CN104962629A - Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level - Google Patents
Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level Download PDFInfo
- Publication number
- CN104962629A CN104962629A CN201510366168.9A CN201510366168A CN104962629A CN 104962629 A CN104962629 A CN 104962629A CN 201510366168 A CN201510366168 A CN 201510366168A CN 104962629 A CN104962629 A CN 104962629A
- Authority
- CN
- China
- Prior art keywords
- adipoq
- specific primer
- mrna expression
- sequence
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a specific primer detecting the cattle ADIPOQ gene mRNA expression level. According to the nucleotide sequence of the specific primer, the upstream primer sequence is 5'-AGAAAGGGAGAACCTGGAGA-3', and the downstream primer sequence is 5'-GGTAAAGCGAATGGGAACA-3'. The invention further provides a corresponding detection kit. The purpose of easily, conveniently and fast detecting the ADIPOQ gene transcription level is achieved, and the mRNA expression state of ADIPOQ genes of different cattle breeds (including dairy cows, cattle and yaks) and different kinds of tissue at different periods can be detected. The specific primer has the advantages of being high in sensitivity, good in stability and low in experiment cost when the mRNA expression level of the ADIPOQ genes is detected.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to the Auele Specific Primer and the fluorescent quantificationally PCR detecting kit that detect ox ADIPOQ mrna expression.
Background technology
(Polymerase Chain Reaction, PCR) is technology the most frequently used in DNA manipulation in vitro technology in polymerase chain reaction.Template DNA, Auele Specific Primer, dNTPs substrate, hot resistant DNA polymerase, magnesium ion etc. are placed in same buffering reaction system by round pcr, carry out repeatedly high-temperature denatured, low-temperature annealing, middle temperature chain extension thermal cycling, realize target dna fragment in reaction solution in 2
ndoubly amplification (wherein n is times of thermal cycle).
Fluorescent quantitative PCR technique is on the basis of common PCR reaction, combines real-time fluorescence detection technique and Computer Analysis technology.Quantitative fluorescent PCR adds specific fluorescent mark material in common PCR reaction system, the amplification situation of real time monitoring of DNA is carried out by the changing conditions of the fluorescent value in PCR reaction system after detecting each thermal cycling, and obtain the fluorescent quantitation change curve of each sample, and then obtain the Ct value (change in fluorescence reaches cycle number during threshold value) of each reaction tubes; Simultaneously, 2(or 10 is detected under identical reaction system and reaction conditions) the target DNA of the dose known amounts of doubly dilution, obtain its Ct value, with the logarithm of starting template number for X-coordinate, with Ct value for ordinate zou preparation standard curve, the initiate dna template number of Ct value to each reaction of typical curve and each sample carries out quantitative assay accordingly.
Although the mrna expression level of Northern blot technology detectable gene, whole experimentation operation more complicated.During Northern blot tests, a main problem is the degraded that there is RNA, so experimental articles all in Northern Blot all needs the process through removing RNA enzyme, as high bake, DEPC process etc.In addition, in Northern Blot, a lot of experimental article such as formaldehyde, EB, DEPC, ultraviolet lamp etc. have certain injury to human body.Although gene chip experiment reduces the workload of experimenter, and in once testing, can detect several thousand gene expression amounts changes, its sensitivity is lower simultaneously.
And SYBR Green is a kind of combination dye be incorporated in double-stranded DNA ditch.After being combined with double-stranded DNA, its fluorescence strengthens greatly.The detection that this character is used for amplified production is ideal.The maximum absorption wavelength of SYBR Green is about 497 nm, and emission wavelength is maximum is about 520 nm.In PCR reaction system, add excessive SYBR fluorescence dye, after SYBR fluorescence dye mixes DNA double-strand specifically, emitting fluorescence signal, and the SYBR dye molecule do not mixed in chain can not launch any fluorescent signal, thus ensure the increase of fluorescent signal and the increase Complete Synchronization of PCR primer.
SYBR Green has many good qualities in the real-time context of detection of nucleic acid, and because it combines with all double-stranded DNAs, need not customize especially because template is different, the program versatility therefore designed is good, and price is relatively low.In addition, because a PCR primer can be combined with polymolecular dyestuff, therefore the sensitivity of SRYB Green is very high.But because SYRB Green combines with all double-stranded DNAs, the false positive therefore caused by the amplified production of primer dimer, strand secondary structure and mistake can affect quantitative accuracy.The impact reducing non-specific product can be helped by the change of fluorescence after measurement raised temperature.The homogeneity carrying out assay products by melting curve contributes to analyzing and obtains quantitative result by SYBR Green.
Adiponectin (Adiponectin, ADIPOQ) assembles agglomerating adipocyte formation primarily of a large amount of, is a kind of endogenous bioactive polypeptide or the protein of adipocyte secretion.ADIPOQ is also a kind of insulin sensitivity enhancing hormone simultaneously, can improve insulin resistance and the arteriosclerosis of mouse; Find the research of human body, ADIPOQ level can indicate the development of type II diabetes and coronary heart disease, and shows the potentiality of anti-diabetic, anti-atherogenic and inflammation in clinical trial.ADIPOQ can act on skeletal muscle increases fatty acid oxidation, and can also act on liver increases insulin resistance glyconeogenesis simultaneously, and when fatty over-deposit, the expression amount of ADIPOQ gene in fatty tissue and blood ADIPOQ level all reduce; And during weight loss, expression amount and the blood ADIPOQ level of ADIPOQ all raise, ADIPOQ promotes the oxidation of skeletal muscle fatty acid by protein kinase, reduce the accumulation of lipid at skeletal muscle, reduce free fatty acids and enter liver, improve hepatic insulin resistance, reduce the generation of glycogen and the synthesis of vldl.In animal productiong, animal body fat deposits and lipid content are the important factors affecting meat, the too high health not only affecting human consumer of animal product lipid content, and reduce efficiency of feed utilization.The research of ADIPOQ, for the molecular breeding research improving carcass quality, growth performance and fatty deposits provides theoretical foundation.
Summary of the invention
The invention provides the Auele Specific Primer and fluorescent quantificationally PCR detecting kit that detect adiponectin (Adiponectin, ADIPOQ) mrna expression.By a large amount of experimental studies, our optimization is a set of effectively can detect the primer of different ox kind (comprising milk cow, ox and yak) ADIPOQ gene mRNA expression amount and the condition of PCR reaction, and be assembled into ADIPOQ gene mRNA expression and detect fluorescent quantitative poly chain reaction test kit, to meet the detection needs of life science, animal medicine and animal science investigator.
The invention provides a kind of Auele Specific Primer detecting ox ADIPOQ mrna expression, the nucleotides sequence of described Auele Specific Primer is classified as:
Upstream primer sequence is: 5 '-AGAAAGGGAGAACCTGGAGA-3 ';
Downstream primer sequence is: 5 '-GGTAAAGCGAATGGGAACA-3 '.
Second object of the present invention is to provide a kind of fluorescent quantificationally PCR detecting kit of ox ADIPOQ mrna expression, and described test kit comprises Auele Specific Primer, and described specific primer sequence is:
Upstream primer sequence is: 5 '-AGAAAGGGAGAACCTGGAGA-3 ';
Downstream primer sequence is: 5 '-GGTAAAGCGAATGGGAACA-3 '.
Preferably, described test kit also comprises SYBR Green dyestuff.
Preferably, described test kit also comprises positive control and negative control.
Preferably, the nucleotide sequence of described positive control is see SEQ ID No.3 in sequence table.
3rd object of the present invention is to provide the using method of mentioned reagent box, for template with cDNA to be measured, the Auele Specific Primer described in claim 1 and SYBR Green dyestuff is utilized to carry out real-time fluorescence quantitative PCR, record Ct value, and using ADIPOQ standard gene as positive control drawing standard curve, typical curve and Ct value carry out quantitative assay accordingly.
Preferably, the reaction conditions of described real-time fluorescence quantitative PCR is: 95 DEG C of denaturations 30 seconds; 95 DEG C 5 seconds, 56.0 DEG C 20 seconds, catch fluorescent signal, circulate 40 times.
4th object of the present invention is to provide a kind of quantitative detecting method of ox ADIPOQ mrna expression, for template with cDNA to be measured, the Auele Specific Primer described in claim 1 and SYBR Green dyestuff is utilized to carry out real-time fluorescence quantitative PCR, record Ct value, and using ADIPOQ standard gene as positive control drawing standard curve, typical curve and Ct value carry out quantitative assay accordingly.
Preferably, the reaction conditions of described real-time fluorescence quantitative PCR is: 95 DEG C of denaturations 30 seconds; 95 DEG C 5 seconds, 56.0 DEG C 20 seconds, catch fluorescent signal, circulate 40 times.
5th the object of the present invention nucleotides sequence be to provide in Auele Specific Primer according to claim 1, the arbitrary described test kit of claim 2-5, sequence table described in SEQ ID No.3 is listed in the application in detection by quantitative ox ADIPOQ mrna expression; Preferably, described ox is ox, milk cow and yak.
Compared with prior art, the invention has the advantages that:
1. present invention achieves the object of simple and efficient detection by quantitative ADIPOQ mrna expression, the mrna expression state of ADIPOQ gene of different ox kind (comprising milk cow, ox and yak), different tissues, different times can be monitored.
2. the present invention has highly sensitive, that good stability, experimental cost are low advantage in detection mrna expression.
3. the present invention can monitor different ox kind (comprising milk cow, ox and yak) adiponectin (Adiponectin, ADIPOQ) gene mRNA transcriptional level, by the research to this gene, the proterties such as carcass quality, growth performance and fatty deposits can be improved.
Accompanying drawing explanation
Accompanying drawing is used to provide a further understanding of the present invention, and forms a part for specification sheets, together with embodiments of the present invention for explaining the present invention, is not construed as limiting the invention.In the accompanying drawings:
Fig. 1 is the fluoroscopic examination result figure of ADIPOQ mrna expression.Wherein, A: amplification curve, X-coordinate is PCR cycle index, and ordinate zou is relative fluorescence value (Relative Fluorescence Units, RFU); B: melting curve, X-coordinate is temperature, and ordinate zou is the variable quantity (d (RFU)/dT) of relative fluorescence at unit temperature.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.
Wherein, SYBR Green dyestuff is purchased from precious biotechnology (Dalian) company limited.
embodiment 1
The fluorescent quantificationally PCR detecting kit of ADIPOQ mrna expression of the present invention is composed of the following components:
2×SYBR GREEN MIX 5mL;
Positive control: standard A DIPOQ gene template 500 μ L;
Primer mixed solution 500 μ L;
Ultrapure water 5mL.
Wherein, 2 × SYBR GREEN MIX is composed of the following components: Taq archaeal dna polymerase 0.1 U/ μ L, dNTPs substrate 0.4 mmol/L, Mg
2+5.0 mmol/L, KCl 100 TrisHCl 20 mmol/L of mmol/L, pH8.3, mass percentage are gelatin and the SYBR Green dyestuff of 0.02%.
Primer mixed solution: upstream primer 8 μm of ol/L, downstream primer 8 μm of ol/L.Wherein, the sequence of upstream primer is: 5 '-AGAAAGGGAGAACCTGGAGA-3 ',
The sequence of downstream primer is: 5 '-GGTAAAGCGAATGGGAACA-3 '.
Standard A DIPOQ gene template: to be 0.8 μm of ol/L, ADIPOQ gene template sequence be concentration
5’-AGAAAGGGAGAACCTGGAGAAAGTGCCTATGTATACCGCTCAGCATTCAGTGTGGGACTGGAGAGACAGGTCACTGTCCCCAATGTTCCCATTCGCTTTACC-3’。
Ultrapure water: purity is more than 18.25 M Ω CM.
The step applying fluorescent quantificationally PCR detecting kit detection by quantitative ox ADIPOQ mrna expression of the present invention is as follows:
(1) prepare ADIPOQ fluorescence quantitative PCR reaction solution in proportion, 20 μ L reaction systems are as table 1:
Table 1 ADIPOQ fluorescence quantitative PCR reaction solution 20 μ L reaction system
Negative control and positive control should be provided with in a quantitative reaction simultaneously.
Wherein, negative control is ultrapure water; Positive control is standard A DIPOQ gene template.
(2) get 2 × SYBR GREEN MIX 1000 μ L, primer mixed solution 100 μ L, ultrapure water 800 μ L fully mixes, the FQ-PCR preparing 1900 μ L reacts premixed liquid;
(3) fully mix above various liquid, premixed liquid is distributed into 100 tubules by 19 μ L/ pipes, adds in the special PCR reaction tubes of fluorescent quantitation or Sptting plate;
(4) preparation is managed with the standard A DIPOQ gene template 5 of the dilution series such as 10E+8/ML, 10E+7/ML, 10E+6/ML, 10E+5/ML, 10E+4/ML, often pipe 10 μ L;
(5) FQ-PCR amplification: add 1 μ L cDNA to be measured, ultrapure water (negative control) or standard A DIPOQ gene template (positive control) respectively each being equipped with in the reaction tubes of 19 μ L PCR reaction premixed liquids, concussion mixing, after brief centrifugation, upper machine is in quantitative real time PCR Instrument (Bio-Rad CFX96TM), denaturation 30 seconds at 95 DEG C, then by 95 DEG C 5 seconds, 56.0 DEG C of thermal cyclings in 20 seconds 40 times, and 56.0 DEG C time detection record fluorescent signal, according to this fluorescent signal make melting curve.Pcr amplification curve shows ADIPOQ gene by fluorescence signal value standard compliant " S " type curve see Figure 1A, Figure 1A, and melting curve (Figure 1B) shows that this fluorescent quantitation has the detection specificity of height.Therefore, the present invention can measure the expression level of ADIPOQ accurately, and has the specificity of height, and effect is very desirable, completely the same with the expection of design.
Wherein, the preparation method of cDNA to be measured is as follows:
A, RNA leaching process: the tissue gathering ox kind (ox, milk cow or yak), is organized in 100mg in liquid nitrogen and grinds, add 1mL TRIzol, carry out homogenized with Syrup-homogenizing instrument; Homogenised sample is placed 5 minutes in room temperature (15-30 DEG C), nucleic acid-protein mixture is separated completely; Add 0.2 mL chloroform, thermal agitation 15 seconds, room temperature places 3 minutes; Centrifugal 15 minutes (sample is divided into three layers: bottom is yellow organic phase, and upper strata is colourless aqueous phase and a middle layer) of 4 DEG C of 10000 × g; Aqueous phase is transferred in new pipe; Add the RNA in 0.5 mL isopropanol precipitating aqueous phase, room temperature places 10 minutes; , after centrifugal, at the bottom of pipe side and pipe, there is gelatinous precipitate in centrifugal 10 minutes of 4 DEG C of 10000 × g; Remove supernatant, use 1mL 75 % washing with alcohol RNA precipitation; Centrifugal 5 minutes of 4 DEG C of 7000 × g, abandon supernatant; Room temperature is placed dry RNA and is precipitated; Adding 25-200 μ l beats several times without the water rifle head suction of RNase, and 58 DEG C of placements make RNA dissolve in 10 minutes, now obtain the RNA solution of ox kind.
B, transcriptive process,reversed, namely obtain the process of cDNA: in PCR pipe, add 50 μm of ol/L oligo dT solution 1.5 μ L, 10 mmol/L dNTP mixed solution 1 μ L, ox total serum IgE 2.5 μ L, RNase free dH
2o 5 μ L, mixing, places after 5 minutes, is transferred to cooled on ice rapidly at 65 DEG C.Continue to add 5 × Prime Script in above-mentioned PCR pipe
tMdamping fluid 4 μ L, 40 U/ μ L RNA enzyme inhibitors 0.5 μ L, 200 U/ μ L Prime Script
tMthermoScript II 1 μ L, RNase free dH
2o 4.5 μ L, mixing, in 30 DEG C of 10 min, 42 DEG C of 60 min, processes under 70 DEG C of 15 min condition.
(6) after PCR reaction terminates, read the Ct value of each reaction in order to quantitative analysis: with the logarithm of starting template number for X-coordinate, with the Ct value of positive control for ordinate zou preparation standard curve, the starting template number of Ct value to each reaction of typical curve and each sample carries out quantitative assay accordingly.Carry out PCR primer electrophoresis in 3% sepharose, ethidium bromide staining simultaneously, observe under gel imaging system, the result of each PCR reaction of gray scale scanning analytic record.To determine the size of amplified production, thus determine further increase whether be goal gene.
Because the present invention is when designing ADIPOQ gene by fluorescence quantitative primer, selected gene fragment complete homology in milk cow, ox, yak, derive from the ADIPOQ gene of these species so use Auele Specific Primer of the present invention and adopt method of the present invention effectively to increase, thus detect the mrna expression amount of the ADIPOQ gene of each ox kind.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Sequence table
<110> Lanzhou Livestock and Animal Drug Inst., Chinese Academy of Agricultural Science
<120> detects Auele Specific Primer and the fluorescence quantitative detection kit of ox ADIPOQ mrna expression
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> artificial sequence
<400> 1
agaaagggag aacctggaga 20
<210> 2
<211> 19
<212> DNA
<213> artificial sequence
<400> 2
ggtaaagcga atgggaaca 19
<210> 3
<211> 102
<212> DNA
<213> artificial sequence
<400> 3
agaaagggag aacctggaga aagtgcctat gtataccgct cagcattcag tgtgggactg 60
gagagacagg tcactgtccc caatgttccc attcgcttta cc 102
Claims (10)
1. detect the Auele Specific Primer of ox ADIPOQ mrna expression, it is characterized in that: the nucleotides sequence of described Auele Specific Primer is classified as:
Upstream primer sequence is: 5 '-AGAAAGGGAGAACCTGGAGA-3 ';
Downstream primer sequence is: 5 '-GGTAAAGCGAATGGGAACA-3 '.
2. a fluorescent quantificationally PCR detecting kit for ox ADIPOQ mrna expression, is characterized in that: described test kit comprises Auele Specific Primer, and described specific primer sequence is:
Upstream primer sequence is: 5 '-AGAAAGGGAGAACCTGGAGA-3 ';
Downstream primer sequence is: 5 '-GGTAAAGCGAATGGGAACA-3 '.
3. test kit according to claim 2, is characterized in that: described test kit also comprises SYBR Green dyestuff.
4. the test kit according to Claims 2 or 3, is characterized in that: described test kit also comprises positive control and negative control.
5. test kit according to claim 4, is characterized in that: the nucleotide sequence of described positive control is see SEQ ID No.3 in sequence table.
6. the using method of the arbitrary described test kit of claim 2-5, it is characterized in that: be for template with cDNA to be measured, the Auele Specific Primer described in claim 1 and SYBR Green dyestuff is utilized to carry out real-time fluorescence quantitative PCR, record Ct value, and using ADIPOQ standard gene as positive control drawing standard curve, typical curve and Ct value carry out quantitative assay accordingly.
7. using method according to claim 6, is characterized in that: the reaction conditions of described real-time fluorescence quantitative PCR is: 95 DEG C of denaturations 30 seconds; 95 DEG C 5 seconds, 56.0 DEG C 20 seconds, catch fluorescent signal, circulate 40 times.
8. the quantitative detecting method of an ox ADIPOQ mrna expression, it is characterized in that: be for template with cDNA to be measured, the Auele Specific Primer described in claim 1 and SYBR Green dyestuff is utilized to carry out real-time fluorescence quantitative PCR, record Ct value, and using ADIPOQ standard gene as positive control drawing standard curve, typical curve and Ct value carry out quantitative assay accordingly.
9. using method according to claim 8, is characterized in that: the reaction conditions of described real-time fluorescence quantitative PCR is: 95 DEG C of denaturations 30 seconds; 95 DEG C 5 seconds, 56.0 DEG C 20 seconds, catch fluorescent signal, circulate 40 times.
10. the nucleotides sequence in Auele Specific Primer according to claim 1, the arbitrary described test kit of claim 2-5, sequence table described in SEQ ID No.3 is listed in the application in detection by quantitative ox ADIPOQ mrna expression; Preferably, described ox is ox, milk cow and yak.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510366168.9A CN104962629A (en) | 2015-06-29 | 2015-06-29 | Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510366168.9A CN104962629A (en) | 2015-06-29 | 2015-06-29 | Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104962629A true CN104962629A (en) | 2015-10-07 |
Family
ID=54216714
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510366168.9A Pending CN104962629A (en) | 2015-06-29 | 2015-06-29 | Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104962629A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107083431A (en) * | 2017-05-23 | 2017-08-22 | 铜仁学院 | The genetic marker related to Sheep Muscle Traits and its application |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102477461A (en) * | 2010-11-25 | 2012-05-30 | 吉林农业科技学院 | Application of adiponcetin gene expression level in beef cattle muscle marbling grade identification |
CN102634520A (en) * | 2011-11-01 | 2012-08-15 | 云南农业大学 | Intramuscular fat deposition related adiponectin gene |
CN104388435A (en) * | 2014-10-28 | 2015-03-04 | 四川农业大学 | Construction and application of goat adiponectin gene eukaryotic expression vector |
-
2015
- 2015-06-29 CN CN201510366168.9A patent/CN104962629A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102477461A (en) * | 2010-11-25 | 2012-05-30 | 吉林农业科技学院 | Application of adiponcetin gene expression level in beef cattle muscle marbling grade identification |
CN102634520A (en) * | 2011-11-01 | 2012-08-15 | 云南农业大学 | Intramuscular fat deposition related adiponectin gene |
CN104388435A (en) * | 2014-10-28 | 2015-03-04 | 四川农业大学 | Construction and application of goat adiponectin gene eukaryotic expression vector |
Non-Patent Citations (1)
Title |
---|
孙永刚 等: "胰岛素可逆性抑制牛脂肪细胞脂联素mRNA 的表达", 《农业生物技术学报》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107083431A (en) * | 2017-05-23 | 2017-08-22 | 铜仁学院 | The genetic marker related to Sheep Muscle Traits and its application |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103725796B (en) | Mark parting fluorescence PCR detection kit and preparation thereof in a kind of bovine viral diarrhea virus | |
CN103667514B (en) | A kind of human interleukin 2 8B gene pleiomorphism fluorescence PCR detection reagent kits | |
CN105112522A (en) | Detection primer combination and kit for HER2 (human epidermal growth factor receptor 2) gene amplification | |
US20230203591A1 (en) | Detection method using eukaryotic cells | |
CN109913540A (en) | A kind of kit and application thereof detecting CYP3A polymorphic site | |
CN104498629A (en) | Duplex real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit for H3N2 subtype avian influenza virus (AIV) | |
CN104313124A (en) | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit | |
CN105420393A (en) | Primers, probe, and kit for detecting BRCA1 gene expression | |
Wan et al. | Genetic structure, polymorphism identification of LGP2 gene and their relationship with the resistance/susceptibility to GCRV in grass carp, Ctenopharyngodon idella | |
CN109852715A (en) | A kind of kit of TaqMan probe method detection leptospira interrogans metalloprotease gene | |
CN109371022A (en) | A kind of circular rna hsa_circKPNA2_002 and its specificity amplification primer and application | |
CN104894266B (en) | A kind of specific primer and fluorescence quantitative detection kit for detecting ox MSTN mrna expressions | |
CN104962629A (en) | Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level | |
CN104894120A (en) | Specific primers for detecting mRNA expression level of bovine LPL (lipoprotein lipase) genes and fluorescent quantitative detecting kit | |
CN108998532A (en) | A kind of diagnosis and treatment marker of rectal adenocarcinoma | |
CN101760518A (en) | Method for extracting live bacteria RNA in Mycobacterium tuberculosis and detection kit thereof | |
CN104278106B (en) | Duplex fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for duck tembusu virus and egg drop syndrome virus | |
CN104894267A (en) | Specific primer for detecting mRNA expression levels of MYF5 genes of cows and fluorescent quantitative detecting kit | |
CN104946768A (en) | Specific primers for detecting bovine LF gene mRNA (messenger ribonucleic acid) expression level and fluorescent quantitative detection kit | |
CN105039559A (en) | Cattle FABP3 gene transcriptional level fluorescent quantization PCR detection kit | |
CN101671728B (en) | Method for detecting expression quantity of carcinoembryonic antigen mRNA and special kit thereof | |
CN105316424A (en) | Molecular marker related to weight, breast and leg muscle weight and breast muscle fiber characteristics of Gaoyou ducks and acquisition method and application thereof | |
CN104313125A (en) | Specific primer for detecting bovine GHR genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit | |
Chen et al. | An enhanced DNA amplification method to detect the species origins of the rootless hair shafts | |
CN108707696A (en) | A kind of gene C type duck hepatitis A virus detection kit and application based on constant temperature isolation type fluorescent PCR platform |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151007 |