CN105087793A - Rapid single-tube detection method and rapid single-tube detection kit for multipoint mutation of NRAS gene - Google Patents
Rapid single-tube detection method and rapid single-tube detection kit for multipoint mutation of NRAS gene Download PDFInfo
- Publication number
- CN105087793A CN105087793A CN201510496448.1A CN201510496448A CN105087793A CN 105087793 A CN105087793 A CN 105087793A CN 201510496448 A CN201510496448 A CN 201510496448A CN 105087793 A CN105087793 A CN 105087793A
- Authority
- CN
- China
- Prior art keywords
- primer
- nras
- single tube
- detection kit
- fluorescent probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a rapid single-tube detection method and a rapid single-tube detection kit for multipoint mutation. The rapid single-tube detection method for multipoint mutation includes: 1) designing ARMS primers as well as downstream primers, mediated ligation primers, a universal fluorescence probe and a quenching probe corresponding to the ARMS primers; 2) mixing the ARMS primers as well as the downstream primers, the mediated ligation primers, the universal fluorescence probe and the quenching probe corresponding to the ARMS primers with a rapid hot-start Taq enzyme system prior to amplification; 3) detecting fluorescence change of a reaction system and determining whether point mutation exists or not. The rapid single-tube detection method has the advantages that the rapid single-tube detection method is simple to operate and capable of detecting existence of multipoint mutation qualitatively; the primers used in the detection method are low in design difficulty, so that primer synthesis cost is reduced substantially; limitations of an existing ARMS technology are overcome, and detection throughput is improved greatly; substituting single-tube reaction for previous multi-tube detection is achieved, and accordingly, manpower and material resources are saved.
Description
Technical field
The present invention relates to a kind of mutation detection kit, particularly a kind of NRAS multipoint mutation single tube quick detection kit.
Background technology
Point mutation and many tumours have close relationship, there are some researches show, the point mutation in some group site can make the incidence of tumour significantly improve.Oncogene N-ras develops closely related and is extensively studied by people because of the generation of itself and mankind's Several Kinds of Malignancy.The N-ras gene be activated can be undergone mutation, and it is by changing catalytic activity of protein thus strengthening the signal in downstream, finally cause cell propagation and to vicious transformation.Simultaneously N-ras gene also participates in the precision control to cell senescence and apoptosis.
To have found at present in kinds cancer (cancer of the stomach,
acute myeloid leukaemiadeng) there is NRAS transgenation.But, mutant cell is often mixed in together with wild-type cell, and therefore extracted DNA, often with a large amount of wild-type DNA, needs higher specificity so detect somatic mutation, and now widely used direct sequencing detectivity is limited, clinical requirement can not be met completely.
Because the catastrophe point of NRAS genomic medicine sensitivity is more, fluorescence PCR detection reagent kit on the market generally uses single gene mutation to detect, and analytic process is loaded down with trivial details and there is no need.Whole testing process is comparatively slow simultaneously, wastes a large amount of time and resource.
Be necessary the detection kit developing a kind of NRAS multipoint mutation more rapidly and efficiently.
Summary of the invention
The object of the present invention is to provide a kind of NRAS multipoint mutation single tube method for quick and test kit efficiently.
The technical solution used in the present invention is:
Multipoint mutation single tube method for quick, comprises the steps:
1) downstream primer, the intermediary that design ARMS primer and the correspondence of suddenling change for difference connect primer, universal fluorescent probe and quenching probes thereof; Wherein, intermediary connects primer and is made up of universal sequence part and distinguished sequence part, universal sequence part and universal fluorescent probe portion complementary, the partial sequence complementarity in distinguished sequence part and point mutation downstream;
2) downstream primer of ARMS primer and correspondence, intermediary are connected primer, universal fluorescent probe and quenching probes thereof and mix with the quick Taq enzyme system of warm start, increase;
3) change in fluorescence of detection reaction system, determines whether there is point mutation.
As the further improvement of aforesaid method, downstream primer, intermediary that ARMS primer pair is answered connect primer, universal fluorescent probe and should be degeneracy, namely downstream primer, intermediary connects primer, universal fluorescent probe can correspond to many.
As the further improvement of aforesaid method, Nucleotide universal fluorescent probe connecting fluorophor is no more than 4 Nucleotide with the spacing of Nucleotide after complementary pairing quenching probes being connected quenching group, further, 3,2,1 or be connected on two Nucleotide of mutually pairing is no more than.
As the further improvement of aforesaid method, intermediary connects in primer and is no less than 10bp with the nucleic acid quantity of the partial sequence complementarity in downstream, mutational site, and especially, complementary nucleic acid quantity is 15 ~ 30bp.
As the further improvement of aforesaid method, intermediary connects the nucleic acid quantity of matching with universal fluorescent probe portion complementary nucleic acid in primer and is no less than 10bp, and especially, complementary nucleic acid quantity is 15 ~ 45bp.
The existence of complementary sequence, is conducive to ensureing to there is enough avidity between primer, ensures the reliability of detected result.
As the further improvement of aforesaid method, one end of universal fluorescent probe is connected with protection nucleotide sequence.The effect of protection sequence is to prevent the critical sequences of probe from not excised too early by the exonuclease being not intended in reaction system introduce.Protection sequence not with the complementary pairing such as sequence to be measured, primer, can be simple repeated sequence, as multiple A, T, C, G etc.
A kind of NRAS multipoint mutation single tube quick detection kit, comprise DNA extraction liquid, quick Taq enzyme system and NRAS abrupt climatic change primer, it is characterized in that: described NRAS abrupt climatic change primer by downstream primer, the intermediary's connection primer of organizing ARMS primer and correspondence more, and universal fluorescent probe composition; Wherein: intermediary connects a terminal sequence of primer and treats the partial sequence complementarity in downstream, NRAS mutational site, and the other end sequence and universal fluorescent probe portion complementary nucleic acid match.
Quick Taq enzyme system consist of dNTPS(U), UNG enzyme, fast Taq enzyme.
Preferably, the intermediary used in above-mentioned NRAS multipoint mutation single tube quick detection kit connects in primer and is no less than 10bp with the nucleic acid quantity of the partial sequence complementarity in downstream, NRAS mutational site, and especially, complementary nucleic acid quantity is 15 ~ 30bp.
Preferably, the intermediary used in above-mentioned NRAS multipoint mutation single tube quick detection kit connects the nucleic acid quantity of matching with universal fluorescent probe portion complementary nucleic acid in primer and is no less than 10bp, and especially, complementary nucleic acid quantity is 15 ~ 45bp.
Especially, the sequence of the ARMS primer used in above-mentioned NRAS multipoint mutation single tube quick detection kit is as follows:
G12S:CTGGTGGTGGTTGGAGCAA(SEQIDNO:1)
G12R:CTGGTGGTGGTTGGAGCAC(SEQIDNO:2)
G12C:ACTGGTGGTGGTTGGAGCAT(SEQIDNO:3)
G12D:TGGTGGTGGTTGGAGCAGA(SEQIDNO:4)
G12A:TGGTGGTGGTTGGAGCAGC(SEQIDNO:5)
G12V:TGGTGGTGGTTGGAGCAGT(SEQIDNO:6)
G13D:TGGTGGTTGGAGCAGGTGA(SEQIDNO:7)
Q61L:ATACTGGATACAGCTGGACT(SEQIDNO:8)
Q61R:TACTGGATACAGCTGGACG(SEQIDNO:9)
Especially, the sequence of the universal fluorescent probe used in above-mentioned NRAS multipoint mutation single tube quick detection kit is as follows:
Universal fluorescent probe:
5’-TG(dT-FAM)CTGATCTACGTGATACGTGAACATGACGGATTTTTTTTTTTTTTTT-3’
General quenching probes: 5 ' BHQ-TCAGACA-3 '.
The invention has the beneficial effects as follows:
1) of the present invention simple to operate, qualitative detection can go out the existence of multipoint mutation.The design of primers difficulty used in detection method of the present invention is low, significantly reduces the cost of primer synthesis.
2) detection method of the present invention overcomes the limitation of existing ARMS technology, substantially increases it and detects flux.
3) detection method of the present invention achieves the simplification of multitube detection reaction, and the multitube before 1 tube reaction instead of detects.Use manpower and material resources sparingly.
4) quick Taq enzyme is used in detection method of the present invention, better than general T aq enzyme.
Accompanying drawing explanation
Fig. 1 to Fig. 6 is the schematic diagram of detection method;
Fig. 7 is the pcr amplification curve of isoconcentration template under different Taq enzyme reaction conditions, illustrates that the quick Taq enzyme used in this test kit is better than the expanding effect of general T aq enzyme.
Embodiment
Below in conjunction with accompanying drawing, further illustrate Cleaning Principle of the present invention.
With NRAS catastrophe point Q61L for example, the wild-type of this point is A, and saltant type is T, in PCR process, first uses 1 pair of primer, containing 1 ARMS primer for catastrophe point (last base of primer is T) and downstream primer.This primer is specific under the effect of quick enzyme amplifies mutational site T, and wild type site A is not amplified.As shown in Figure 1;
After specific amplification occurs, under the guiding of ARMS primer, quick Taq enzyme is along DNA profiling from 5 '-3 ' direction moves and is hydrolyzed intermediary and connect the sequence mediates region of primer, and the probes complementary region that intermediary connects primer is then released, as shown in Figure 2 and Figure 3;
The probes complementary region discharged, based on base pair complementarity principle, with universal fluorescent probe, complementation occurs, under the existence of quenching group, the fluorescence of fluorophor is quenched, as shown in Figure 4;
Quick Taq enzyme connects the probes complementary region of primer, from 5 '-3 by intermediary ' direction moves, hydrolysis quenching group, thus quenching group is away from fluorophor, thus PCR reaction creates fluorescence, as shown in Figure 5, Figure 6.
Therefore, as long as the ARMS primer in multiple mutational site, downstream primer are connected primer with intermediary, 1 group of universal fluorescent probe and general cancellation complementary probe, can be placed in a PCR reaction tubes, namely can detect in sample whether there is point mutation, significantly improve the detection flux of ARMS method.
Embodiment 1
NRAS multipoint mutation single tube quick detection kit, principal constituent is as follows:
1) DNA extraction liquid:
50mMNaOH, 10mMTris-HCl(PH8.0), 1%NP-40,6%Chelex, 0.1mMEDTA(PH8.0) composition
2) quick Taq enzyme system:
The dNTPs(25mM of quick Taq, the 0.5ul of 3U)
3) primer:
The downstream primer of NRASARMS primer and correspondence:
Intermediary connects primer:
4) universal fluorescent probe is to as follows:
Universal fluorescent probe:
5’
-TG(dT-FAM)CTGATCTACGTGATACGTGAACATGACGGATTTTTTTTTTTTTTTT-3’
General quenching probes: 5 '
bHQ-TCAGACA-3 '
Use NRAS multipoint mutation single tube quick detection kit, operation steps is as follows:
1) DNA extraction:
Get the FFPE tissue slice of 2 10 μm, put into after scraping down in 1.5ml centrifuge tube, then add the DNA extraction liquid of 120 μ l, 100 DEG C boil 10 minutes after, by centrifugal for centrifuge tube 12000rpm 5 minutes, the supernatant getting 10 μ l joined in PCR reaction tubes;
2) fast PCR:
In 50 μ l fluorescent PCR systems, the quick Taq enzyme of 3U, the UNG enzyme of 10mMTris-HCL, 50mMKCL, 0.5U, 0.2mMdNTPS(U), 3mMMgCl2.Universal fluorescent probe and each 1 μm of general cancellation complementary probe, the ARMS primer in 5 mutational sites, downstream primer are connected each 1 μm of primer with intermediary.After 95 degree of 5min, 95 DEG C 5 seconds, 58 DEG C 31 seconds, cycle number is 40 circulations;
3) monitor the change in fluorescence of reaction system, as there is point mutation, then fluorescent signal can increase.
SEQUENCELISTING
<110> Guangzhou two kinds of substance synthesis into another Technology Co., Ltd.
<120>NRAS gene multipoint mutation single tube method for quick and test kit
<130>
<160>14
<170>PatentInversion3.5
<210>1
<211>19
<212>DNA
<213> artificial sequence
<400>1
ctggtggtggttggagcaa19
<210>2
<211>19
<212>DNA
<213> artificial sequence
<400>2
ctggtggtggttggagcac19
<210>3
<211>20
<212>DNA
<213> artificial sequence
<400>3
actggtggtggttggagcat20
<210>4
<211>19
<212>DNA
<213> artificial sequence
<400>4
tggtggtggttggagcaga19
<210>5
<211>19
<212>DNA
<213> artificial sequence
<400>5
tggtggtggttggagcagc19
<210>6
<211>19
<212>DNA
<213> artificial sequence
<400>6
tggtggtggttggagcagt19
<210>7
<211>19
<212>DNA
<213> artificial sequence
<400>7
tggtggttggagcaggtga19
<210>8
<211>20
<212>DNA
<213> artificial sequence
<400>8
atactggatacagctggact20
<210>9
<211>19
<212>DNA
<213> artificial sequence
<400>9
tactggatacagctggacg19
<210>10
<211>25
<212>DNA
<213> artificial sequence
<400>10
tgggtaaagatgatccgacaagtga25
<210>11
<211>20
<212>DNA
<213> artificial sequence
<400>11
gctcctagtacctgtagagg20
<210>12
<211>35
<212>DNA
<213> artificial sequence
<400>12
atccgtcatgttcacgtatccagtgcgcttttccc35
<210>13
<211>35
<212>DNA
<213> artificial sequence
<400>13
atccgtcatgttcacgtatccatggcactgtactc35
<210>14
<211>48
<212>DNA
<213> artificial sequence
<400>14
tgctgatctacgtgatacgtgaacatgacggatttttttttttttttt48
Claims (9)
1. multipoint mutation single tube method for quick, comprises the steps:
The downstream primer, the intermediary that design ARMS primer and the correspondence of suddenling change for difference connect primer and universal fluorescent probe, wherein, intermediary connects primer by the universal sequence part with universal fluorescent probe portion complementary with form with the specific part of the partial sequence complementarity in point mutation downstream; By the downstream primer of ARMS primer and correspondence, intermediary connects primer and universal fluorescent probe mixes with quick Taq enzyme system, increases;
The change in fluorescence of detection reaction system, determines whether there is point mutation.
2. a NRAS multipoint mutation single tube quick detection kit, comprise DNA extraction liquid, quick Taq enzyme system and NRAS abrupt climatic change primer, it is characterized in that: described NRAS abrupt climatic change primer by downstream primer, the intermediary's connection primer of organizing ARMS primer and correspondence more, and universal fluorescent probe composition, wherein:
Intermediary connects a terminal sequence of primer and the partial sequence complementarity in downstream, NRAS mutational site to be detected, and the other end sequence and universal fluorescent probe portion complementary nucleic acid match.
3. NRAS multipoint mutation single tube quick detection kit according to claim 2, is characterized in that: fast Taq enzyme system consist of dNTPS(U), UNG enzyme, fast Taq enzyme.
4. NRAS multipoint mutation single tube quick detection kit according to claim 2, is characterized in that: intermediary connects in primer and is no less than 10bp with the nucleic acid quantity of the partial sequence complementarity in downstream, NRAS mutational site.
5. NRAS multipoint mutation single tube quick detection kit according to claim 4, is characterized in that: it is 15 ~ 30bp that intermediary to connect in primer with the nucleic acid quantity of the partial sequence complementarity in downstream, NRAS mutational site.
6. NRAS multipoint mutation single tube quick detection kit according to claim 2, is characterized in that: intermediary connects the nucleic acid quantity of matching with universal fluorescent probe portion complementary nucleic acid in primer and is no less than 10bp.
7. NRAS multipoint mutation single tube quick detection kit according to claim 6, is characterized in that: it is 15 ~ 45bp that intermediary connects the nucleic acid quantity of matching with universal fluorescent probe portion complementary nucleic acid in primer.
8. the NRAS multipoint mutation single tube quick detection kit according to claim 2 ~ 7 any one, is characterized in that: the sequence of ARMS primer is as follows:
。
9. NRAS multipoint mutation single tube quick detection kit according to claim 8, is characterized in that:
The sequence of universal fluorescent probe is:
5’-TG(dT-FAM)CTGATCTACGTGATACGTGAACATGACGGATTTTTTTTTTTTTTTT-3’
General quenching probes: 5 ' BHQ-TCAGACA-3 '.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510496448.1A CN105087793A (en) | 2015-08-13 | 2015-08-13 | Rapid single-tube detection method and rapid single-tube detection kit for multipoint mutation of NRAS gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510496448.1A CN105087793A (en) | 2015-08-13 | 2015-08-13 | Rapid single-tube detection method and rapid single-tube detection kit for multipoint mutation of NRAS gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105087793A true CN105087793A (en) | 2015-11-25 |
Family
ID=54569119
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510496448.1A Pending CN105087793A (en) | 2015-08-13 | 2015-08-13 | Rapid single-tube detection method and rapid single-tube detection kit for multipoint mutation of NRAS gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105087793A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112176062A (en) * | 2020-10-13 | 2021-01-05 | 苏州中科先进技术研究院有限公司 | Nucleic acid composition for detecting NRAS gene mutation and kit thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012112582A2 (en) * | 2011-02-14 | 2012-08-23 | Swift Biosciences, Inc. | Polynucleotide primers and probes |
CN104293913A (en) * | 2014-08-28 | 2015-01-21 | 广州和实生物技术有限公司 | Multiple mutation single tube rapid detection method and kit |
CN104762410A (en) * | 2015-04-29 | 2015-07-08 | 上海允英医疗科技有限公司 | Primer, probes and detection kit used for full RAS mutation detection |
-
2015
- 2015-08-13 CN CN201510496448.1A patent/CN105087793A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012112582A2 (en) * | 2011-02-14 | 2012-08-23 | Swift Biosciences, Inc. | Polynucleotide primers and probes |
CN104293913A (en) * | 2014-08-28 | 2015-01-21 | 广州和实生物技术有限公司 | Multiple mutation single tube rapid detection method and kit |
CN104762410A (en) * | 2015-04-29 | 2015-07-08 | 上海允英医疗科技有限公司 | Primer, probes and detection kit used for full RAS mutation detection |
Non-Patent Citations (1)
Title |
---|
杨建刚等: "急性髓系白血病中Nras基因点突变的检测以及信号传导通路蛋白的表达", 《现代医学》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112176062A (en) * | 2020-10-13 | 2021-01-05 | 苏州中科先进技术研究院有限公司 | Nucleic acid composition for detecting NRAS gene mutation and kit thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104293913B (en) | Multipoint mutation single tube method for quick and test kit | |
Madic et al. | Pyrophosphorolysis-activated polymerization detects circulating tumor DNA in metastatic uveal melanoma | |
CN105039534A (en) | C-KIT gene multipoint mutation single tube fast detection method and kit | |
CN105112500B (en) | A kind of primer, probe and kit for being used to detect C-KIT gene mutations | |
WO2016095093A1 (en) | Method for screening tumor, method and device for detecting variation of target region | |
CN105624274B (en) | Tumor-targeting drug associated gene mutation high-flux detection method, primer and reagent | |
JP2012525147A5 (en) | ||
CN105603061A (en) | Method, probe, primer and kit for detecting methylation of human Septin 9 gene based on digital PCR technology | |
CN103436613A (en) | Fluorescent PCR (Polymerase Chain Reaction) detection kit for IDH1/IDH2 (isocitrate dehydrogenase 1/isocitrate dehydrogenase 2) gene mutation and application thereof | |
WO2016109939A1 (en) | Method and reagent for enrichment of circulating tumor dna | |
CN107988372A (en) | A kind of kit and its detection method for detecting susceptibility gene of colorectal cancer mutation | |
CN110951828A (en) | Design method of primer and probe | |
CN105861641A (en) | Primer, kit and method for detecting CHO cell DNA residues | |
CN107523617A (en) | The standard items of intestinal cancer clinical drug-resistant genetic test and its application | |
CN104830981A (en) | KRAS gene multipoint mutation single tube rapid detection method and kit | |
Sethi et al. | Analytical validation of the Signatera™ RUO assay, a highly sensitive patient-specific multiplex PCR NGS-based noninvasive cancer recurrence detection and therapy monitoring assay | |
CN108018353B (en) | Colorectal cancer early screening primer group and kit based on 4 genes | |
CN110079597A (en) | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver | |
CN105087793A (en) | Rapid single-tube detection method and rapid single-tube detection kit for multipoint mutation of NRAS gene | |
CN105087792A (en) | Rapid single-tube detection method and rapid single-tube detection kit for multipoint mutation of PDGFRA (platelet-derived growth factor receptor alpha) gene | |
CN105063177A (en) | BRAF gene multi-point mutation single tube rapid detection method and BRAF gene multi-point mutation single tube rapid detection kit | |
CN107739757A (en) | For detecting primer, probe and the kit of 37 1738 mutation of C KIT gene 17s | |
CN106282329A (en) | A kind of helicobacter pylori gyrA gene mutation detection kit and detection method thereof | |
CN107723361A (en) | For detecting primer, probe and the kit of 1,654 1689 mutation of C KIT genes | |
CN105039533A (en) | PIK3CA gene multipoint mutation single tube fast detection method and kit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
CB02 | Change of applicant information |
Address after: 510665, A8, building fourth, building 11, Kaiyuan Avenue, Science City, Guangzhou hi tech Industrial Development Zone, Guangdong, Applicant after: GUANGZHOU HESHI BIOTECHNOLOGY CO., LTD. Address before: 510665 Guangdong economic and Technological Development Zone, Guangzhou Science City, litchi Road, building No. 6, room 1, room 510 Applicant before: GUANGZHOU HESHI BIOTECHNOLOGY CO., LTD. |
|
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151125 |
|
WD01 | Invention patent application deemed withdrawn after publication |