CN105039533A

CN105039533A - PIK3CA gene multipoint mutation single tube fast detection method and kit

Info

Publication number: CN105039533A
Application number: CN201510395820.XA
Authority: CN
Inventors: 陈华云; 陈嘉昌; 刘淑园; 肖湘文; 丁渭; 邓利琼; 张天海; 邓金萍
Original assignee: GUANGZHOU HESHI BIOTECHNOLOGY Co Ltd
Current assignee: GUANGZHOU HESHI BIOTECHNOLOGY Co Ltd
Priority date: 2015-07-08
Filing date: 2015-07-08
Publication date: 2015-11-11

Abstract

The invention discloses a PIK3CA gene multipoint mutation single tube fast detection method and kit. The PIK3CA gene multipoint mutation single tube fast detection method comprises 1, designing ARMS primers and a corresponding downstream primer, intermediary connection primer, general fluorescent probe and quenching probe, 2, mixing the ARMS primers, the corresponding downstream primer, intermediary connection primer, general fluorescent probe and quenching probe and a hot-start fast Taq enzyme system and carrying out amplification, and 3, detecting a fluorescence change of the reaction system to determine if point mutation exists. The detection method can be operated simply and can realize qualitative detection of multipoint mutation existence. The detection method utilizes the primers with low design difficulty, greatly reduces a primer synthesis cost, solves limitation of the existing ARMS technology, greatly improves detection throughput, realizes single tube reaction replacing the existing multi-tube detection and saves manpower and material resources.

Description

PIK3CA gene multipoint mutation single tube method for quick and test kit

Technical field

The present invention relates to a kind of mutation detection kit, particularly a kind of PIK3CA multipoint mutation single tube quick detection kit.

Background technology

Point mutation and many tumours have close relationship, there are some researches show, the point mutation in some group site can make the incidence of tumour significantly improve.Phosphatidylinositol 3-kinase (PI3K) is the kinases of catalysis inisotol groups phosphorylation, the heterodimer be made up of catalytic subunit and adjustment subunit; According to its substrate structure difference point I, II and type III.PI3K is EGFR downstream signaling molecule, can grown factor receptor tyrosine kinases (as EGFR) activate, make serine/threonine kinases (AKT) phosphorylation and raise the activity of this path and produce various biological effect, comprising and regulate cell proliferation, survival and cell cycle regulating etc.

Found that (as mammary cancer, nonsmall-cell lung cancer etc.) exist PIK3CA transgenation in kinds cancer at present, PIK3CA transgenation causes PI3K/Akt signal path persistent activation.PI3K is activated as EGFR downstream signaling molecule, causes tumour cell to the resistance of the medicines such as EGFR-TKI.So, detect PIK3CA transgenation can predicting tumors patient to the resistance of the medicines such as EGFR-TKI.

Mutant cell is often mixed in together with wild-type cell, therefore extracted DNA is often with a large amount of wild-type DNA, need higher specificity so detect somatic mutation, and now widely used direct sequencing detectivity is limited, can not meet clinical requirement completely.

Because the catastrophe point of PIK3CA genomic medicine sensitivity is more, fluorescence PCR detection reagent kit on the market generally uses single gene mutation to detect, and analytic process is loaded down with trivial details and there is no need.Whole testing process is comparatively slow simultaneously, wastes a large amount of time and resource.

Be necessary the detection kit developing a kind of PIK3CA multipoint mutation more rapidly and efficiently.

Summary of the invention

The object of the present invention is to provide a kind of PIK3CA multipoint mutation single tube method for quick and test kit efficiently.

The technical solution used in the present invention is:

Multipoint mutation single tube method for quick, comprises the steps:

1) downstream primer, the intermediary that design ARMS primer and the correspondence of suddenling change for difference connect primer, universal fluorescent probe and quenching probes thereof; Wherein, intermediary connects primer and is made up of universal sequence part and distinguished sequence part, universal sequence part and universal fluorescent probe portion complementary, the partial sequence complementarity in distinguished sequence part and point mutation downstream;

2) downstream primer of ARMS primer and correspondence, intermediary are connected primer, universal fluorescent probe and quenching probes thereof and mix with the quick Taq enzyme system of warm start, increase;

3) change in fluorescence of detection reaction system, determines whether there is point mutation.

A kind of PIK3CA multipoint mutation single tube quick detection kit, comprise DNA extraction liquid, quick Taq enzyme system and PIK3CA abrupt climatic change primer, it is characterized in that: described PIK3CA abrupt climatic change primer by downstream primer, the intermediary's connection primer of organizing ARMS primer and correspondence more, and universal fluorescent probe composition; Wherein: intermediary connects a terminal sequence of primer and treats the partial sequence complementarity in downstream, PIK3CA mutational site, and the other end sequence and universal fluorescent probe portion complementary nucleic acid match.

Quick Taq enzyme system consist of dNTPS(U), UNG enzyme, fast Taq enzyme.

Preferably, the intermediary used in above-mentioned PIK3CA multipoint mutation single tube quick detection kit connects in primer and is no less than 10bp with the nucleic acid quantity of the partial sequence complementarity in downstream, PIK3CA mutational site, and especially, complementary nucleic acid quantity is 15 ~ 30bp.

Preferably, the intermediary used in above-mentioned PIK3CA multipoint mutation single tube quick detection kit connects the nucleic acid quantity of matching with universal fluorescent probe portion complementary nucleic acid in primer and is no less than 10bp, and especially, complementary nucleic acid quantity is 15 ~ 45bp.

Especially, the sequence of the ARMS primer used in above-mentioned PIK3CA multipoint mutation single tube quick detection kit is as follows:

H1047R：ATGAAACAAATGAATGATGCACG（SEQIDNO：1）

H1047L：CATGAAACAAATGAATGATGCACT（SEQIDNO：2）

E542K：TCTACACGAGATCCTCTCTCTA（SEQIDNO：3）

E545D：AGATCCTCTCTCTGAAATCACTT（SEQIDNO：4）

E545K：AGATCCTCTCTCTGAAATCACTA（SEQIDNO：5）。

Especially, the sequence of the universal fluorescent probe used in above-mentioned PIK3CA multipoint mutation single tube quick detection kit is as follows:

Universal fluorescent probe:

5’-TG(dT-FAM)CTGATCTACGTAGTTGCAGTCAGTTACGTTATTTTTTTTTTTTTTT-3’

General quenching probes: 5 ' BHQ-TCAGACA-3 '.

The invention has the beneficial effects as follows:

1) of the present invention simple to operate, qualitative detection can go out the existence of multipoint mutation.The design of primers difficulty used in detection method of the present invention is low, significantly reduces the cost of primer synthesis;

2) detection method of the present invention overcomes the limitation of existing ARMS technology, substantially increases it and detects flux;

3) detection method of the present invention achieves the simplification of multitube detection reaction, and the multitube before 1 tube reaction instead of detects.Use manpower and material resources sparingly;

4) quick Taq enzyme is used in detection method of the present invention, better than general T aq enzyme.

Accompanying drawing explanation

Fig. 1 to Fig. 6 is the schematic diagram of detection method;

Fig. 7 is the pcr amplification curve of isoconcentration template under different Taq enzyme reaction conditions, illustrates that the quick Taq enzyme used in this test kit is better than the expanding effect of general T aq enzyme.

Embodiment

Below in conjunction with accompanying drawing, further illustrate Cleaning Principle of the present invention.

With PIK3CA catastrophe point H1047R for example, the wild-type of this point is A, and saltant type is G, in PCR process, first uses 1 pair of primer, containing 1 ARMS primer for catastrophe point (last base of primer is G) and downstream primer.This primer is specific under the effect of quick enzyme amplifies mutational site G, and wild type site A is not amplified.As shown in Figure 1;

After specific amplification occurs, under the guiding of ARMS primer, quick Taq enzyme is along DNA profiling to 5 '-3 ' direction moves and is hydrolyzed intermediary and connect the sequence mediates region of primer, and the probes complementary region that intermediary connects primer is then released, as shown in Figure 2 and Figure 3;

The probes complementary region discharged, based on base pair complementarity principle, with universal fluorescent probe, complementation occurs, under the existence of quenching group, the fluorescence of fluorophor is quenched, as shown in Figure 4;

Quick Taq enzyme connects the probes complementary region of primer, to 5 '-3 by intermediary ' direction moves, hydrolysis quenching group, thus quenching group is away from fluorophor, thus PCR reaction creates fluorescence, as shown in Figure 5, Figure 6.

Therefore, as long as the ARMS primer in multiple mutational site, downstream primer are connected primer with intermediary, 1 group of universal fluorescent probe and general cancellation complementary probe, can be placed in a PCR reaction tubes, namely can detect in sample whether there is point mutation, significantly improve the detection flux of ARMS method.

Embodiment 1

PIK3CA multipoint mutation single tube quick detection kit, principal constituent is as follows:

1) DNA extraction liquid:

50mMNaOH, 10mMTris-HCl(PH8.0), 1%NP-40,6%Chelex, 0.1mMEDTA(PH8.0) composition

2) quick Taq enzyme system:

The dNTPs(25mM of quick Taq, the 0.5ul of 3U)

3) primer:

The downstream primer of PIK3CAARMS primer and correspondence:

Intermediary connects primer:

4) universal fluorescent probe is to as follows:

Universal fluorescent probe:

5’ -TG(dT-FAM)CTGATCTACGTAGTTGCAGTCAGTTACGTTATTTTTTTTTTTTTTT-3’

General quenching probes: 5 ' bHQ-TCAGACA-3 '.

Use PIK3CA multipoint mutation single tube quick detection kit, operation steps is as follows:

1) DNA extraction:

Get the FFPE tissue slice of 2 10 μm, put into after scraping down in 1.5ml centrifuge tube, then add the DNA extraction liquid of 120 μ l, 100 DEG C boil 10 minutes after, by centrifugal for centrifuge tube 12000rpm 5 minutes, the supernatant getting 10 μ l joined in PCR reaction tubes;

2) fast PCR:

In 50 μ l fluorescent PCR systems, the quick Taq enzyme of 3U, the UNG enzyme of 10mMTris-HCL, 50mMKCL, 0.5U, 0.2mMdNTPS(U), 3mMMgCl2.Universal fluorescent probe and each 1 μm of general cancellation complementary probe, the ARMS primer in 5 mutational sites, downstream primer are connected each 1 μm of primer with intermediary.After 95 degree of 5min, 95 DEG C 5 seconds, 58 DEG C 31 seconds, cycle number is 40 circulations;

3) monitor the change in fluorescence of reaction system, as there is point mutation, then fluorescent signal can increase.

SEQUENCELISTING

<110> Guangzhou two kinds of substance synthesis into another Technology Co., Ltd.

<120>PIK3CA gene multipoint mutation single tube method for quick and test kit

<130>

<160>10

<170>PatentInversion3.5

<210>1

<211>23

<212>DNA

<213> primer sequence

<400>1

atgaaacaaatgaatgatgcacg23

<210>2

<211>24

<212>DNA

<213> primer sequence

<400>2

catgaaacaaatgaatgatgcact24

<210>3

<211>22

<212>DNA

<213> primer sequence

<400>3

tctacacgagatcctctctcta22

<210>4

<211>23

<212>DNA

<213> primer sequence

<400>4

agatcctctctctgaaatcactt23

<210>5

<211>23

<212>DNA

<213> primer sequence

<400>5

agatcctctctctgaaatcacta23

<210>6

<211>21

<212>DNA

<213> primer sequence

<400>6

caattcctatgcaatcggtct21

<210>7

<211>21

<212>DNA

<213> primer sequence

<400>7

gctgagatcagccaaattcag21

<210>8

<211>36

<212>DNA

<213> primer sequence

<400>8

taacgtaactgactgcaacttgttgtccagccacca36

<210>9

<211>38

<212>DNA

<213> primer sequence

<400>9

taacgtaactgactgcaacttagaaaatctttctcctg38

<210>10

<211>48

<212>DNA

<213> universal fluorescent probe

<400>10

tgctgatctacgtagttgcagtcagttacgttattttttttttttttt48

Claims

1. multipoint mutation single tube method for quick, comprises the steps:

The downstream primer, the intermediary that design ARMS primer and the correspondence of suddenling change for difference connect primer and universal fluorescent probe, wherein, intermediary connects primer by the universal sequence part with universal fluorescent probe portion complementary with form with the specific part of the partial sequence complementarity in point mutation downstream;

By the downstream primer of ARMS primer and correspondence, intermediary connects primer and universal fluorescent probe mixes with quick Taq enzyme system, increases;

The change in fluorescence of detection reaction system, determines whether there is point mutation.

2. a PIK3CA multipoint mutation single tube quick detection kit, comprise DNA extraction liquid, quick Taq enzyme system and PIK3CA abrupt climatic change primer, it is characterized in that: described PIK3CA abrupt climatic change primer by downstream primer, the intermediary's connection primer of organizing ARMS primer and correspondence more, and universal fluorescent probe composition, wherein:

Intermediary connects a terminal sequence of primer and treats the partial sequence complementarity in downstream, PIK3CA mutational site, and the other end sequence and universal fluorescent probe portion complementary nucleic acid match.

3. PIK3CA multipoint mutation single tube quick detection kit according to claim 2, is characterized in that: fast Taq enzyme system consist of dNTPS(U), UNG enzyme, fast Taq enzyme.

4. PIK3CA multipoint mutation single tube quick detection kit according to claim 2, is characterized in that: intermediary connects in primer and is no less than 10bp with the nucleic acid quantity of the partial sequence complementarity in downstream, PIK3CA mutational site.

5. PIK3CA multipoint mutation single tube quick detection kit according to claim 4, is characterized in that: it is 15 ~ 30bp that intermediary to connect in primer with the nucleic acid quantity of the partial sequence complementarity in downstream, PIK3CA mutational site.

6. PIK3CA multipoint mutation single tube quick detection kit according to claim 2, is characterized in that: intermediary connects the nucleic acid quantity of matching with universal fluorescent probe portion complementary nucleic acid in primer and is no less than 10bp.

7. PIK3CA multipoint mutation single tube quick detection kit according to claim 6, is characterized in that: it is 15 ~ 45bp that intermediary connects the nucleic acid quantity of matching with universal fluorescent probe portion complementary nucleic acid in primer.

8. the PIK3CA multipoint mutation single tube quick detection kit according to claim 2 ~ 7 any one, is characterized in that: the sequence of ARMS primer is as follows:

Exon Mutant designations ARMS primer sequence (5 ' → 3 ') 20 H1047R ATGAAACAAATGAATGATGCACG 20 H1047L CATGAAACAAATGAATGATGCACT 9 E542K TCTAC ACGAGATCCTCTCTCTA 9 E545D AGATCCTCTCTCTGAAATCACTT 9 E545K AGATCCTCTCTCTGAAATCACTA

。

9. PIK3CA multipoint mutation single tube quick detection kit according to claim 8, is characterized in that:

Universal fluorescent probe:

5-TG(dT-FAM)CTGATCTACGTAGTTGCAGTCAGTTACGTTATTTTTTTTTTTTTTT-3’

General quenching probes: 5 ' BHQ-TCAGACA-3 '.