CN105039558A - Cattle HIF-1A gene transcriptional level fluorescent quantization PCR detection kit - Google Patents
Cattle HIF-1A gene transcriptional level fluorescent quantization PCR detection kit Download PDFInfo
- Publication number
- CN105039558A CN105039558A CN201510489280.1A CN201510489280A CN105039558A CN 105039558 A CN105039558 A CN 105039558A CN 201510489280 A CN201510489280 A CN 201510489280A CN 105039558 A CN105039558 A CN 105039558A
- Authority
- CN
- China
- Prior art keywords
- hif
- primer
- gene
- detecting
- fluorescent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a cattle HIF-1A gene transcriptional level fluorescent quantization PCR detection kit, and provides a specific detection method. The kit comprises the following reagents: 2*SYBR GREEN MIX, a standard HIF-1A genetic template, ultrapure water and a primer pair consisting of a primer I and a primer II, wherein the primer I is shown as the sequence 1 in a sequence list, and the primer II is shown as a sequence 2 in a sequence list. The cattle HIF-1A gene transcriptional level fluorescent quantization PCR detection kit has the beneficial effects that the kit can effectively detect an mRNA expression state and an expression quantity of HIF-1A genes of different cattle species, different tissues and different periods and can identify correlation of the gene to the low-oxygen adaptability of animals, thereby meeting the detection requirements of life science, animal medicine and animal science researchers. Compared with the prior art, the kit has the following advantages: 1, a purpose of conveniently and rapidly detecting a transcriptional level of the HIF-1A genes is realized; 2, advantages of high sensitivity, good stability and low experimental cost in the aspect of detecting the transcriptional level of genes can be realized.
Description
Technical field
The present invention relates to biological technical field, be specifically related to ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kit.
Background technology
Polymerase chain reaction (PolymeraseChainReaction, PCR) is technology the most frequently used in DNA manipulation in vitro technology.Template DNA, special primer, dNTPs substrate, hot resistant DNA polymerase, magnesium ion etc. are placed in same buffering reaction system by round pcr, carry out repeatedly high-temperature denatured, low-temperature annealing, middle temperature chain extension thermal cycling, realize target dna fragment in reaction solution in 2
ndoubly amplification (wherein n is times of thermal cycle).
Fluorescent quantitative PCR technique is on the basis of common PCR reaction, in conjunction with the gene quantifying method that real-time fluorescence detection technique and Computer Analysis technology grow up.Quantitative fluorescent PCR adds specific fluorescent mark material in common PCR reaction system, the quantitative change situation of real time monitoring of DNA is carried out by the changing conditions of the fluorescent value in PCR reaction system after detecting each thermal cycling, and obtain the fluorescent quantitation change curve of each sample, and then obtain the Ct value (change in fluorescence reaches cycle number during threshold value) of each reaction tubes; Simultaneously, the target DNA of the dose known amounts of 2-10 multiple dilutions is detected under identical reaction system and reaction conditions, obtain its Ct value, with the logarithm of starting template number for X-coordinate, with Ct value for ordinate zou preparation standard curve, the initiate dna template number of Ct value to each reaction of typical curve and each sample carries out quantitative assay accordingly.
SYBRGreen is a kind of combination dye be incorporated in double-stranded DNA ditch, and after being combined with double-stranded DNA, its fluorescence strengthens greatly, and the detection that this character makes it be applied to amplified production is ideal.The maximum absorption wavelength of SYBRGreen is about 497nm, and emission wavelength is maximum is about 520nm.In PCR reaction system, add excessive SYBR fluorescence dye, after SYBR fluorescence dye mixes DNA double chain specifically, emitting fluorescence signal, and the SYBR dye molecule do not mixed in chain can not launch any fluorescent signal, thus ensure the increase of fluorescent signal and the increase Complete Synchronization of PCR primer.
The transcriptional level of Northernblot technology detectable gene, but whole experimentation operation more complicated.In Northernblot experiment, a main problem is that RNA easily degrades, so experimental articles all in NorthernBlot all needs the process through removing RNA enzyme, as high bake, DEPC process etc., this makes experimentation become more loaded down with trivial details.In addition, in NorthernBlot, a lot of experimental article such as formaldehyde, EB, DEPC, ultraviolet lamp etc. have certain injury to human body.
Although biochip technology experiment reduces the workload of experimenter, and in once testing, can detect several thousand gene expression amounts changes, its sensitivity is lower simultaneously.
SYBRGreen has many good qualities in the real-time context of detection of nucleic acid, and because it combines with all double-stranded DNAs, need not customize especially because template is different, the program versatility therefore designed is good, and price is relatively low.In addition, because a PCR primer can be combined with polymolecular dyestuff, therefore the sensitivity of SRYBGreen is very high.But because SYRBGreen combines with all double-stranded DNAs, the false positive therefore caused by the amplified production of primer dimer, strand secondary structure and mistake can affect quantitative accuracy.Can help to reduce non-specific product to the impact of quantitative result by the change of fluorescent value after measurement raised temperature.The homogeneity being carried out assay products by melting curve contributes to analyzing the quantitative result obtained by SYBRGreen.
HIF-1 is prevalent in people and mammiferous cell also referred to as hypoxia inducible factor-1 (HypoxiaInducibleFactor-1, HIF-1), though have expression under normal oxygen, and under anoxic conditions just can stably express.HIF-1 is a kind of heterodimeric body protein, is made up of α and β subunit, i.e. HIF-1 A(HypoxiaInducibleFactor-1A, HIF-1A) and HIF-1 B(HypoxiaInducibleFactor-1B, HIF-1B).HIF-1B subunit stably express in cytoplasm, and namely HIF-1A subunit is degraded by uiquitin-protease enzymic hydrolysis complex body upon translation.Substantially can't detect the expression of subunit in cell under normal oxygen saturation, and under anoxic condition, the degraded of HIF-1A subunit is suppressed, α and β subunit forms activated HIF-1, transfers in nucleus and regulates transcribing of several genes.Therefore, qualification animal is contributed to the adaptive faculty of low-oxygen environment to the transcriptional level detection of HIF-1A gene.
Summary of the invention
Object of the present invention is exactly for above-mentioned defect of the prior art, provide a kind of easy and simple to handle, quick, and can detection by quantitative different ox kind (comprising milk cow, ox and yak) HIF-1 A(HypoxiaInducibleFactor-1, HIF-1A) fluorescent quantificationally PCR detecting kit of gene transcription level.
To achieve these goals, technical scheme provided by the invention is: for detecting the primer pair of ox HIF-1A gene transcription level, be made up of primer one and primer two, described primer is just like shown in sequence in sequence table 1, and described primer two is as shown in sequence in sequence table 2.
Second object of the present invention there is provided the test kit for detecting ox HIF-1A gene transcription level, includes following reagent: 2 × SYBRGREENMIX, standard HIF-1A gene template, above-mentioned primer pair and ultrapure water.
Further, the above-mentioned test kit for detecting ox HIF-1A gene transcription level, in described test kit, the proportioning of 2 × SYBRGREENMIX, standard HIF-1A gene template, above-mentioned primer pair and ultrapure water is 5mL:500 μ L:500 μ L:5mL.
Further, the above-mentioned test kit for detecting ox HIF-1A gene transcription level, described 2 × SYBRGREENMIX is made up of following reagent: Taq DNA polymerase 0.1U/ μ L, dNTPs substrate 0.4mmol/L, Mg
2+5.0mmol/L, KCl100mmol/L, Tris.HCl20mmol/L, gelatin 0.02%, SYBRGreen dyestuff.
Further, the above-mentioned test kit for detecting ox HIF-1A gene transcription level, described standard HIF-1A gene template is as shown in sequence in sequence table 3, and the concentration of standard HIF-1A gene template is 0.8 μm of ol/L.
Further, the above-mentioned test kit for detecting ox HIF-1A gene transcription level, in the primer mixed solution of above-mentioned primer pair composition, the concentration of primer one is 8 μm of ol/L, and the concentration of primer two is 8 μm of ol/L.
Further, the above-mentioned test kit for detecting ox HIF-1A gene transcription level, the purity of described ultrapure water is greater than 18.25M Ω .cm.
3rd object of the present invention there is provided the fluorescent quantitative PCR detection method for detecting ox HIF-1A gene transcription level, comprises the following steps:
1) prepare quantitative fluorescent PCR reaction premixed liquid: get 2 × SYBRGREENMIX1000 μ L, above-mentioned primer pair composition primer mixed solution 100 μ L, ultrapure water 800 μ L fully mix, preparation obtain 1900 μ L quantitative fluorescent PCR reaction premixed liquid;
2) quantitative fluorescent PCR reaction premixed liquid step 1) obtained is distributed into 100 tubules by 19 μ L/ pipes, adds in the special PCR reaction tubes of fluorescent quantitation or Sptting plate;
3) the standard HIF-1A gene template of 10E-1,10E-2,10E-3,10E-4,10E-5 dilution series is prepared, and undiluted standard HIF-1A gene template, totally 6 kinds, often kind of 10 μ L, for detecting the amplification efficiency of gene;
4) quantitative fluorescent PCR reaction amplification: each being equipped with in the 19 μ L quantitative fluorescent PCRs reaction reaction tubess of premixed liquids or Sptting plate adds 1 μ L cDNA to be measured, respectively as the ultrapure water of negative control or as positive control and the HIF-1A gene template calculating amplification efficiency standard, concussion mixing, after brief centrifugation, upper machine is in quantitative real time PCR Instrument, sex change 30 seconds at 95 DEG C, then by 95 DEG C 5 seconds, 55.2 DEG C of thermal cyclings in 20 seconds 40 times, and 55.2 DEG C time detection record fluorescent signal;
5), after PCR reaction terminates, the Ct value of each reaction is read in order to quantitative analysis; Carry out PCR primer electrophoresis in 3% sepharose, ethidium bromide staining simultaneously, observe under gel imaging system, the result of each PCR reaction of gray scale scanning analytic record.
Further, the above-mentioned fluorescent quantitative PCR detection method for detecting ox HIF-1A gene transcription level, in described step 4), be equipped with in 100 tubules of 19 μ L quantitative fluorescent PCR reaction premixed liquids, wherein 1 pipe adds and adds as positive control and the HIF-1A gene template calculating amplification efficiency standard as the ultrapure water of negative control, 6 pipes, and all the other tubules add cDNA to be measured.
Beneficial effect of the present invention is: ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kit provided by the invention, effectively can detect different ox kind (comprising milk cow, ox and yak), the mrna expression state of HIF-1A gene of different tissues, different times and expression amount, the dependency of this gene and animal Hypoxia adaptation ability can be identified, to meet the detection needs of life science, animal medicine and animal science investigator simultaneously.Compared with prior art, the invention has the advantages that: 1, present invention achieves the object conveniently detecting HIF-1A gene transcription level; 2, the present invention has highly sensitive, that good stability, experimental cost are low advantage in detection gene transcription level.
Accompanying drawing explanation
Fig. 1 is the amplification curve of HIF-1A gene transcription level fluoroscopic examination result.
Wherein, X-coordinate is PCR cycle index, and ordinate zou is relative fluorescence value (RelativeFluorescenceUnits, RFU), and amplification curve result shows HIF-1A gene by fluorescence signal value standard compliant " S " type curve.
Fig. 2 is the melting curve of HIF-1A gene transcription level fluoroscopic examination result.
Wherein, X-coordinate is temperature, and ordinate zou is the variable quantity of relative fluorescence at unit temperature, and melting curve shows that this fluorescent quantitation has the detection specificity of height.
Embodiment
embodiment 1:
Ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kit:
This test kit is primarily of 2 × SYBRGREENMIX, standard HIF-1A gene template, primer mixed solution and ultrapure water composition, and in test kit, the composition of each composition is as shown in table 1:
Table 1
In test kit, each moiety is as follows:
2 × SYBRGreenMIX:TaqDNA polysaccharase 0.1U/ μ L, dNTPs substrate 0.4mmol/L, Mg
2+5.0mmol/L, 100mmol/LKCl, 20mmol/LTris.HCl, 0.02% gelatin and SYBRGreen dyestuff.
Primer mixed solution: primer A8 μm ol/L, primer B8 μm ol/L, primer 1 sequence is 5 '-CAGAATGAAGTGTACCCTAA-3 ', and primer 2 sequence is 5 '-TCATCGGTGGTTTCTTAT-3 '.
Standard HIF-1A gene template: concentration is 0.8 μm of ol/L, HIF-1A gene template sequence is 5 '-CAGAATGAAGTGTACCCTAACTAGCCGGGGGAGAACTATGAACATAAAATCTGCAA CATGGAAAGTACTTCACTGCACAGGCCATATTCATGTATACGATACCAACAGTAAC CAATCTCAGTGTGGGTATAAGAAACCACCGATGA-3 '.
Ultrapure water: purity is more than 18.25M Ω .CM.
Mix appropriate 2 × SYBRGREENMIX, standard HIF-1A gene template/cDNA template, primer mixed solution and ultrapure water, thermal cycler carries out the thermal cycling repeatedly of high temperature, low temperature, middle temperature; And detect when middle temperature and record fluorescent value.This HIF-1A quantitative fluorescent PCR, due to primer complete homology in milk cow, ox, yak, derives from the HIF-1A gene of these species so can effectively increase, thus detects the transcriptional level of HIF-1A gene.
For detecting the fluorescent quantitative PCR detection method of ox HIF-1A gene transcription level, comprise the following steps:
1) prepare HIF-1A fluorescence quantitative PCR reaction solution in proportion, 20 μ L reaction systems are as shown in table 2.
Table 2
Negative control and positive control should be provided with in a quantitative reaction simultaneously;
2) get 2 × SYBRGREENMIX1000 μ L, primer mixed solution 100 μ L, ultrapure water 800 μ L fully mixes, the FQ-PCR preparing 1900 μ L reacts premixed liquid;
3) fully mix above various liquid, premixed liquid is become to be distributed into 100 tubules by 19 μ L/ pipes, adds in the special PCR reaction tubes of fluorescent quantitation or Sptting plate;
4) preparation is with the standard HIF-1A gene template of 10E-1,10E-2,10E-3,10E-4,10E-5 dilution series, adds undiluted standard HIF-1A gene template, totally 6 pipes, often pipe 10 μ L;
5) each being equipped with in the reaction tubes of 19 μ LPCR reaction premixed liquids of FQ-PCR amplification adds 1 μ L cDNA to be measured, water or standard HIF-1A gene template respectively, concussion mixing, after brief centrifugation, upper machine is in quantitative real time PCR Instrument (Bio-RadCFX96TM), sex change 30 seconds at 95 DEG C, then by 95 DEG C 5 seconds, 55.2 DEG C of thermal cyclings in 20 seconds 40 times, and 55.2 DEG C time detection record fluorescent signal;
6), after PCR reaction terminates, the Ct value of each reaction is read in order to quantitative analysis; Simultaneously in 3% sepharose performing PCR product electrophoresis, ethidium bromide staining, observes under gel imaging system, the result of each PCR reaction of gray scale scanning analytic record.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Sequence table
<110> Lanzhou Livestock and Animal Drug Inst., Chinese Academy of Agricultural Science
<120> ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kit
<210>1
<211>20
<212>DNA
<213> artificial sequence
<400>1
cagaatgaagtgtaccctaa20
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>2
tcatcggtggtttcttat18
<210>1
<211>146
<212>DNA
<213> ox standard HIF-1A gene template
<400>3
cagaatgaagtgtaccctaactagccgggggagaactatgaacataaaatctgcaacatg60
gaaagtacttcactgcacaggccatattcatgtatacgataccaacagtaaccaatctca120
gtgtgggtataagaaaccaccgatga146
Sequence table
<110> Lanzhou Livestock and Animal Drug Inst., Chinese Academy of Agricultural Science
<120> ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kit
<210>1
<211>20
<212>DNA
<213> artificial sequence
<400>1
cagaatgaagtgtaccctaa20
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>2
tcatcggtggtttcttat18
<210>1
<211>146
<212>DNA
<213> ox standard HIF-1A gene template
<400>3
cagaatgaagtgtaccctaactagccgggggagaactatgaacataaaatctgcaacatg60
gaaagtacttcactgcacaggccatattcatgtatacgataccaacagtaaccaatctca120
gtgtgggtataagaaaccaccgatga146
Claims (9)
1. for detecting the primer pair of ox HIF-1A gene transcription level, it is characterized in that, being made up of primer one and primer two, described primer is just like shown in sequence in sequence table 1, and described primer two is as shown in sequence in sequence table 2.
2. for detecting the test kit of ox HIF-1A gene transcription level, it is characterized in that, including following reagent: 2 × SYBRGREENMIX, standard HIF-1A gene template, primer pair according to claim 1 and ultrapure water.
3. the test kit for detecting ox HIF-1A gene transcription level according to claim 2, it is characterized in that, in described test kit, the proportioning of 2 × SYBRGREENMIX, standard HIF-1A gene template, primer pair according to claim 1 and ultrapure water is 5mL:500 μ L:500 μ L:5mL.
4. the test kit for detecting ox HIF-1A gene transcription level according to claim 3, is characterized in that, described 2 × SYBRGREENMIX is made up of following reagent: Taq DNA polymerase 0.1U/ μ L, dNTPs substrate 0.4mmol/L, Mg
2+5.0mmol/L, KCl100mmol/L, Tris.HCl20mmol/L, gelatin 0.02%, SYBRGreen dyestuff.
5. the test kit for detecting ox HIF-1A gene transcription level according to claim 4, is characterized in that, described standard HIF-1A gene template is as shown in sequence in sequence table 3, and the concentration of standard HIF-1A gene template is 0.8 μm of ol/L.
6. the test kit for detecting ox HIF-1A gene transcription level according to claim 5, is characterized in that, in the primer mixed solution of primer pair composition according to claim 1, the concentration of primer one is 8 μm of ol/L, and the concentration of primer two is 8 μm of ol/L.
7. the test kit for detecting ox HIF-1A gene transcription level according to claim 6, is characterized in that, the purity of described ultrapure water is greater than 18.25M Ω .cm.
8. for detecting the fluorescent quantitative PCR detection method of ox HIF-1A gene transcription level, it is characterized in that, comprising the following steps:
1) prepare quantitative fluorescent PCR reaction premixed liquid: the primer mixed solution 100 μ L, the ultrapure water 800 μ L that get the arbitrary described primer pair composition of 2 × SYBRGREENMIX1000 μ L, claim 1-7 fully mix, preparation obtains the quantitative fluorescent PCR reaction premixed liquid of 1900 μ L;
2) quantitative fluorescent PCR reaction premixed liquid step 1) obtained is distributed into 100 tubules by 19 μ L/ pipes, adds in the special PCR reaction tubes of fluorescent quantitation or Sptting plate;
3) the standard HIF-1A gene template of 10E-1,10E-2,10E-3,10E-4,10E-5 dilution series is prepared, and undiluted standard HIF-1A gene template, totally 6 kinds, often kind of 10 μ L, for detecting the amplification efficiency of gene;
4) quantitative fluorescent PCR reaction amplification: each being equipped with in the 19 μ L quantitative fluorescent PCRs reaction reaction tubess of premixed liquids or Sptting plate adds 1 μ L cDNA to be measured, respectively as the ultrapure water of negative control or as positive control and the HIF-1A gene template calculating amplification efficiency standard, concussion mixing, after brief centrifugation, upper machine is in quantitative real time PCR Instrument, sex change 30 seconds at 95 DEG C, then by 95 DEG C 5 seconds, 55.2 DEG C thermal cycling in 20 seconds 40 times, and 55.2 DEG C time detection record fluorescent signal;
5), after PCR reaction terminates, the Ct value of each reaction is read in order to quantitative analysis; Carry out PCR primer electrophoresis in 3% sepharose, ethidium bromide staining simultaneously, observe under gel imaging system, the result of each PCR reaction of gray scale scanning analytic record.
9. the fluorescent quantitative PCR detection method for detecting ox HIF-1A gene transcription level according to claim 8, it is characterized in that, in described step 4), be equipped with in 100 tubules of 19 μ L quantitative fluorescent PCR reaction premixed liquids, wherein 1 pipe adds and adds as positive control and the HIF-1A gene template calculating amplification efficiency standard as the ultrapure water of negative control, 6 pipes, and all the other tubules add cDNA to be measured.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510489280.1A CN105039558B (en) | 2015-08-11 | 2015-08-11 | Ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kits |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510489280.1A CN105039558B (en) | 2015-08-11 | 2015-08-11 | Ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kits |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039558A true CN105039558A (en) | 2015-11-11 |
| CN105039558B CN105039558B (en) | 2018-06-15 |
Family
ID=54446524
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510489280.1A Expired - Fee Related CN105039558B (en) | 2015-08-11 | 2015-08-11 | Ox HIF-1A gene transcription level fluorescent quantificationally PCR detecting kits |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039558B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070299086A1 (en) * | 2006-06-26 | 2007-12-27 | The Procter & Gamble Company | Prolyl hydroxylase inhibitors and methods of use |
| CN104313124A (en) * | 2014-06-10 | 2015-01-28 | 中国农业科学院兰州畜牧与兽药研究所 | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit |
-
2015
- 2015-08-11 CN CN201510489280.1A patent/CN105039558B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070299086A1 (en) * | 2006-06-26 | 2007-12-27 | The Procter & Gamble Company | Prolyl hydroxylase inhibitors and methods of use |
| CN104313124A (en) * | 2014-06-10 | 2015-01-28 | 中国农业科学院兰州畜牧与兽药研究所 | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit |
Non-Patent Citations (1)
| Title |
|---|
| 马晓华等: "雌二醇对牛视网膜毛细血管内皮细胞VEGF、HIF-1α的调控", 《山东大学耳鼻喉眼学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039558B (en) | 2018-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wong et al. | Real-time PCR for mRNA quantitation | |
| CN104962630A (en) | Fluorescence-quantitative PCR detection kit for gene transcription level of agasicles hygrophila actin | |
| CN110656187B (en) | Kit for detecting pathological tissues or echinococcus in canine feces by multiple RAA and multiple PCR and detection method | |
| CN103725796A (en) | BVDV (bovine viral diarrhea virus) internal control typing fluorescent PCR (polymerase chain reaction) detection kit and preparation thereof | |
| CN105506111A (en) | Method for detecting CNV (copy number variation) mark of MAPK10 gene of Nanyang cattle and application thereof | |
| CN104313124A (en) | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit | |
| CN110885900B (en) | Freeze-dried microchip, kit and method for identifying classical strain of porcine reproductive and respiratory syndrome virus and NADC30-Like strain | |
| CN108796106A (en) | Giardia bovis, Cryptosporidium multiple PCR detection kit and its method | |
| Wang et al. | Development of a naked eye CRISPR-Cas12a and-Cas13a multiplex point-of-care detection of genetically modified swine | |
| CN101434990B (en) | Mink heart DNA detection kit and identification method | |
| CN105039559A (en) | Cattle FABP3 gene transcriptional level fluorescent quantization PCR detection kit | |
| CN105039558A (en) | Cattle HIF-1A gene transcriptional level fluorescent quantization PCR detection kit | |
| CN104894266A (en) | Specific primer for detecting mRNA expression levels of MSTN genes of cows and fluorescent quantitative detecting kit | |
| CN103290134B (en) | Fluorogenic quantitative PCR detection kit for bovine ACTB gene transcription level | |
| CN110343766A (en) | A method of based on calf-derived Cyclospora in QPCR quantitative detection livestock meat | |
| Tao et al. | A simple, affordable, and rapid visual CRISPR-based field test for sex determination of earlier porcine embryos and pork products | |
| CN105039557A (en) | Cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit | |
| CN103740822B (en) | Fluorescence quantitative PCR (polymerase chain reaction) combined rapid detection kit and method for SPF (specific pathogen free) mice pathogenic bacteria nucleic acid | |
| CN103305608B (en) | Ox GAPDH gene transcription level fluorescent quantificationally PCR detecting kit | |
| CN108913790B (en) | Recombinase polymerase isothermal amplification method for detecting coxiella burnetii, special primer and probe and application | |
| CN104894120A (en) | Specific primers for detecting mRNA expression level of bovine LPL (lipoprotein lipase) genes and fluorescent quantitative detecting kit | |
| Chen et al. | An enhanced DNA amplification method to detect the species origins of the rootless hair shafts | |
| CN104962629A (en) | Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level | |
| CN104313125A (en) | Specific primer for detecting bovine GHR genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit | |
| CN108796059A (en) | The system of ox and its Early-stage judgment, method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180615 Termination date: 20210811 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |