CN105483266A - Gene liquid chip for detecting three serotypes in colibacillus H serotype and detection method - Google Patents
Gene liquid chip for detecting three serotypes in colibacillus H serotype and detection method Download PDFInfo
- Publication number
- CN105483266A CN105483266A CN201610023282.6A CN201610023282A CN105483266A CN 105483266 A CN105483266 A CN 105483266A CN 201610023282 A CN201610023282 A CN 201610023282A CN 105483266 A CN105483266 A CN 105483266A
- Authority
- CN
- China
- Prior art keywords
- gene
- seqidno
- serotype
- sequence
- intestinal bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a gene liquid chip for detecting three serotypes in colibacillus H serotype and a detection method. A colibacillus flagellin fliC specific gene is taken as a target gene, and a liquid chip for detecting three flagellins and a detection method are established to provide a novel and reliable way for colibacillus flagellin typing detection. When used for detecting three flagellin serotypes in colibacillus, the gene liquid chip has the advantages of simple and convenient operation, high sensitivity, strong specificity, good accuracy and the like.
Description
Technical field
The present invention relates to and a kind ofly examine gene liquid chip of 3 kinds of serotypes in intestinal bacteria H serotype and preparation method thereof.The present invention's gene liquid chip also designed described in utilization carries out the method detected.
Background technology
Liquid-phase chip is the multifunction chip platform based on xMAP (flexibleMulti-AnalyteProfiling) technological development of Luminex company of the U.S..It is on the microballoon of different coding, carry out Ag-Ab, enzyme-substrate, the association reaction of ligand-receptor and nucleic acid hybridization reaction, microballoon coding is detected respectively and reporter fluorescence reaches the object of quantitative and qualitative analysis by red, green two bundle laser, can complete nearly 100 kinds of different biologicallies in a reacting hole, be the high-throughput molecular detection technology platform of new generation after gene chip, protein chip.Compared with traditional detection method, liquid-phase chip technology has that high-throughput, handiness are good, highly sensitive, high specificity, the advantage such as reproducible.Based on above-mentioned plurality of advantages, liquid-phase chip technology has immeasurable application potential.
The polystyrene microsphere that the whole system matrix of liquid-phase chip is 5 μm by diameter forms, and often kind of microballoon mixes red and orange two kinds of fluorescence dyes in different ratios in making processes, is numbered, microballoon can be divided into 100 kinds with this to microballoon.Often kind of microballoon, due to the difference of fluorescence dye ratio, has different spectral signatures, can by laser specific identification in testing process.When utilizing liquid-phase chip to detect, microballoon defiled, one by one through sense channel, detecting instrument sends red and green two bundle laser simultaneously.Red laser, by exciting the color in microsphere matrices, identifies the numbering of microballoon, thus determines the kind of target molecule, carry out qualitative to target molecule.Green laser identifiable design reporter molecules, through digital signal processor, generates fluorescent value in digital form, due to reporter molecules coupled microballoon, therefore just can carry out quantitatively the target molecule that will detect according to the size of fluorescent value.Therefore, by detecting while red and green color laser, real-time, the qualitative and quantitative analysis to reaction is completed.
Colon bacillus, also known as intestinal bacteria, belongs to enterobacteriaceae, Escherichia, is found in 1885.Within a very long time, be taken as one of normal intestinal flora, but in mid-term in 20th century, it is pathogenic that people just recognize that some intestinal bacteria has, diarrhoea and microbemia can be caused.
Mastigoneme is formed along the medium pore canal eccentric pattern of diameter 20nm by the flagellin subunit of diameter 4.5nm, 8-10 subunit weekly.Flagellin subunit determines the specificity of H-antigen.Subunit of fliC negative gene responsible editor code flagellum unit, its two ends are conserved regions, and centre is special district.Most of intestinal bacteria only have a gene being responsible for coding flagellin, fliC gene high special between different serotypes, conservative in phase homologous serotype, size is at 500-1000bp, therefore can be used to design primer and probe, detect different H-antigen serotype.
At present, detect the mainly traditional slide agglutination experiment of the method for intestinal bacteria H antigen serotype and antiserum(antisera) is tested, but shortcoming is also obvious easily occurs cross agglutination and false positive.Also occur that some Molecular strain typing methods are as PCR detection technique in recent years successively, and the real-time fluorescence quantitative PCR be derived by PCR detection technique and multiple PCR technique are also applied to coli flagellum albumen somatotype.Although the method specificity of real-time fluorescence quantitative PCR is high, accurately convenient, convenient operation, expensive equipment, fluorescent probe synthesis difficulty, strongly limit its application.Multiple PCR technique can detect multiple cause of disease simultaneously, but easily forms non-specific amplification and cross reaction.The liquid-phase chip detection system of 3 kinds of flagellins in the detection intestinal bacteria H antigen that the present invention sets up, easy and simple to handle, highly sensitive, high specificity, accuracy is good.Fill up the deficiency of somatotype detection technique in the past.
Summary of the invention
One object of the present invention is just to provide a kind of gene liquid chip method detecting 3 kinds of serotypes in intestinal bacteria H antigen, this chip comprises: fluorescence-encoded microballoon, capture probe, primer, PCR reaction system, SA-PE, is primarily characterized in that described capture probe comprises one or more sequences chosen from following sequence:
(1) selected from the special gene sequence of intestinal bacteria H15 antigen serotype nucleotide sequence; See SEQIDNO:1;
(2) selected from the special gene sequence of intestinal bacteria H28 antigen serotype nucleotide sequence; See SEQIDNO:2;
(3) selected from the special gene sequence of intestinal bacteria H37 antigen serotype nucleotide sequence; See SEQIDNO:3.
A kind of DNA sequence dna in the DNA sequence dna of nucleotide sequence selected from the flagellin special gene sequence of intestinal bacteria H antigen serotype H15, these 3 kinds of bacterial strains of H28, H37 difference of the present invention shown in corresponding SEQIDNO:1-SEQIDNO:3;
Primer sequence of the present invention is the primer order of shown in corresponding SEQIDNO:1-SEQIDNO:6 respectively.
Gene liquid chip of the present invention, the DNA fragmentation of primer sequence wherein or the DNA fragmentation of its complementation.
The preparation method of gene liquid chip of the present invention, comprises nucleic acid extraction, microballoon coupling, pcr amplification and upper machine testing.
The present invention further discloses liquid-phase chip in the application for intestinal bacteria H antigen flagellin serotype context of detection.The detection probes applied comprises at least one in the DNA sequence dna shown in SEQIDNO:1-SEQIDNO:3.
As seen from the above technical solutions, liquid-phase chip technology is introduced the detection field of intestinal bacteria H antigen flagellin serotype by the present invention first, establish a kind of quick, sensitive, accuracy is high, repeatability strong liquid-phase chip and detection method thereof, due to easy and simple to handle, accuracy is high, repeatability is strong, and this liquid-phase chip has important using value in field of medical examination.
Accompanying drawing explanation
Figure 13 plants flagellin type specific gene probe specificity and compares;
Fig. 2 comprises: the sensitivity technique of Fig. 2 A intestinal bacteria H15 serotype;
The sensitivity technique of Fig. 2 B intestinal bacteria H28 serotype;
The sensitivity technique of Fig. 2 C intestinal bacteria H37 serotype;
Fig. 3 actual sample detects figure; The digitized representation microballoon numbering occurred in figure, such as (45) etc.
Strain Escherichia coli source used by the present invention is as shown in table 1 below:
Bacterial classification used by this experiment of table 1
Embodiment 1
The Design & preparation of primer, probe
1, the screening of probe
Specific probe is whole liquid-phase chip technology core, and general employing first designs specific probe, and then designs corresponding primer according to probe location.
Due to the requirement of later stage multiplex PCR, therefore when designing probe in early stage, should focus on ensureing all probe Tm values within the specific limits, this research chooses Tm value scope 55
+2 DEG C.During designing probe by the cut to lengthen of probe between 18-25bp, GC content controls at 30-60%.Devise many specific probes for each target gene during design in early stage so not only to ensure to filter out conservative special again probe, more can also guarantee the reliability of detected result.
Expect that not only conservative but also special probe is iff being far from being enough by bioinformatic analysis, the probe sometimes meeting very much above-mentioned condition but can not get stable positive signal in actual crossover process.Therefore the probe designed has to pass through machine testing in actual chips and carries out screening repeatedly, guarantee really probe effectively.
This research, through repeated multiple times experiment screening, finally obtains the probe sequence that often kind of bacterium is special, as shown in table 1:
The sequence oligonucleotide probe that table 2 gene chip of the present invention is selected and detectable flagellin serotype
2, the design of primer
By reading lot of documents, this research is finally determined with intestinal bacteria H antigen fliC gene for target gene.PrimerPremier5.0 is utilized to design primer, set operating software after the parameters such as the length of primer, Primer type, base number, from Output rusults, find out Tm value=62 DEG C ± 2 DEG C, base number inner without secondary structure and amplified fragments comprises the primer of probe sequence without dimer, primer between 18-30bp, between primer.And finally to ensure that the object fragment that all primer PCRs increase out is being less than 300bp.Utilize the primer multiplex PCR designed, the primer finally obtained is as shown in table 2:
Primer used by table 3 chip
The preparation of embodiment 2, gene liquid chip
1, choose coding microball (bio-rad or Luminex company), the corresponding microballoon numbering of each probe, 3 kinds of flagellin serotype microballoon numberings that just needs 3 are different, as the probe of No. 045 microballoon coupling H37, get about 1.25 × 10
6individually be placed in centrifuge tube, 12000rpm/min, centrifugal 3-5 minute, carefully removes supernatant;
2, the MES(2-(n-morpholino of 10uL0.1M is added) ethyl sulfonic acid solution), fully shake mixing, centrifugal a little;
3, with distilled water, the oligonucleotide probe of synthesis is diluted to 0.1mmol/L; Add the H37 probe of 4uL dilution in No. 045 microsphere suspension liquid, vibration mixing;
4, add the EDC solution of the freshly prepared 10mg/mL of 2.5uL in microballoon and probe mixed solution, vibration, room temperature lucifuge hatches 30 minutes, and this step requires fast operating;
5, repeating step 4;
6, wash once with 1mL0.02%Tween20, the centrifugal 3-5 minute of 12000rpm/min;
7, carefully abandon supernatant, microballoon is resuspended in 1mL0.1%SDS, vibration mixing;
8, the centrifugal 3-5 minute of 12000rpm/min, carefully abandons supernatant, and microballoon is resuspended in 30uLpH8.0TE, and mixing has been hanged in vibration, namely obtains the detection microballoon that coupling is good;
9, by the quantity of Hematocyte Counter counting microballoon, the unit concentration of often kind of microballoon is conversed;
10, detection microballoon good for coupling is placed on 4 DEG C to keep in Dark Place, the microballoon of often kind of probe conjugate is preserved separately, during use, selects the microballoon kind that will mix according to test item.
The extraction of embodiment 3, sample nucleic acid
1, get in 1.5mL bacterium liquid centrifuge tube, centrifugal 5 minutes of 8000rpm, abandons supernatant, repeats to wash once.
2, add 250 μ L50mMTris-HCl damping fluids (pH8.0) resuspended, centrifugal 5 minutes of 12000rpm, abandons supernatant.
3, add 250 μ L50mMTris-HCl damping fluids (pH8.0) resuspended, then add 10 μ L0.45MEDTA (pH8.0), fully suspend, 37 DEG C of temperature are bathed 20 minutes.
4, add 10 μ L20mg/mL N,O-Diacetylmuramidases, 37 DEG C of temperature are bathed 20 minutes.
5, add 1.5 μ L20mg/mL Proteinase Ks, softly mix.
6, add 15 μ L10%SDS, 50 DEG C of water-baths 2 are little of solution clarification, and period puts upside down mixing several times gently.
7,2 μ L20mg/mLRNAse are added, 65 DEG C of water-baths 30 minutes.
8, with the rifle head cutting off tip, above-mentioned solution is moved on in new clean centrifuge tube.
9, in stink cupboard, add 250 μ L phenol: chloroform: primary isoamyl alcohol (25:24:1), fully mixes, 12000rpm, 4 DEG C centrifugal 10 minutes, and new centrifuge tube transferred to by supernatant liquor, repeats once.
10, in stink cupboard, add 250 μ L chloroforms: primary isoamyl alcohol (24:1), fully mixes, 12000rpm, 4 DEG C centrifugal 10 minutes, and new centrifuge tube transferred to by supernatant liquor.
11, the dehydrated alcohol of the precooling in advance of 2.5 times of volumes is added, jog, in-80 DEG C of precipitation DNA.12000rpm, 4 DEG C of centrifugal 15min.
12, by 1mL70% ice washing with alcohol DNA precipitation, then at 65 DEG C, 10min is dried.
13, dissolve with 30 μ LTE, and for subsequent use in-20 ° of C refrigerators.
Embodiment 4, sample pcr amplification
Using the template that the supernatant liquor reclaimed reacts as PCR, PCR reaction system and reaction conditions:
PCR reaction system:
PCR reaction conditions:
With the agarose gel electrophoresis inspection amplification situation of 2% after reaction terminates
Embodiment 5, detection
1, outstandingly to shake, supersound process microballoon (crosslinked probe) 20 seconds with resuspended it;
2, preparation mixing microballoon working fluid: each group of microballoon is diluted to 150/ul with 1.5 х TMAC hybridization solutions; (note: each reaction needed 33ul mixing microballoon working fluid)
3, outstandingly to shake, supersound process microballoon 20 seconds to be to mix working fluid;
4, in each reacting hole and blank control wells, 33ul working fluid is added;
5, in each blank well, 17ulTE(pH8.0 is added); And in each sample well, add biotinylated amplified production 17ul respectively;
6, with the upper and lower pressure-vaccum of rifle for several times to mix each reacting hole;
7, build Sptting plate with prevent volatilization, be placed on 95-100 DEG C 5 minutes to make PCR primer denatured double stranded;
8, again Sptting plate is placed in afterwards 57 DEG C 15 minutes;
9, fresh nitrite ion is prepared: with 1 х TMAC hybridization solution by streptavidin-R-phycoerythrin(SA-PE) be made into 2-4ug/ml; (note: every hole needs 75ul nitrite ion)
10, prewet with 1 х TMAC hybridization solution by the Milliporefilterplate of 1.2um, negative pressure is found time again afterwards; The reaction solution of having hybridized is moved in the hole of having prewetted afterwards, find time to remove supernatant by negative pressure; Every hole adds 75ul nitrite ion more afterwards, and with the upper and lower pressure-vaccum of the volley of rifle fire for several times with resuspended reaction solution; Rapidly reaction solution is retracted in PCR plate;
11, Sptting plate is placed in hybridization temperature 120r/min again and hatches 15 minutes;
12, after having reacted, on 57 DEG C, detect with Luminex100 machine;
13, BIO-Plex detection system, by red, green two bundle laser detection, red laser excites the dyestuff of microsphere matrices thus identifies microballoon numbering, and green laser identifies the fluorescence dye that microsphere surface combines, and realizes the quantitative analysis of the PCR primer that capture probe is caught.
When detecting, carry out detection as detection background using PCR negative control simultaneously.For each detection system and detection background, the data that instrument exports are fluorescence intensity median (MedianFluorescenceIntensity of a kind of numbering population of microspheres in respective reaction system, MFI), the statistical average value of each microballoon strength of signal of the population of microspheres (>100) of this numbering namely read.
Result interpretation: be judged to the positive when the MFI value of sample to be detected is more than 5 times of the detection background strength of signal of its correspondence.
Embodiment 6, flagellin serotype sensitivity technique
In order to probe into the detection sensitivity of this invention, we carry out sensitivity technique experiment to 3 kinds in 3 kinds of flagellin serotype, and concrete grammar is as follows:
1. with NanoDropOD instrument, the genome concentration extracted is measured, and dilution is 100ng/ μ L, 10ng/ μ L, 1ng/ μ L, 100pg/ul, 10pg/ul, 1pg/ul, 100fg/ul, 10fg/ul, 1fg/ul respectively.
2. pcr amplification is carried out to genome, chip hybridization, upper machine testing.
3. detected result is shown in Fig. 2 A, 2B, 2C.
Embodiment 7, actual sample detect
May be used for the detection of intestinal bacteria H antigen flagellin serotype to probe into this invention, any 3 kinds of flagellin serotypes that we choose except H15, H28 and H37 detect.Concrete grammar is as follows:
1. first the genome of the hemophilus influenzae of 3 kinds of selected serotypes is all diluted respectively for 100ng/ μ L.
2. PCR amplification system is with embodiment 4.
3. chip hybridization, upper machine testing.
4. detected result is shown in Fig. 3.
SEQUENCELISTING
<110> Nankai University
<120> detects gene liquid chip and the detection method of 3 kinds of serotypes in intestinal bacteria H serotype
<160>9
<170>PatentInversion3.5
<210>1
<211>21
<212>DNA
<213> artificial sequence
<400>1
ggcaacattgaatgatgtcct21
<210>2
<211>20
<212>DNA
<213> artificial sequence
<400>2
cagtgctggcttgacctctg20
<210>3
<211>22
<212>DNA
<213> artificial sequence
<400>3
cacagttgatgttggagctact22
<210>4
<211>19
<212>DNA
<213> artificial sequence
<400>4
actaagaacggctctgata19
<210>5
<211>17
<212>DNA
<213> artificial sequence
<400>5
tgccgctatcgaagtca17
<210>6
<211>18
<212>DNA
<213> artificial sequence
<400>6
atcggttgatgtcgttct18
<210>7
<211>19
<212>DNA
<213> artificial sequence
<400>7
ccagtcagagtagccagtt19
<210>8
<211>18
<212>DNA
<213> artificial sequence
<400>8
cactctggctggcggtac18
<210>9
<211>23
<212>DNA
<213> artificial sequence
<400>9
cctgtgtgttgttgtactatacc23
Claims (7)
1. one kind is detected the gene liquid chip of intestinal bacteria 3 kinds of flagellin serotypes, this chip comprises: fluorescence-encoded microballoon, capture probe, primer, PCR reaction system, SA-PE, is primarily characterized in that described capture probe comprises a kind of sequence from choosing shown in SEQIDNO:1-SEQIDNO:3.
2. gene liquid chip according to claim 1, it is characterized in that described nucleotide sequence selected from the flagellin special gene sequence of intestinal bacteria H serotype H15, these 3 kinds of bacterial strains of H28, H37 has from one or more DNA sequence dnas the DNA sequence dna shown in SEQIDNO:1-SEQIDNO:3, wherein:
(1) selected from the special gene sequence of intestinal bacteria H15 serotype nucleotide sequence; See SEQIDNO:1;
(2) selected from the special gene sequence of intestinal bacteria H28 serotype nucleotide sequence; See SEQIDNO:2;
(3) selected from the special gene sequence of intestinal bacteria H37 serotype nucleotide sequence; See SEQIDNO:3.
3. gene liquid chip according to claim 1, is characterized in that described primer sequence: have one or more primer order shown in SEQIDNO:4-SEQIDNO:9.
4. gene liquid chip according to claim 1, is characterized in that the preparation method of described gene liquid chip, comprises nucleic acid extraction, microballoon coupling, pcr amplification and upper machine testing.
5. liquid-phase chip described in claim 1 is in the application for intestinal bacteria H antigen 3 kinds of serotype context of detection.
6. the application of liquid-phase chip according to claim 5, is characterized in that applied detection probes comprises at least one in the DNA sequence dna shown in SEQIDNO:1-SEQIDNO:3.
7. described in claim 1, examine the application of intestinal bacteria H antigen 3 kinds of serotype gene liquid chips in preparation detection intestinal bacteria H antigen flagellin gene is diseases induced.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610023282.6A CN105483266A (en) | 2016-01-15 | 2016-01-15 | Gene liquid chip for detecting three serotypes in colibacillus H serotype and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610023282.6A CN105483266A (en) | 2016-01-15 | 2016-01-15 | Gene liquid chip for detecting three serotypes in colibacillus H serotype and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105483266A true CN105483266A (en) | 2016-04-13 |
Family
ID=55670537
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610023282.6A Pending CN105483266A (en) | 2016-01-15 | 2016-01-15 | Gene liquid chip for detecting three serotypes in colibacillus H serotype and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105483266A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011281A (en) * | 2016-07-19 | 2016-10-12 | 浙江大学 | Detection methods of intestinal segmented filamentous bacteria flagellin |
| CN108950038A (en) * | 2018-09-05 | 2018-12-07 | 江苏省疾病预防控制中心 | A kind of Escherichia coli H Serotypes detection kit and detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305627A (en) * | 2013-07-16 | 2013-09-18 | 中国农业科学院上海兽医研究所 | Escherichia coli O1, O2, O18 and O78 serotype detection kit and detection method thereof |
| CN105112506A (en) * | 2015-07-30 | 2015-12-02 | 南开大学 | Gene liquid chip for typing 10 K antigens of Escherichia coli in sample and detection method thereof |
-
2016
- 2016-01-15 CN CN201610023282.6A patent/CN105483266A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305627A (en) * | 2013-07-16 | 2013-09-18 | 中国农业科学院上海兽医研究所 | Escherichia coli O1, O2, O18 and O78 serotype detection kit and detection method thereof |
| CN105112506A (en) * | 2015-07-30 | 2015-12-02 | 南开大学 | Gene liquid chip for typing 10 K antigens of Escherichia coli in sample and detection method thereof |
Non-Patent Citations (1)
| Title |
|---|
| KARIN BALLMER ET AL: "Fast DNA Serotyping of Escherichia coli by Use of an Oligonucleotide Microarray", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011281A (en) * | 2016-07-19 | 2016-10-12 | 浙江大学 | Detection methods of intestinal segmented filamentous bacteria flagellin |
| CN106011281B (en) * | 2016-07-19 | 2019-04-23 | 浙江大学 | The detection method of enteron aisle merogenesis der Pilz flagellin |
| CN108950038A (en) * | 2018-09-05 | 2018-12-07 | 江苏省疾病预防控制中心 | A kind of Escherichia coli H Serotypes detection kit and detection method |
| CN108950038B (en) * | 2018-09-05 | 2022-01-14 | 江苏省疾病预防控制中心 | Escherichia coli H serotype typing detection kit and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101985665B (en) | Method for detecting various respiratory viruses and primers and probes thereof | |
| US9476101B2 (en) | Scanning multifunctional particles | |
| Kuschel et al. | Robust methylation‐based classification of brain tumours using nanopore sequencing | |
| CN101560558B (en) | Method for detecting suspension chip of multiple PCR products | |
| CN114196746A (en) | Detection of nucleic acids | |
| CN104263848B (en) | A kind of deaf susceptibility gene mutation detection kit and preparation method thereof and application | |
| CN103911447B (en) | Detect plasmodial primer, probe and method | |
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN101701266A (en) | Gene chip for detecting influenza A virus and preparation method and application thereof | |
| CN109097446A (en) | A kind of method and kit detecting miRNA | |
| CN105483266A (en) | Gene liquid chip for detecting three serotypes in colibacillus H serotype and detection method | |
| CN103898240B (en) | Detect the primer of dengue virus and somatotype thereof, probe and method | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN105331693A (en) | Gene liquid chip for conducting typing on eight O-antigens of plesiomonas shigelloides and detection method | |
| KR102276396B1 (en) | A composition and RT-qPCR based chip for detecting avian influenza viruses and method for detecting avian influenza viruses using the same | |
| CN105112506A (en) | Gene liquid chip for typing 10 K antigens of Escherichia coli in sample and detection method thereof | |
| CN105112509A (en) | Gene liquid chip and detection method for detecting six capsule serotypes of Haemophilus influenzae | |
| CN103667527B (en) | Liquid phase chip detection primer of potato spindle tuber viroid, and detection method thereof | |
| CN101429545A (en) | Method for detecting Shigella by using suspension chip technology | |
| CN101403000A (en) | Method for detecting pathogenic shigella by using suspending chip technique | |
| CN116732209B (en) | Kit and method for simultaneously detecting drug resistance genes ISCR2 and FLOR based on digital PCR technology | |
| CN101487047B (en) | Method for detecting Vibrio cholerae O1 by suspending chip technology | |
| Sanchez Barea et al. | Droplet microfluidics for single‐molecule and single‐cell analysis in research, diagnosis, and therapy | |
| KR102143795B1 (en) | Loop Mediated Isothermal Amplification Primer Set for Detection of Dengue Virus Serotype 2 or 4 and Uses Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160413 |
|
| WD01 | Invention patent application deemed withdrawn after publication |