7, any 2 kinds of capsular serotypes
May be used for the detection of hemophilus influenzae at least one capsular serotypes to probe into this invention, first we choose any 2 kinds of capsular serotypes and detect.Concrete grammar is as follows:
1. first the genome of the hemophilus influenzae of 2 kinds of selected serotypes is all diluted respectively for 100ng/ μ L.
2. PCR amplification system is as follows:
3. chip hybridization, upper machine testing.
4. detected result is shown in Fig. 3.
Result shows:
(1) this liquid-phase chip detects while may be used for hemophilus influenzae a and e two kinds of capsular serotypes;
(2) this liquid-phase chip detects while may be used for hemophilus influenzae b and e two kinds of capsular serotypes;
(3) this liquid-phase chip detects while may be used for hemophilus influenzae c and e two kinds of capsular serotypes;
(4) this liquid-phase chip may be used for hemophilus influenzae at least two kinds of capsular serotypes and detects simultaneously.
the detection of embodiment 8, any 3 kinds of capsular serotypes
May be used for the detection of hemophilus influenzae at least one capsular serotypes to probe into this invention, we then choose any 3 kinds of capsular serotypes and detect.Concrete grammar is as follows.
1. first the genome of the hemophilus influenzae of 3 kinds of selected serotypes is all diluted respectively for 100ng/ μ L.
2. PCR amplification system is as follows:
3. chip hybridization, upper machine testing.
4. detected result is shown in Fig. 4
Result shows:
(1) this liquid-phase chip detects while may be used for hemophilus influenzae c, d and e tri-kinds of capsular serotypes;
(2) this liquid-phase chip detects while may be used for hemophilus influenzae b, c and e tri-kinds of capsular serotypes;
(3) this liquid-phase chip may be used for hemophilus influenzae at least three kinds of capsular serotypes and detects simultaneously.
the detection of embodiment 9, any 4 kinds of capsular serotypes
May be used for the detection of hemophilus influenzae at least one capsular serotypes to probe into this invention, we then choose any 4 kinds of capsular serotypes and detect.Concrete grammar is as follows:
1. first the genome of the hemophilus influenzae of 4 kinds of selected serotypes is all diluted respectively for 100ng/ μ L.
2. PCR amplification system is as follows:
3. chip hybridization, upper machine testing.
4. detected result is shown in Fig. 5.
Result shows:
(1) this liquid-phase chip detects while may be used for hemophilus influenzae b, c, d and e tetra-kinds of capsular serotypes;
(2) this liquid-phase chip detects while may be used for hemophilus influenzae a, c, d and e tetra-kinds of capsular serotypes;
(3) this liquid-phase chip may be used for hemophilus influenzae at least four kinds of capsular serotypes and detects simultaneously.
the detection of embodiment 10, any 5 kinds of capsular serotypes
May be used for the detection of hemophilus influenzae at least one capsular serotypes to probe into this invention, we and choose any 5 kinds of capsular serotypes and detect.Concrete grammar is as follows:
1. first the genome of the hemophilus influenzae of 5 kinds of selected serotypes is all diluted respectively for 100ng/ μ L.
2. PCR amplification system is as follows:
3. chip hybridization, upper machine testing.
4. detected result is shown in Fig. 6.
5. result shows:
(1) this liquid-phase chip detects while may be used for hemophilus influenzae a, b, c, d and e five kinds of capsular serotypes;
(2) this liquid-phase chip detects while may be used for hemophilus influenzae b, c, d, e and f five kinds of capsular serotypes;
(3) this liquid-phase chip may be used for hemophilus influenzae at least five kinds of capsular serotypes and detects simultaneously.
embodiment 11,6 kind of capsular serotypes detect simultaneously
May be used for the detection of hemophilus influenzae at least one capsular serotypes to probe into this invention, finally we determine to detect hemophilus influenzae 6 kinds of capsular serotypes simultaneously.Concrete grammar is as follows:
1. first the genome of the hemophilus influenzae of 6 kinds of serotypes is all diluted respectively for 100ng/ μ L.
2. PCR amplification system is as follows:
3. chip hybridization, upper machine testing.
4. detected result is shown in Fig. 7.
Result shows: this liquid-phase chip may be used for hemophilus influenzae six kinds of capsular serotypes and detects simultaneously.
SEQUENCELISTING
<110> Nankai University
<120> detects gene liquid chip and the detection method of hemophilus influenzae six kinds of capsular serotypes
<160>18
<170>PatentInversion3.5
<210>1
<211>25
<212>DNA
<213> artificial sequence
<400>1
gcaaccatcttacaacttagcgaat25
<210>2
<211>21
<212>DNA
<213> artificial sequence
<400>2
ctgcggtgtcctgtgtttagg21
<210>3
<211>26
<212>DNA
<213> artificial sequence
<400>3
caagatacctttggtcgtctgctaaa26
<210>4
<211>25
<212>DNA
<213> artificial sequence
<400>4
taggctcgaagaatgagaagttttg25
<210>5
<211>23
<212>DNA
<213> artificial sequence
<400>5
tctgcaagaaatgttggaattga23
<210>6
<211>29
<212>DNA
<213> artificial sequence
<400>6
gtgaaacattctctgattctgatatttgt29
<210>7
<211>25
<212>DNA
<213> artificial sequence
<400>7
ttgatgaccgatacaacctgtttaa25
<210>8
<211>27
<212>DNA
<213> artificial sequence
<400>8
ccagaaattatttctccgttatgttga27
<210>9
<211>28
<212>DNA
<213> artificial sequence
<400>9
gagtttaaggattttattgagcttttcg28
<210>10
<211>26
<212>DNA
<213> artificial sequence
<400>10
agcaatagtttgaaagaaccctctgt26
<210>11
<211>27
<212>DNA
<213> artificial sequence
<400>11
cttacgcctgaaatttgctattacttt27
<210>12
<211>28
<212>DNA
<213> artificial sequence
<400>12
agaatgtggtctatttccattctctttt28
<210>13
<211>21
<212>DNA
<213> artificial sequence
<400>13
ctatcaagtgaagcatgtcgc21
<210>14
<211>22
<212>DNA
<213> artificial sequence
<400>14
tgatatgggtacatctgttcgc22
<210>15
<211>19
<212>DNA
<213> artificial sequence
<400>15
acgttcaaaccgaatgggt19
<210>16
<211>25
<212>DNA
<213> artificial sequence
<400>16
taagaatggttgtaaaactcttctt25
<210>17
<211>20
<212>DNA
<213> artificial sequence
<400>17
agtggagcggcttgaattaa20
<210>18
<211>19
<212>DNA
<213> artificial sequence
<400>18
atattcgctccgcaaatgc19
Claims (7)
1. one kind is detected the gene liquid chip of infant's respiratory tract common pathogen hemophilus influenzae six kinds of capsular serotypes, this chip comprises: fluorescence-encoded microballoon, capture probe, primer, PCR reaction system, SA-PE, is primarily characterized in that described capture probe comprises a kind of sequence from choosing shown in SEQIDNO:13-SEQIDNO:18.
2. gene liquid chip according to claim 1, it is characterized in that a kind of DNA sequence dna in the described DNA sequence dna of nucleotide sequence difference shown in corresponding SEQIDNO:13-SEQIDNO:18 selected from the pod membrane special gene sequence of hemophilus influenzae serotype a, these 6 kinds of bacterial strains of b, c, d, e and f, wherein:
(1) selected from the special gene sequence of hemophilus influenzae capsular serotypes a nucleotide sequence; See SEQIDNO:13;
(2) selected from the special gene sequence of hemophilus influenzae capsular serotypes b nucleotide sequence; See SEQIDNO:14;
(3) selected from the special gene sequence of hemophilus influenzae capsular serotypes c nucleotide sequence; See SEQIDNO:15;
(4) selected from the special gene sequence of hemophilus influenzae capsular serotypes d nucleotide sequence; See SEQIDNO:16;
(5) selected from the special gene sequence of hemophilus influenzae capsular serotypes e nucleotide sequence; See SEQIDNO:17;
(6) selected from the special gene sequence of hemophilus influenzae capsular serotypes f nucleotide sequence is shown in SEQIDNO:18.
3. gene liquid chip according to claim 1, is characterized in that the described primer sequence primer order of shown in corresponding SEQIDNO:1-SEQIDNO:12 respectively.
4. gene liquid chip according to claim 1, is characterized in that the preparation method of described gene liquid chip, comprises nucleic acid extraction, microballoon coupling, pcr amplification and upper machine testing.
5. liquid-phase chip described in claim 1 is in the application for hemophilus influenzae six kinds of capsular serotypes context of detection.
6. the application of liquid-phase chip according to claim 5, is characterized in that applied detection probes comprises at least one in the DNA sequence dna shown in SEQIDNO:13-SEQIDNO:18.
7. detect infant's respiratory tract common pathogen hemophilus influenzae six kinds of capsular serotypes gene liquid chips described in claim 1 and detect childrens respiratory tract infection in preparation, the application in secondary septicemia, meningococcal disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510464704.9A CN105112509A (en) | 2015-08-03 | 2015-08-03 | Gene liquid chip and detection method for detecting six capsule serotypes of Haemophilus influenzae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510464704.9A CN105112509A (en) | 2015-08-03 | 2015-08-03 | Gene liquid chip and detection method for detecting six capsule serotypes of Haemophilus influenzae |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105112509A true CN105112509A (en) | 2015-12-02 |
Family
ID=54660613
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510464704.9A Pending CN105112509A (en) | 2015-08-03 | 2015-08-03 | Gene liquid chip and detection method for detecting six capsule serotypes of Haemophilus influenzae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105112509A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103205509A (en) * | 2013-04-23 | 2013-07-17 | 中国检验检疫科学研究院 | High-flux non-diagnostic detection method for 13 respiratory viruses based on novel suspension chip technology |
-
2015
- 2015-08-03 CN CN201510464704.9A patent/CN105112509A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103205509A (en) * | 2013-04-23 | 2013-07-17 | 中国检验检疫科学研究院 | High-flux non-diagnostic detection method for 13 respiratory viruses based on novel suspension chip technology |
Non-Patent Citations (2)
| Title |
|---|
| T.J. FALLA ET AL.: "PCR for Capsular Typing of Haemophilus influenzae", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 田国忠等: "多重聚合酶链反应检测流感嗜血杆菌", 《中华流行病学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| Kuschel et al. | Robust methylation‐based classification of brain tumours using nanopore sequencing | |
| CN103911447B (en) | Detect plasmodial primer, probe and method | |
| Xie et al. | The intriguing landscape of single‐cell protein analysis | |
| CN101560558A (en) | Method for detecting suspension chip of multiple PCR products | |
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| US20050136442A1 (en) | Three dimensional apparatus and method for integrating sample preparation and multiplex assays | |
| CN110218819A (en) | A kind of high-throughput micro-fluidic chip and detection method detecting porcine respiratory epidemic disease cause of disease | |
| CN103173567B (en) | Suspension-array multiple non-diagnostic detection method for tick-borne pathogens | |
| CN110295255A (en) | A kind of rapid detection method based on RT-LAMP-LFD detection Kiwi berry chlorisis ring spot correlated virus | |
| CN103898240B (en) | Detect the primer of dengue virus and somatotype thereof, probe and method | |
| CN105483266A (en) | Gene liquid chip for detecting three serotypes in colibacillus H serotype and detection method | |
| CN101130814A (en) | Nucleic acid ligand group chip and manufacturing method thereof | |
| CN102559878B (en) | Composite amplification system and detection kit of mouse short tandem repeat | |
| CN105331693A (en) | Gene liquid chip for conducting typing on eight O-antigens of plesiomonas shigelloides and detection method | |
| CN105112509A (en) | Gene liquid chip and detection method for detecting six capsule serotypes of Haemophilus influenzae | |
| CN110129482A (en) | Detect LAMP primer group, kit and the detection method of African swine fever virus | |
| CN105112506A (en) | Gene liquid chip for typing 10 K antigens of Escherichia coli in sample and detection method thereof | |
| CN101429545A (en) | Method for detecting Shigella by using suspension chip technology | |
| CN101403000A (en) | Method for detecting pathogenic shigella by using suspending chip technique | |
| CN108531648B (en) | Oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof | |
| CN101550457A (en) | Liquid phase chip for detecting pathogeny of hand foot and mouth disease, preparation method and applications thereof | |
| CN116732209B (en) | Kit and method for simultaneously detecting drug resistance genes ISCR2 and FLOR based on digital PCR technology | |
| CN110205373A (en) | For detecting the primer sets and its application and application its product of ATP7B gene point mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151202 |