CN105087386A - Preparation method and application of choiromyces aboriginum and extract thereof - Google Patents
Preparation method and application of choiromyces aboriginum and extract thereof Download PDFInfo
- Publication number
- CN105087386A CN105087386A CN201510128499.9A CN201510128499A CN105087386A CN 105087386 A CN105087386 A CN 105087386A CN 201510128499 A CN201510128499 A CN 201510128499A CN 105087386 A CN105087386 A CN 105087386A
- Authority
- CN
- China
- Prior art keywords
- endogenetic fungus
- reed
- fungus
- extract
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention relates to the field of the microbial technology, and in particular relates to endophytic fungus No51 extracted from a Yinchuan wild reed root system and the induced disease resistance of a hypha alcohol extract of the endophytic fungus No51 under the artificial rearing condition for rice blast. The strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the systematic name of the endophytic fungus is Fusarium sp. Through the application of relevant products, strong induced disease resistance is generated for the rice blast, and thus the choiromyces aboriginum can be taken as a novel disease-resistant inducer for rice.
Description
Technical field
The invention belongs to microbial technology field, relate generally to a kind of from the wild reed root system in Yinchuan, be separated a strain endogenetic fungus No51 and the alcohol extract thereof obtained preparation method and purposes, relate generally to the preparation method of its alcohol extract and the induced resistance effect to rice blast thereof.
Background technology
As the rice blast of one of Main Rice Diseases, the popular time causes Severe Reduction of Rice.The prophylactico-therapeutic measures of current rice blast mainly comprises disease-resistant variety seed selection, chemical control and cultivation management.When disease burst or oneself through formed time, quick-acting chemical preventions remains effectively preventing means the most.But agricultural chemicals is big for environment pollution, costly, life-time service can cause Pyricularia oryzae to develop immunity to drugs.Therefore, method that is new, effectively preventing rice blast is sought or approach has unusual meaning.In recent years, along with developing rapidly of On Induced Disease Resistance In Plants, achieve significant effect with its control rice blast, the research of rice blast inductor is also increased thereupon and goed deep into.Resistance inductor, by activating the potential defense mechanism of paddy rice, induces the expression of potential resistant gene, reaches the object of defence rice blast with this.Resistance inductor will become a kind of important form of control rice blast.
Summary of the invention
The present invention is directed to above-mentioned problems of the prior art, take rice Pyricularia grisea as target, and from the wild reed root system in Yinchuan, be separated the strain endogenetic fungus No51 obtained, its alcohol extract has inducing anti-disease effect to rice blast.And endogenetic fungus No51 has been carried out to the systematic study of Species estimation and alcohol extract inducing anti-disease effect, be intended to for the Study and Development of novel microorganism source pesticide provides excellent starting strain.
The present invention is achieved by the following technical solutions:
From the wild reed root system in Yinchuan, separation and purification obtains endogenetic fungus No51, this endogenetic fungus specific name is: Fusarium (Fusariumsp.), its deposit number is CGMCCNO.10118, preservation date is 2014.12.11, depositary institution's title: China Committee for Culture Collection of Microorganisms's common micro-organisms center; Depositary institution address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City.
Utilize CTAB method to extract endogenetic fungus genomic dna, utilize universal primer ITS4 and ITS5 to carry out pcr amplification and the order-checking of gene; Described endogenetic fungus primer I TS4 and ITS5 DNA amplification sequence as follows:
CCCTCGGGCATTCCGACCTGATTCGAGGTCACTTCAGAAGAGTTGGGTGTTTTACGGCGTGGCCGCGCCGCTCTCCAGTCGCGAGGTGTTAGCTACTACGCGATGGAAGCTGCGGCGGGACCGCCACTGTATTTGGGGGACGGCGTGTGCCCACGGGGGGCTCCGCCGATCCCCAACGCCAGGCCCGGGGGCCTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTGTTTTACTCAGAAGAAACATTATAGAAACAGAGTTAGGGGTCCTCTGGCGGGGGCGGCCCGTTTCACGGGGCCGTCTGTTCCCGCCGAAGCAACGTTTAGGTATGTTCACAGGGTTGATGAGTTGAATAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGATTTTTACTTACA。
The preparation method of described reed endogenetic fungus extract comprises the steps: that separation and purification obtains endogenetic fungus No51 from the wild reed root system in Yinchuan, after being cultivated by this endogenetic fungus, proceeds in liquid PDA substratum on solid PDA medium; Cultivate 6d to take out, add the 20wt% ethanol with mycelium equimultiple volume, lixiviate 24h after extracting mycelium, filter, filtrate is preserved, and namely obtains endogenous fungus metabolite and prepares liquid.
Described liquid PDA culture medium culturing is, by the endogenetic fungus strain inoculation of activation in the little triangular flask that 10mLPDA substratum is housed, is placed in 28 DEG C, 200rmin
-1shaking table cultivate.
The alcohol extract of described endogenetic fungus has very high activity, after trace uses, has stronger inducing anti-disease effect to the rice blast of paddy rice.
The advantage that the present invention has and positively effect are:
1. the alcohol extract of endogenetic fungus No51 has feature that is efficient, nontoxic, wide spectrum as novel paddy disease-resistant inductor, farthest can reduce the use of agricultural chemicals, alleviate the environmental pollution of agricultural chemicals.
2. the alcohol extract of endogenetic fungus No51 is a kind of tunning with the endophyte of plant of super-active as Novel rice Plant elicitors, uses trace can reach inducing anti-disease effect.
Embodiment
From the wild reed root system in Yinchuan, separation and purification obtains endogenetic fungus No51, this endogenetic fungus specific name is: Fusarium (Fusariumsp.), its deposit number is CGMCCNO.10118, preservation date is 2014.12.11, depositary institution's title: China Committee for Culture Collection of Microorganisms's common micro-organisms center; Depositary institution address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City.
Utilize CTAB method to extract endogenetic fungus genomic dna, utilize universal primer ITS4 and ITS5 to carry out pcr amplification and the order-checking of gene; Described endogenetic fungus primer I TS4 and ITS5 DNA amplification sequence as follows:
CCCTCGGGCATTCCGACCTGATTCGAGGTCACTTCAGAAGAGTTGGGTGTTTTACGGCGTGGCCGCGCCGCTCTCCAGTCGCGAGGTGTTAGCTACTACGCGATGGAAGCTGCGGCGGGACCGCCACTGTATTTGGGGGACGGCGTGTGCCCACGGGGGGCTCCGCCGATCCCCAACGCCAGGCCCGGGGGCCTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTGTTTTACTCAGAAGAAACATTATAGAAACAGAGTTAGGGGTCCTCTGGCGGGGGCGGCCCGTTTCACGGGGCCGTCTGTTCCCGCCGAAGCAACGTTTAGGTATGTTCACAGGGTTGATGAGTTGAATAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGATTTTTACTTACA。
Embodiment 1
1. the preparation of endogenous fungus metabolite
By the endogenetic fungus strain inoculation of activation in the little triangular flask that 10mLPDA substratum is housed, be placed in 28 DEG C, the shaking table of 200rmin-1 cultivates 6d and take out, the 20wt% ethanol with mycelium equimultiple volume is added after extracting mycelium, lixiviate 24h, filter, filtrate is preserved, and namely obtains endogenous fungus metabolite and prepares liquid.
Prepared by magnaporthe grisea spore suspension
(1) germ preparation is cultivated: being transplanted respectively by Pyricularia oryzae on rolled oats tomato juice agar, connecing some for growing can move rapidly more; 5 ~ 7d is cultivated under 25 ~ 27 DEG C of conditions, for subsequent use.
(2) mycelium culture: wash lower mycelia and conidium gently with sterilized water, make bacteria suspension, be applied to by uniform suspension on another new plate culture medium, every ware is about 0.5mL, dries up in Bechtop; Be placed in 25 DEG C of incubators and cultivate about 35 ~ 40h, grow the sparse aerial mycelium of one deck to media surface.
(3) produce spore to cultivate: on bacterium colony, add 500ul sterilized water, the aerial hyphae on surface is wiped gently with cotton swab, and with water, the mycelia of media surface and conidium are cleaned up, treat that media surface dries 2 layers of gauze on back cover, tie up with rubber band, under 25 DEG C of illumination conditions, be cultured to a large amount of conidium produce (about 2 ~ 3d).
(4) collecting cells: wash lower conidium from substratum with clear water, filters, abandons supernatant, and the conidium under precipitation suspends with the Tween20 aqueous solution of volume fraction 0.2%, and blood counting chamber counts, and spore suspension concentration is adjusted to 2 × 10
5individual spore/ml (under 15 × 10 mirrors about 20 ~ 30 spores), for inoculation application.
2. magnaporthe grisea spore inoculation
Paddy rice is potted plant, when paddy rice grows to 3 leaf 1 heart, the endophyte meta-bolites of final concentration 50ng/mL is prepared liquid, sprays in rice leaf surface.Within 3 days, inoculate magnaporthe grisea spore suspension afterwards.Observe rice leaf rice blast incidence.Coincident with severity degree of condition is evaluated by unified standard, in table 1.Incidence disease index and inducing effect represent.
4. the sequential analysis of endogenetic fungus
Utilize CTAB method to extract endogenetic fungus genomic dna, utilize universal primer ITS4 and ITS5 to carry out pcr amplification and the order-checking of gene.Reaction system is 50 μ L.Reaction conditions is 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, and 72 DEG C extend 1min, totally 30 circulations, and 72 DEG C extend 5min.PCR primer is carried out purifying and is checked order.Based on blast search, choose and compare with for trying to study the strain sequence that the immediate kind of strain sequence or hithermost evolutionary branching represent sibship nearer, utilize DNAStar software building evolutionary tree.
Embodiment 2
1, the preparation of endogenous fungus metabolite
By the endogenetic fungus strain inoculation of activation in the little triangular flask that 10mLPDA substratum is housed, be placed in 28 DEG C, the shaking table of 200rmin-1 cultivates 6d and take out, the 20wt% ethanol with mycelium equimultiple volume is added after extracting mycelium, lixiviate 24h, filter, filtrate is preserved, and namely obtains endogenous fungus metabolite and prepares liquid.
2, Pyricularia oryzae is cultivated
Pyricularia oryzae being transplanted respectively on PDA solid medium, connecing some for growing can move rapidly more; 5 ~ 7d is cultivated under 25 ~ 27 DEG C of conditions, for subsequent use.
3. Pyricularia oryzae inoculation
Paddy rice is potted plant, when paddy rice grows to 3 leaf 1 heart, the endophyte meta-bolites of final concentration 50ng/mL is prepared liquid, sprays in rice leaf surface.
After 48h, which floor thieving paper is cut into the disk of suitable size at the bottom of culture dish, is laid in plastic culture dish, adds water-soaked.Get the leaf section of the 5th leaf central part about the 5cm launched not yet completely, be placed in the culture dish of moisturizing, every ware puts 4 leaf sections, is then placed on blade by Pyricularia oryzae, pricks an aperture gently with syringe needle.
Culture dish moisturizing about 30h under 28 DEG C of complete darkness, 100% relative humidities of inoculation leaf section.Then cultivate under 28 DEG C of full exposure conditions, observe the anti-sense response type of scab at any time.
Coincident with severity degree of condition is undertaken evaluating (see table 2) by unified standard.Incidence disease index and inducing effect represent.
4. the sequential analysis of endogenetic fungus
Utilize CTAB method to extract endogenetic fungus genomic dna, utilize universal primer ITS4 and ITS5 to carry out pcr amplification and the order-checking of gene.Reaction system is 50 μ L.Reaction conditions is 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, and 72 DEG C extend 1min, totally 30 circulations, and 72 DEG C extend 5min.PCR primer is carried out purifying and is checked order.Based on blast search, choose and compare with for trying to study the strain sequence that the immediate kind of strain sequence or hithermost evolutionary branching represent sibship nearer, utilize DNAStar software building evolutionary tree.
Table 1 rice blast is in a bad way situation evaluation criteria
Table 2 rice blast is in a bad way situation evaluation criteria
Claims (5)
1. reed endogenetic fungus, it is characterized in that this endogenetic fungus specific name is: Fusarium (Fusariumsp.), its deposit number is CGMCCNO.10118, preservation date is 2014.12.11, depositary institution's title: China Committee for Culture Collection of Microorganisms's common micro-organisms center; Depositary institution address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City.
2. reed endogenetic fungus according to claim 1, it is characterized in that described endogenetic fungus primer I TS4 and ITS5 DNA amplification sequence as follows:
CCCTCGGGCATTCCGACCTGATTCGAGGTCACTTCAGAAGAGTTGGGTGTTTTACGGCGTGGCCGCGCCGCTCTCCAGTCGCGAGGTGTTAGCTACTACGCGATGGAAGCTGCGGCGGGACCGCCACTGTATTTGGGGGACGGCGTGTGCCCACGGGGGGCTCCGCCGATCCCCAACGCCAGGCCCGGGGGCCTGAGGGTTGTAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTAATTTATTTGCTTGTTTTACTCAGAAGAAACATTATAGAAACAGAGTTAGGGGTCCTCTGGCGGGGGCGGCCCGTTTCACGGGGCCGTCTGTTCCCGCCGAAGCAACGTTTAGGTATGTTCACAGGGTTGATGAGTTGAATAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGATTTTTACTTACA。
3. the preparation method of reed endogenetic fungus extract according to claim 1, it is characterized in that comprising the steps: that separation and purification obtains endogenetic fungus No51 from the wild reed root system in Yinchuan, after this endogenetic fungus solid PDA medium is cultivated, proceed in liquid PDA substratum; Cultivate 6d to take out, add the 20wt% ethanol with mycelium equimultiple volume, lixiviate 24h after extracting mycelium, filter, filtrate is preserved, and namely obtains endogenous fungus metabolite and prepares liquid.
4. the preparation method of reed endogenetic fungus extract according to claim 3, is characterized in that described liquid PDA culture medium culturing is, by the endogenetic fungus strain inoculation of activation in the little triangular flask that 10mLPDA substratum is housed, is placed in 28 DEG C, 200rmin
-1shaking table cultivate.
5. the application of extract in paddy disease-resistant inductor of reed endogenetic fungus according to claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510128499.9A CN105087386A (en) | 2015-03-23 | 2015-03-23 | Preparation method and application of choiromyces aboriginum and extract thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510128499.9A CN105087386A (en) | 2015-03-23 | 2015-03-23 | Preparation method and application of choiromyces aboriginum and extract thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105087386A true CN105087386A (en) | 2015-11-25 |
Family
ID=54568724
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510128499.9A Pending CN105087386A (en) | 2015-03-23 | 2015-03-23 | Preparation method and application of choiromyces aboriginum and extract thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105087386A (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102086439A (en) * | 2010-11-18 | 2011-06-08 | 辽宁省农业科学院 | Method for preparing ginseng fungus and ginseng fungus extract and application of ginseng fungus extract |
-
2015
- 2015-03-23 CN CN201510128499.9A patent/CN105087386A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102086439A (en) * | 2010-11-18 | 2011-06-08 | 辽宁省农业科学院 | Method for preparing ginseng fungus and ginseng fungus extract and application of ginseng fungus extract |
Non-Patent Citations (2)
Title |
---|
陈珣等: "内生真菌N0051的鉴定及其代谢产物对稻瘟病的诱导抗病研究", 《广东农业科学》 * |
马晓颖等: "1株Alternariasp.真菌菌丝提取物", 《微生物学杂志》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104745483B (en) | A kind of Paecilonyces variotii strain SJ1 and its application | |
CN106135285A (en) | The application in prevention and control rice blast of the Rhodopseudomonas palustris biocontrol agent | |
CN103160442A (en) | Paecilomyceslilacinus strain having strong pathogenicity for diaphorina citri | |
CN102586120B (en) | Endophytic fungi CEF08111 of cotton and application thereof in prevention and treatment of cotton verticillium wilt | |
CN111793566B (en) | China fir endophytic fungi and biological control application thereof | |
CN107287130A (en) | A kind of Streptomycesalbidoflhaving bacterial strain and its application in agricultural chemicals | |
CN105368720A (en) | Cotton fungal endophyte CEF-082 and application of cotton fungal endophyte CEF-082 in prevention and treatment of cotton verticillium wilt | |
CN105441331B (en) | One plant of myrothecium roidium and its application | |
CN103103152A (en) | Corallococcus coralloides and application thereof | |
CN105838642A (en) | Actinomycetes for preventing and treating peanut diseases and application of actinomycetes | |
CN105779360A (en) | Bacillus subtilis and application thereof | |
CN104651319A (en) | Fusarium graminearum low-toxicity virus FgHV2/JS16 and application thereof | |
CN103642704B (en) | Cotton endogenetic fungus CEF-714 and the application in cotton verticillium wilt control thereof | |
CN106085899B (en) | Microbial inoculum and the application of one plant of process for preparation of benzoylurea compounds degradation bacteria and its production | |
CN110669675A (en) | Metarhizium anisopliae MANGS71814 and application thereof in control of potato tuber moth | |
CN111808888B (en) | Chinese fir endophytic fungi fermentation filtrate and extract thereof, and preparation method and application of Chinese fir endophytic fungi fermentation filtrate and extract | |
CN108559718A (en) | The myxococcus stipitatus of one plant of predacious plant pathogenetic bacteria and its application in bacterial disease biological control | |
CN110317735B (en) | Biocontrol pythium oligandrum and application thereof | |
CN109735457B (en) | Mutant eurotium cristatum and application thereof in preventing and controlling barnyard grass | |
CN117106639A (en) | Streptomyces nojirimensis strain and application of fermentation liquor thereof in preventing and controlling pepper anthracnose | |
CN102634461B (en) | Verticillium dahliae 171 (Vd171) for preventing and treating cotton verticillium wilt and application of Vd171 | |
Choi et al. | Sooty mould disease caused by Leptoxyphium kurandae on kenaf | |
CN114703069B (en) | Epicoccus nigrum fermentation product, preparation method and application thereof | |
CN103667083B (en) | A kind of mould, its cultural method of top spore and the application in preparation original spore powder of meloidogyne pesticide thereof | |
CN102382776B (en) | Small spore phoma microspora for controlling conyza sumatrensis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151125 |
|
RJ01 | Rejection of invention patent application after publication |